Starting /dee2/code/volunteer_pipeline.sh SRR11389814 current disk space = 1544549715968 free memory = 1603698592 SRR11389814 SRAfilesize 3f0d2619a035e98f5c2ecdbe9652455f SRR11389814.sra SRR11389814.sra file validated SRR11389814 is paired end SRR11389814 is conventional basespace SRR11389814 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9265 32.0 32.0 32.0 32.0 32.0 2 31.012 32.0 32.0 32.0 32.0 32.0 3 31.0415 32.0 32.0 32.0 32.0 32.0 4 31.168 32.0 32.0 32.0 32.0 32.0 5 31.223 32.0 32.0 32.0 32.0 32.0 6 33.88025 36.0 36.0 36.0 32.0 36.0 7 34.049 36.0 36.0 36.0 32.0 36.0 8 33.92875 36.0 36.0 36.0 32.0 36.0 9 34.0125 36.0 36.0 36.0 32.0 36.0 10-11 33.997625 36.0 36.0 36.0 32.0 36.0 12-13 34.008624999999995 36.0 36.0 36.0 32.0 36.0 14-15 34.129875 36.0 36.0 36.0 32.0 36.0 16-17 34.022375 36.0 36.0 36.0 32.0 36.0 18-19 33.930875 36.0 36.0 36.0 32.0 36.0 20-21 33.965375 36.0 36.0 36.0 32.0 36.0 22-23 33.89575 36.0 36.0 36.0 32.0 36.0 24-25 33.826 36.0 36.0 36.0 32.0 36.0 26-27 33.512625 36.0 36.0 36.0 21.0 36.0 28-29 33.692750000000004 36.0 36.0 36.0 32.0 36.0 30-31 33.5625 36.0 36.0 36.0 29.5 36.0 32-33 33.591499999999996 36.0 36.0 36.0 27.0 36.0 34-35 33.511125 36.0 36.0 36.0 26.5 36.0 36-37 33.47730226133832 36.0 36.0 36.0 27.0 36.0 38-39 33.4733550162622 36.0 36.0 36.0 27.0 36.0 40-41 33.17481273513814 36.0 36.0 36.0 17.5 36.0 42-43 33.123280478007985 36.0 36.0 36.0 21.0 36.0 44-45 32.903431863727455 36.0 36.0 36.0 14.0 36.0 46-47 32.944157451711234 36.0 36.0 36.0 17.5 36.0 48-49 32.82997185073097 36.0 34.0 36.0 14.0 36.0 50-51 32.83029556921811 36.0 34.0 36.0 14.0 36.0 52-53 32.79499856172653 36.0 34.0 36.0 14.0 36.0 54-55 32.72987013019882 36.0 36.0 36.0 14.0 36.0 56-57 32.49874087131705 36.0 34.0 36.0 14.0 36.0 58-59 32.503684260675634 36.0 32.0 36.0 14.0 36.0 60-61 32.3421112532357 36.0 32.0 36.0 14.0 36.0 62-63 32.17691393586544 36.0 32.0 36.0 14.0 36.0 64-65 32.514946075774105 36.0 32.0 36.0 14.0 36.0 66-67 32.53088420863517 36.0 32.0 36.0 14.0 36.0 68-69 32.48469725367371 36.0 32.0 36.0 14.0 36.0 70-71 32.50590721024537 36.0 32.0 36.0 14.0 36.0 72-73 32.33407504802278 36.0 32.0 36.0 14.0 36.0 74-75 32.265957148220394 36.0 32.0 36.0 14.0 36.0 76 32.09056745584367 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 7.0 25 14.0 26 41.0 27 71.0 28 98.0 29 184.0 30 265.0 31 341.0 32 507.0 33 730.0 34 1022.0 35 714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.293646823411706 10.055027513756878 12.181090545272637 40.47023511755878 2 23.23661830915458 15.632816408204103 31.090545272636316 30.040020010005 3 22.411205602801402 16.933466733366682 25.087543771885944 35.56778389194598 4 28.01400700350175 24.537268634317158 18.734367183591797 28.714357178589296 5 29.41470735367684 25.987993996998497 22.061030515257627 22.536268134067033 6 23.861930965482742 30.990495247623812 22.761380690345174 22.386193096548272 7 18.70935467733867 24.88744372186093 33.1415707853927 23.261630815407706 8 19.93496748374187 24.83741870935468 29.914957478739368 25.312656328164078 9 22.0360180090045 19.78489244622311 32.491245622811405 25.68784392196098 10-11 25.30015007503752 28.189094547273637 20.99799899949975 25.512756378189096 12-13 25.350175087543768 22.923961980990494 23.21160580290145 28.51425712856428 14-15 23.21160580290145 25.22511255627814 24.599799899949975 26.96348174087044 16-17 25.662831415707853 23.224112056028016 24.137068534267133 26.975987993997 18-19 24.12456228114057 23.59929964982491 25.287643821910955 26.988494247123562 20-21 25.15007503751876 23.649324662331164 25.125062531265634 26.075537768884445 22-23 24.69984992496248 26.93846923461731 23.074037018509255 25.287643821910955 24-25 24.012006003001503 23.936968484242122 24.487243621810904 27.56378189094547 26-27 24.187093546773387 24.674837418709355 23.899449724862432 27.238619309654826 28-29 24.77488744372186 25.062531265632813 24.324662331165584 25.83791895947974 30-31 24.299649824912457 23.299149574787396 24.73736868434217 27.66383191595798 32-33 24.537268634317158 25.362681340670335 23.78689344672336 26.313156578289142 34-35 24.074537268634316 22.936468234117058 25.250125062531264 27.738869434717362 36-37 26.241400875547217 22.57661038148843 23.889931207004377 27.292057535959973 38-39 26.482361771328495 24.54340755566675 23.58018513885414 25.39404553415061 40-41 24.96558628457014 25.691402828181705 23.35127017895132 25.991740708296835 42-43 25.01251877816725 24.461692538808215 24.44917376064096 26.076614922383573 44-45 23.76002004008016 24.123246492985974 24.874749498997996 27.241983967935873 46-47 26.330953275710883 23.261931604659903 24.11374170111487 26.293373418514342 48-49 25.501504513540624 23.921765295887663 24.34804413239719 26.22868605817452 50-51 25.790662650602407 24.284638554216865 24.246987951807228 25.67771084337349 52-53 24.41290970739671 24.098957679266608 22.818033404495793 28.670099208840888 54-55 25.51880266633128 23.154320211294177 24.487485850836375 26.839391271538172 56-57 24.263409720473433 23.09242004532863 24.76706119365399 27.877109040543946 58-59 24.489795918367346 24.33862433862434 24.02368354749307 27.14789619551524 60-61 25.4006309148265 23.20504731861199 24.65615141955836 26.738170347003155 62-63 25.47408343868521 23.67888748419722 23.615676359039192 27.231352718078384 64-65 25.905751203445654 23.22016721560679 23.650874081580948 27.22320749936661 66-67 24.958719674838054 25.12384097548584 23.282103391337483 26.635335958338622 68-69 25.2769642174965 25.226028269451167 23.48147204889851 26.015535464153828 70-71 25.59774964838256 25.687252269530752 22.516302263137707 26.198695818948988 72-73 24.758718311671597 25.196242439840432 22.970016728863722 27.07502251962424 74-75 25.338253382533825 21.716550498838323 24.682246822468223 28.26294929615963 76 28.335212326193158 0.0 32.46899661781285 39.195791055993986 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 3.0 23 2.5 24 2.0 25 2.5 26 4.0 27 4.0 28 7.0 29 13.0 30 16.0 31 23.0 32 29.5 33 29.5 34 39.0 35 57.5 36 73.0 37 87.0 38 103.5 39 119.0 40 136.5 41 175.5 42 195.5 43 182.0 44 188.5 45 202.0 46 203.0 47 203.0 48 203.0 49 194.0 50 180.5 51 174.5 52 164.0 53 143.0 54 128.0 55 126.0 56 131.5 57 124.0 58 110.5 59 111.0 60 119.5 61 108.5 62 92.0 63 97.5 64 92.5 65 89.0 66 83.5 67 71.0 68 72.5 69 75.5 70 69.0 71 61.0 72 66.5 73 67.5 74 51.0 75 36.0 76 29.0 77 25.0 78 19.5 79 14.5 80 11.5 81 9.5 82 7.0 83 4.0 84 3.5 85 2.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 1.0 37 0.0 38 0.0 39 1.0 40 1.0 41 0.0 42 2.0 43 1.0 44 0.0 45 0.0 46 1.0 47 2.0 48 2.0 49 2.0 50 2.0 51 0.0 52 3.0 53 3.0 54 3.0 55 3.0 56 0.0 57 0.0 58 4.0 59 3.0 60 3.0 61 4.0 62 4.0 63 4.0 64 4.0 65 6.0 66 5.0 67 5.0 68 5.0 69 9.0 70 9.0 71 10.0 72 21.0 73 62.0 74 309.0 75 843.0 76 2661.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31783729156139 98.275 2 0.5811015664477008 1.15 3 0.0 0.0 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025265285497726126 0.17500000000000002 8 0.025265285497726126 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 8 0.2 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 7 0.17500000000000002 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAAT 15 0.0021607182 69.212494 37 AATCTCG 15 0.0021607182 69.212494 41 ACGTCTG 15 0.0021607182 69.212494 15 ACTCCAG 15 0.0021607182 69.212494 23 GAGCACA 15 0.0021607182 69.212494 9 TCCGGAG 15 0.0021607182 69.212494 34 AGAGCAC 15 0.0021607182 69.212494 8 AGCACAC 15 0.0021607182 69.212494 10 CTCCGGA 15 0.0021607182 69.212494 33 ACACGTC 20 0.0067544393 51.909374 13 CACACGT 20 0.0067544393 51.909374 12 CGGAGAA 20 0.0067544393 51.909374 36 CACGTCT 20 0.0067544393 51.909374 14 GCACACG 20 0.0067544393 51.909374 11 >>END_MODULE SRR11389814 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389814_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.528 32.0 32.0 32.0 32.0 32.0 2 30.001 32.0 32.0 32.0 21.0 32.0 3 29.901 32.0 32.0 32.0 21.0 32.0 4 29.7525 32.0 32.0 32.0 14.0 32.0 5 29.86225 32.0 32.0 32.0 21.0 32.0 6 32.807 36.0 36.0 36.0 14.0 36.0 7 32.9385 36.0 36.0 36.0 21.0 36.0 8 32.86325 36.0 36.0 36.0 14.0 36.0 9 32.677 36.0 36.0 36.0 14.0 36.0 10-11 32.599125 36.0 36.0 36.0 14.0 36.0 12-13 32.72325 36.0 36.0 36.0 14.0 36.0 14-15 32.54425 36.0 34.0 36.0 14.0 36.0 16-17 32.444375 36.0 32.0 36.0 14.0 36.0 18-19 32.677 36.0 36.0 36.0 14.0 36.0 20-21 32.228125000000006 36.0 32.0 36.0 14.0 36.0 22-23 32.524125 36.0 32.0 36.0 14.0 36.0 24-25 32.448750000000004 36.0 34.0 36.0 14.0 36.0 26-27 32.164874999999995 36.0 32.0 36.0 14.0 36.0 28-29 32.354625 36.0 34.0 36.0 14.0 36.0 30-31 32.247749999999996 36.0 34.0 36.0 14.0 36.0 32-33 32.207 36.0 32.0 36.0 14.0 36.0 34-35 32.133875 36.0 32.0 36.0 14.0 36.0 36-37 32.23593546004827 36.0 32.0 36.0 14.0 36.0 38-39 32.11015037593985 36.0 32.0 36.0 14.0 36.0 40-41 32.17097727124718 36.0 34.0 36.0 14.0 36.0 42-43 32.13319820223339 36.0 32.0 36.0 14.0 36.0 44-45 32.074153074027606 36.0 32.0 36.0 14.0 36.0 46-47 31.96761928283032 36.0 32.0 36.0 14.0 36.0 48-49 32.02176993773957 36.0 32.0 36.0 14.0 36.0 50-51 31.933440964792844 36.0 32.0 36.0 14.0 36.0 52-53 31.794936631894963 36.0 32.0 36.0 14.0 36.0 54-55 32.08525785503309 36.0 32.0 36.0 14.0 36.0 56-57 31.90766902119072 36.0 32.0 36.0 14.0 36.0 58-59 31.869814441080837 36.0 32.0 36.0 14.0 36.0 60-61 31.768302882696112 36.0 32.0 36.0 14.0 36.0 62-63 31.36000789134326 36.0 32.0 36.0 14.0 36.0 64-65 31.236822962926887 36.0 32.0 36.0 14.0 36.0 66-67 31.204103302620318 36.0 32.0 36.0 14.0 36.0 68-69 31.241368968305494 36.0 32.0 36.0 14.0 36.0 70-71 31.412015151817748 36.0 32.0 36.0 14.0 36.0 72-73 31.313605940480294 36.0 32.0 36.0 14.0 36.0 74-75 31.279934953071166 36.0 32.0 36.0 14.0 36.0 76 30.859315589353614 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 3.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 22.0 16 48.0 17 22.0 18 10.0 19 14.0 20 20.0 21 17.0 22 24.0 23 24.0 24 42.0 25 55.0 26 62.0 27 98.0 28 128.0 29 200.0 30 255.0 31 342.0 32 449.0 33 633.0 34 915.0 35 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.8290298320381 16.219603910754575 11.631987966909 34.31937829029832 2 30.584106292303836 23.08849335673101 25.394835798445726 20.932564552519427 3 27.662240040090204 25.757955399649212 20.12027060886996 26.45953395139063 4 30.66900526183914 29.04034076672513 17.01327987972939 23.277374091706342 5 30.243046855424705 31.345527436732652 18.767226259082936 19.644199448759707 6 25.65772989225758 32.4981207717364 21.147582059634175 20.696567276371837 7 24.818250188017046 16.094259212835297 33.19127600902482 25.89621459012284 8 24.85592583312453 22.60085191681283 23.82861438236031 28.71460786770233 9 24.786967418546364 21.503759398496243 26.04010025062657 27.669172932330827 10-11 28.60190763052209 26.543674698795183 18.96335341365462 25.891064257028113 12-13 29.066700163296066 19.381987187539256 23.389021479713605 28.162291169451077 14-15 27.550251256281406 23.253768844221106 23.907035175879397 25.28894472361809 16-17 29.125847776940468 24.315498618437577 21.338859583019342 25.219794021602617 18-19 28.71137905048983 23.034413463953783 22.43154986184376 25.822657623712637 20-21 26.730310262529834 23.414143951764853 24.054766989071723 25.80077879663359 22-23 28.09948498932295 24.155256877276724 22.63534731817611 25.109910815224218 24-25 27.80218400903728 24.124513618677042 23.082716204342915 24.990586167942762 26-27 25.831972874544768 25.379881954037426 22.71756875549416 26.070576415923647 28-29 27.995478522984175 24.415975885455914 21.602612408942477 25.985933182617433 30-31 27.84476262245667 23.38608389851796 22.95905551369003 25.810097965335345 32-33 26.38784225069078 25.62170308967596 22.532027128862094 25.45842753077116 34-35 28.44762622456669 23.09721175584024 23.109771414217533 25.345390605375535 36-37 27.579713783580218 24.165202108963094 22.92242028621642 25.33266382124027 38-39 25.967336683417088 24.937185929648244 23.668341708542716 25.42713567839196 40-41 27.826633165829147 23.316582914572866 23.50502512562814 25.351758793969847 42-43 27.102451288497797 23.029541169076055 23.9220615964802 25.945945945945947 44-45 27.517284726587054 23.469516027655562 23.58265241986172 25.43054682589566 46-47 27.008675971331574 23.66402615365271 23.689173896642775 25.63812397837294 48-49 27.41346758967904 23.524229074889867 23.423536815607303 25.63876651982379 50-51 26.966717095310138 24.646999495713565 23.2476046394352 25.1386787695411 52-53 28.951348626165867 23.229140408369044 22.08217796823796 25.737332997227124 54-55 27.979797979797983 23.244949494949495 23.257575757575758 25.517676767676768 56-57 28.205128205128204 23.69584438549956 23.405330301882028 24.693697107490213 58-59 29.06242102602982 23.540561031084152 22.20116249684104 25.195855446044984 60-61 27.659574468085108 22.011144883485308 23.822188449848024 26.50709219858156 62-63 28.424657534246577 24.061390157280567 22.754946727549466 24.759005580923386 64-65 27.694458566344686 24.110320284697508 22.369089984748346 25.826131164209453 66-67 27.321360336262895 24.50643230161763 22.825117819386065 25.347089542733407 68-69 27.058072750478622 24.977664326738992 23.637523931078494 24.32673899170389 70-71 27.15732786254648 24.43903064495448 22.823438902423387 25.58020259007565 72-73 26.56774193548387 25.006451612903223 22.993548387096773 25.432258064516127 74-75 26.13079019073569 22.765667574931882 23.801089918256128 27.30245231607629 76 31.494864967668313 0.0 31.913275009509317 36.59186002282237 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 1.0 19 3.5 20 4.5 21 4.5 22 4.0 23 2.5 24 1.5 25 3.5 26 7.5 27 7.5 28 6.5 29 7.5 30 16.5 31 23.5 32 24.5 33 31.0 34 43.5 35 52.0 36 58.5 37 71.0 38 89.5 39 113.5 40 130.0 41 138.5 42 156.0 43 166.5 44 166.5 45 177.0 46 183.0 47 179.5 48 173.5 49 159.0 50 155.5 51 156.5 52 154.5 53 158.5 54 155.5 55 142.0 56 126.5 57 127.0 58 130.5 59 121.5 60 115.0 61 116.5 62 114.0 63 111.0 64 105.0 65 99.5 66 93.0 67 85.5 68 94.0 69 101.5 70 87.5 71 75.0 72 68.5 73 61.5 74 56.0 75 46.5 76 38.0 77 28.5 78 21.0 79 19.0 80 20.5 81 18.5 82 13.0 83 11.5 84 8.5 85 5.0 86 2.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 0.5 96 1.0 97 1.5 98 1.5 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.27499999999999997 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.27499999999999997 8 0.22499999999999998 9 0.25 10-11 0.4 12-13 0.4875 14-15 0.5 16-17 0.475 18-19 0.475 20-21 0.4875 22-23 0.4875 24-25 0.41250000000000003 26-27 0.46249999999999997 28-29 0.475 30-31 0.475 32-33 0.475 34-35 0.475 36-37 0.18794637263500816 38-39 0.2506265664160401 40-41 0.21311269900965274 42-43 0.2382743917732631 44-45 0.18820577164366373 46-47 0.18825301204819278 48-49 0.18844221105527637 50-51 0.2515090543259557 52-53 0.16358374229268904 54-55 0.1890359168241966 56-57 0.1387487386478305 58-59 0.12619888944977284 60-61 0.18960940462646947 62-63 0.1519756838905775 64-65 0.15228426395939085 66-67 0.12721027859051012 68-69 0.051026916698558494 70-71 0.05126233499935922 72-73 0.07735946364105209 74-75 0.054466230936819175 76 0.03802281368821293 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 1.0 37 0.0 38 0.0 39 1.0 40 1.0 41 0.0 42 2.0 43 1.0 44 0.0 45 0.0 46 2.0 47 2.0 48 2.0 49 2.0 50 2.0 51 0.0 52 3.0 53 3.0 54 3.0 55 2.0 56 0.0 57 0.0 58 4.0 59 3.0 60 3.0 61 4.0 62 4.0 63 4.0 64 4.0 65 5.0 66 5.0 67 6.0 68 5.0 69 10.0 70 11.0 71 8.0 72 20.0 73 68.0 74 256.0 75 914.0 76 2630.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.4534005037783375 0.8999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025188916876574305 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818715 spots for SRR11389814.sra Written 818715 spots for SRR11389814.sra Read 818719 spots for SRR11389814.sra Written 818719 spots for SRR11389814.sra SRR ids: ['SRR11389814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ta6k87lp SRR11389814.sra spots: 16374304 blocks: [[1, 818715], [818716, 1637430], [1637431, 2456145], [2456146, 3274860], [3274861, 4093575], [4093576, 4912290], [4912291, 5731005], [5731006, 6549720], [6549721, 7368435], [7368436, 8187150], [8187151, 9005865], [9005866, 9824580], [9824581, 10643295], [10643296, 11462010], [11462011, 12280725], [12280726, 13099440], [13099441, 13918155], [13918156, 14736870], [14736871, 15555585], [15555586, 16374304]] SRR11389814 file size 3098058 SRR11389814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389814 SRR11389814_1.fastq SRR11389814_2.fastq Input file: SRR11389814_1.fastq Paired file: SRR11389814_2.fastq trimmed: SRR11389814-trimmed-pair1.fastq, SRR11389814-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:15:53 2024 >> started Sat Dec 7 07:16:06 2024 >> done (12.529s) 16374304 read pairs processed; of these: 734 ( 0.00%) short read pairs filtered out after trimming by size control 370468 ( 2.26%) empty read pairs filtered out after trimming by size control 16003102 (97.73%) read pairs available; of these: 20875 ( 0.13%) trimmed read pairs available after processing 15982227 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 12 0.00% 23 11 0.00% 24 15 0.00% 25 14 0.00% 26 17 0.00% 27 9 0.00% 28 21 0.00% 29 13 0.00% 30 15 0.00% 31 14 0.00% 32 19 0.00% 33 22 0.00% 34 20 0.00% 35 1560 0.01% 36 1702 0.01% 37 1950 0.01% 38 2226 0.01% 39 2684 0.02% 40 3244 0.02% 41 3690 0.02% 42 4232 0.03% 43 4574 0.03% 44 5107 0.03% 45 5505 0.03% 46 5925 0.04% 47 6462 0.04% 48 7093 0.04% 49 7808 0.05% 50 8494 0.05% 51 9355 0.06% 52 10353 0.06% 53 11687 0.07% 54 12497 0.08% 55 13320 0.08% 56 14463 0.09% 57 15419 0.10% 58 16524 0.10% 59 17531 0.11% 60 18896 0.12% 61 20000 0.12% 62 21670 0.14% 63 23130 0.14% 64 25195 0.16% 65 26823 0.17% 66 28790 0.18% 67 31027 0.19% 68 30465 0.19% 69 32374 0.20% 70 34400 0.21% 71 39901 0.25% 72 50231 0.31% 73 162434 1.02% 74 1115736 6.97% 75 6784827 42.40% 76 7363583 46.01% 16003102 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=21 prefix-density=0.25 prefix-fanout=2.6 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=163.95 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=22.3 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.15 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=159.47 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=19.0 sequence=CCGCCGCCGCCG SRR11389814 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:16:34 Started mapping on | Dec 07 07:16:34 Finished on | Dec 07 07:17:45 Mapping speed, Million of reads per hour | 811.42 Number of input reads | 16003102 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 14241401 Uniquely mapped reads % | 88.99% Average mapped length | 149.22 Number of splices: Total | 6283860 Number of splices: Annotated (sjdb) | 5979177 Number of splices: GT/AG | 6192723 Number of splices: GC/AG | 79246 Number of splices: AT/AC | 2718 Number of splices: Non-canonical | 9173 Mismatch rate per base, % | 0.96% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 841972 % of reads mapped to multiple loci | 5.26% Number of reads mapped to too many loci | 65493 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 1.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 919729 919729 919729 N_multimapping 841972 841972 841972 N_noFeature 538444 13768634 752592 N_ambiguous 333137 2264 79125 UnstrandedReadsAssigned:13369820 PositiveStrandReadsAssigned:470503 NegativeStrandReadsAssigned:13409684 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389814 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389814-trimmed-pair1.fastq SRR11389814-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,003,102 reads, 14,085,172 reads pseudoaligned [quant] estimated average fragment length: 159.844 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR11389814.ke.tsv 35125 SRR11389814.se.tsv 88098 total ==> SRR11389814.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.264 0 0 PNS24247 1044 885.156 17.8552 2.09205 PNS24249 1928 1769.16 85.2812 4.99935 PNS24246 1044 885.156 17.8552 2.09205 PNS24248 1044 885.156 17.8552 2.09205 PNS24244 1471 1312.16 21.1531 1.67192 PNS24243 293 145.557 0 0 KQK14069 1603 1444.16 271.182 19.4748 KQK14071 474 316.961 25.0337 8.19115 ==> SRR11389814.se.tsv <== BRADI_1g14170v3 319 BRADI_1g53295v3 33 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 188 BRADI_1g74790v3 223 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR11389814 completed mapping pipeline successfully