Starting /dee2/code/volunteer_pipeline.sh SRR11389815 current disk space = 1544579420160 free memory = 1470737228 SRR11389815 SRAfilesize a63ef854820169af633bd9b229b463a2 SRR11389815.sra SRR11389815.sra file validated SRR11389815 is paired end SRR11389815 is conventional basespace SRR11389815 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.036 32.0 32.0 32.0 32.0 32.0 2 30.992 32.0 32.0 32.0 32.0 32.0 3 31.09225 32.0 32.0 32.0 32.0 32.0 4 31.135 32.0 32.0 32.0 32.0 32.0 5 31.2 32.0 32.0 32.0 32.0 32.0 6 33.88525 36.0 36.0 36.0 32.0 36.0 7 33.845 36.0 36.0 36.0 32.0 36.0 8 33.99675 36.0 36.0 36.0 32.0 36.0 9 34.0355 36.0 36.0 36.0 32.0 36.0 10-11 34.0265 36.0 36.0 36.0 32.0 36.0 12-13 34.076875 36.0 36.0 36.0 32.0 36.0 14-15 34.06725 36.0 36.0 36.0 32.0 36.0 16-17 33.979 36.0 36.0 36.0 32.0 36.0 18-19 34.006 36.0 36.0 36.0 32.0 36.0 20-21 34.009375 36.0 36.0 36.0 32.0 36.0 22-23 33.658 36.0 36.0 36.0 29.5 36.0 24-25 33.597625 36.0 36.0 36.0 27.0 36.0 26-27 33.731375 36.0 36.0 36.0 32.0 36.0 28-29 33.576375 36.0 36.0 36.0 32.0 36.0 30-31 33.5015 36.0 36.0 36.0 26.5 36.0 32-33 33.435500000000005 36.0 36.0 36.0 24.0 36.0 34-35 33.338125 36.0 36.0 36.0 21.0 36.0 36-37 33.32403701850926 36.0 36.0 36.0 21.0 36.0 38-39 33.253440080060045 36.0 36.0 36.0 21.0 36.0 40-41 33.246063339254206 36.0 36.0 36.0 20.5 36.0 42-43 33.14416323255075 36.0 36.0 36.0 17.5 36.0 44-45 32.907541546946604 36.0 36.0 36.0 17.5 36.0 46-47 33.07555010828132 36.0 36.0 36.0 17.5 36.0 48-49 33.14627701651618 36.0 36.0 36.0 21.0 36.0 50-51 33.009678230266466 36.0 36.0 36.0 17.5 36.0 52-53 32.8035927732319 36.0 36.0 36.0 14.0 36.0 54-55 32.85108257804633 36.0 36.0 36.0 14.0 36.0 56-57 32.84865079555664 36.0 36.0 36.0 14.0 36.0 58-59 32.60225664530061 36.0 32.0 36.0 14.0 36.0 60-61 32.456006967328875 36.0 32.0 36.0 14.0 36.0 62-63 32.53243880978376 36.0 36.0 36.0 14.0 36.0 64-65 32.66997319556679 36.0 34.0 36.0 14.0 36.0 66-67 32.639390627936066 36.0 32.0 36.0 14.0 36.0 68-69 32.53025818451999 36.0 32.0 36.0 14.0 36.0 70-71 32.48833810026419 36.0 32.0 36.0 14.0 36.0 72-73 32.46544040842864 36.0 32.0 36.0 14.0 36.0 74-75 32.35129317546546 36.0 32.0 36.0 14.0 36.0 76 32.167153284671535 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 4.0 24 10.0 25 15.0 26 29.0 27 64.0 28 117.0 29 151.0 30 262.0 31 339.0 32 487.0 33 755.0 34 1117.0 35 648.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.64282141070535 9.429714857428714 11.305652826413207 43.621810905452726 2 23.611805902951478 13.881940970485243 32.79139569784893 29.71485742871436 3 24.712356178089045 16.53326663331666 22.661330665332667 36.09304652326163 4 30.76538269134567 22.536268134067033 17.858929464732366 28.83941970985493 5 29.464732366183092 26.113056528264135 22.061030515257627 22.36118059029515 6 24.787393696848426 29.664832416208103 24.112056028014006 21.435717858929465 7 20.83541770885443 23.6368184092046 32.21610805402702 23.311655827913956 8 21.635817908954476 23.51175587793897 29.064532266133064 25.78789394697349 9 22.611305652826413 19.43471735867934 31.44072036018009 26.513256628314156 10-11 25.287643821910955 27.276138069034516 21.135567783891947 26.300650325162582 12-13 25.087543771885944 21.898449224612307 24.212106053026513 28.80190095047524 14-15 25.175087543771884 22.798899449724864 24.637318659329665 27.388694347173587 16-17 26.40070035017509 23.19909954977489 23.08654327163582 27.313656828414207 18-19 25.18759379689845 23.13656828414207 24.312156078039017 27.363681840920464 20-21 26.225612806403202 23.1615807903952 24.287143571785894 26.32566283141571 22-23 24.7623811905953 24.949974987493746 23.386693346673336 26.900950475237618 24-25 25.062531265632813 23.58679339669835 23.836918459229615 27.51375687843922 26-27 25.012506253126567 23.899449724862432 23.36168084042021 27.726363181590795 28-29 26.525762881440716 23.524262131065534 23.961980990495245 25.987993996998497 30-31 24.487243621810904 23.59929964982491 24.337168584292147 27.576288144072038 32-33 25.15007503751876 23.21160580290145 23.899449724862432 27.738869434717362 34-35 26.32566283141571 22.71135567783892 22.936468234117058 28.026513256628316 36-37 25.287643821910955 22.736368184092047 23.3991995997999 28.5767883941971 38-39 25.243932949712285 23.71778834125594 23.555166374781088 27.483112334250688 40-41 25.58838257386079 23.02203304957436 24.486730095142715 26.902854281422133 42-43 25.56042579837195 23.018159048215402 24.070131496556044 27.351283656856605 44-45 25.620456254700425 22.712459262973177 24.07871647029331 27.588368012033094 46-47 26.841510854561424 23.352992847283222 22.8761450621157 26.929351236039658 48-49 25.379881954037426 23.98593494913977 22.37850056511365 28.25568253170915 50-51 25.351935646053292 23.102061337355455 24.06988436400201 27.476118652589243 52-53 26.950176144942123 22.773024660291895 22.043281328636137 28.233517866129844 54-55 26.435045317220546 22.77190332326284 23.778952668680766 27.01409869083585 56-57 25.734089477000634 22.93635790800252 23.85633270321361 27.473219911783236 58-59 25.552608311229 23.102185171150687 23.923203233548058 27.42200328407225 60-61 26.568032372281237 22.610015174506827 24.620637329286797 26.20131512392514 62-63 24.946182094466256 22.958085348866657 24.072432569330125 28.023299987336962 64-65 26.44072099517644 22.81035795887281 23.825844122873825 26.923076923076923 66-67 25.811378388697975 23.940435280641466 23.049509991090748 27.19867633956981 68-69 26.46008671257332 23.603672532517216 23.807702116806936 26.128538638102526 70-71 26.02967510872346 23.8296239447429 22.99820926068048 27.14249168585316 72-73 25.714653618336335 23.358228174092197 23.023435488024724 27.90368271954674 74-75 26.558859805399482 20.515280252158423 24.928052624366178 27.997807318075925 76 28.43065693430657 0.0 32.7007299270073 38.86861313868613 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.5 21 4.0 22 5.5 23 5.0 24 2.0 25 1.5 26 4.5 27 7.0 28 8.0 29 12.0 30 16.5 31 18.5 32 24.5 33 34.5 34 42.5 35 51.0 36 58.5 37 66.0 38 89.0 39 109.0 40 117.5 41 136.5 42 149.0 43 157.5 44 182.0 45 227.0 46 255.0 47 207.5 48 158.5 49 161.0 50 167.5 51 153.5 52 141.5 53 144.0 54 141.5 55 127.5 56 125.5 57 135.5 58 130.0 59 132.0 60 141.5 61 127.5 62 111.0 63 119.0 64 118.5 65 114.0 66 103.5 67 82.0 68 83.0 69 92.5 70 82.5 71 67.0 72 64.5 73 60.5 74 54.0 75 53.5 76 48.5 77 38.5 78 23.0 79 14.0 80 14.5 81 12.5 82 9.0 83 6.0 84 4.0 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 1.0 38 0.0 39 2.0 40 2.0 41 0.0 42 1.0 43 2.0 44 2.0 45 2.0 46 3.0 47 0.0 48 3.0 49 2.0 50 0.0 51 3.0 52 2.0 53 1.0 54 0.0 55 3.0 56 3.0 57 6.0 58 3.0 59 1.0 60 4.0 61 1.0 62 5.0 63 5.0 64 4.0 65 5.0 66 7.0 67 2.0 68 4.0 69 7.0 70 6.0 71 9.0 72 28.0 73 64.0 74 313.0 75 752.0 76 2740.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2109951641639 97.45 2 0.687197760244337 1.35 3 0.050903537795876815 0.15 4 0.025451768897938407 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 38 0.95 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389815 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64275 32.0 32.0 32.0 32.0 32.0 2 30.20775 32.0 32.0 32.0 21.0 32.0 3 30.0925 32.0 32.0 32.0 21.0 32.0 4 30.01925 32.0 32.0 32.0 21.0 32.0 5 30.07225 32.0 32.0 32.0 21.0 32.0 6 33.2925 36.0 36.0 36.0 21.0 36.0 7 33.26675 36.0 36.0 36.0 21.0 36.0 8 33.341 36.0 36.0 36.0 21.0 36.0 9 33.10875 36.0 36.0 36.0 21.0 36.0 10-11 33.044125 36.0 36.0 36.0 21.0 36.0 12-13 33.059 36.0 36.0 36.0 21.0 36.0 14-15 32.845875 36.0 36.0 36.0 17.5 36.0 16-17 33.127125 36.0 36.0 36.0 17.5 36.0 18-19 32.856750000000005 36.0 36.0 36.0 17.5 36.0 20-21 32.676125 36.0 36.0 36.0 14.0 36.0 22-23 32.85975 36.0 36.0 36.0 14.0 36.0 24-25 32.897999999999996 36.0 36.0 36.0 21.0 36.0 26-27 32.7225 36.0 36.0 36.0 14.0 36.0 28-29 32.646625 36.0 36.0 36.0 14.0 36.0 30-31 32.60975 36.0 36.0 36.0 14.0 36.0 32-33 32.62025 36.0 36.0 36.0 14.0 36.0 34-35 32.469125 36.0 34.0 36.0 14.0 36.0 36-37 32.64106740165372 36.0 36.0 36.0 14.0 36.0 38-39 32.586967418546365 36.0 36.0 36.0 14.0 36.0 40-41 32.509470018182995 36.0 34.0 36.0 14.0 36.0 42-43 32.65199786454599 36.0 36.0 36.0 14.0 36.0 44-45 32.30775032143329 36.0 32.0 36.0 14.0 36.0 46-47 32.24962681540928 36.0 32.0 36.0 14.0 36.0 48-49 32.372716468106944 36.0 32.0 36.0 14.0 36.0 50-51 32.38375314861461 36.0 32.0 36.0 14.0 36.0 52-53 32.3358487471196 36.0 32.0 36.0 14.0 36.0 54-55 32.2380171543895 36.0 32.0 36.0 14.0 36.0 56-57 32.41486759676425 36.0 32.0 36.0 14.0 36.0 58-59 32.06423847294316 36.0 32.0 36.0 14.0 36.0 60-61 32.10273429187926 36.0 32.0 36.0 14.0 36.0 62-63 31.87441095880535 36.0 32.0 36.0 14.0 36.0 64-65 31.535973524994468 36.0 32.0 36.0 14.0 36.0 66-67 31.73237795183426 36.0 32.0 36.0 14.0 36.0 68-69 31.75532514606324 36.0 32.0 36.0 14.0 36.0 70-71 31.771027389570577 36.0 32.0 36.0 14.0 36.0 72-73 31.54063625036709 36.0 32.0 36.0 14.0 36.0 74-75 31.637052129578215 36.0 32.0 36.0 14.0 36.0 76 31.44353029169783 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 11.0 16 27.0 17 21.0 18 12.0 19 11.0 20 12.0 21 10.0 22 19.0 23 28.0 24 24.0 25 48.0 26 66.0 27 91.0 28 115.0 29 182.0 30 214.0 31 310.0 32 466.0 33 660.0 34 1000.0 35 656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.29759519038076 16.85871743486974 10.270541082164328 36.573146292585164 2 30.61122244488978 22.24448897795591 25.876753507014026 21.26753507014028 3 27.530060120240478 25.0501002004008 19.514028056112224 27.90581162324649 4 29.859719438877757 30.98697394789579 16.758517034068134 22.394789579158317 5 30.736472945891784 30.636272545090183 17.535070140280563 21.092184368737474 6 24.586466165413533 32.88220551378446 19.949874686716793 22.581453634085214 7 24.94984954864594 15.997993981945838 31.970912738214647 27.08124373119358 8 25.563909774436087 22.05513784461153 22.380952380952383 30.0 9 25.495111556781147 21.78490849837052 24.091250940085235 28.6287290047631 10-11 28.695106649937262 26.787954830614808 18.74529485570891 25.77164366373902 12-13 29.178185473737116 20.155818044734858 22.204071374717266 28.461925106810753 14-15 27.11161387631976 24.06988436400201 22.750125691302163 26.06837606837607 16-17 28.70056497175141 22.53609541745135 21.782799748901443 26.980539861895792 18-19 28.044187798142104 23.612854632186796 22.319859402460455 26.023098167210645 20-21 26.938057544917704 23.73413745445408 23.055660258826485 26.272144741801736 22-23 29.047259929612874 23.340874811463046 21.279537456008043 26.33232780291604 24-25 28.06775407779172 24.127979924717692 22.145545796737768 25.65872020075282 26-27 25.797137835802157 24.956063268892795 23.098167210645244 26.148631684659808 28-29 27.995478522984175 24.415975885455914 21.70308967596081 25.8854559155991 30-31 27.403966859151392 22.671353251318102 22.734120010042684 27.190559879487825 32-33 27.459839357429715 23.93323293172691 22.377008032128515 26.229919678714857 34-35 29.23829840632451 23.3278955954323 21.796963232526036 25.636842765717155 36-37 27.757560547120093 22.67536704730832 22.22361651399172 27.34345589157987 38-39 27.536413862380716 24.359618282270215 22.965846308387743 25.13812154696133 40-41 28.67370007535795 22.8460185882944 21.803566942979153 26.6767143933685 42-43 28.785023244126144 22.57821334338485 22.163588390501317 26.47317502198769 44-45 26.499811344484968 23.330398691988428 23.695132687712235 26.474657275814362 46-47 28.42211308399446 23.334592620576753 21.546404734920035 26.69688956050875 48-49 27.492751796293962 22.03453926635573 23.181646287659145 27.29106264969116 50-51 26.8391167192429 24.07570977917981 22.763406940063092 26.3217665615142 52-53 28.704872506942692 23.36531178995203 21.34561979298157 26.584195910123704 54-55 28.255652393583432 24.049513704686117 21.53593532903878 26.158898572691676 56-57 27.222151978758376 23.49222404855228 22.26577316980655 27.019850802882793 58-59 29.304446978335235 23.17243126821234 21.043963005194477 26.47915874825795 60-61 28.970065956367325 21.752917300862507 22.602739726027394 26.67427701674277 62-63 29.21376857614632 22.761336212371397 21.98653626317795 26.038358948304328 64-65 28.673287496816908 22.701807995925645 22.625413801884388 25.999490705373056 66-67 28.188433550363847 23.06906676879867 22.175411719647645 26.567087961189838 68-69 26.04859335038363 23.98976982097187 23.145780051150894 26.815856777493607 70-71 27.2878749038708 23.609330940784414 22.122532683927197 26.98026147141758 72-73 27.205882352941174 24.084107327141382 21.7234262125903 26.986584107327143 74-75 28.424516659810777 20.910462086932675 23.392293980529274 27.27272727272727 76 30.400599026581805 0.0 29.68925496068888 39.910146012729314 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 1.5 8 2.0 9 2.0 10 2.0 11 2.0 12 1.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.5 22 3.5 23 5.5 24 7.0 25 5.0 26 2.5 27 3.0 28 7.5 29 11.5 30 11.0 31 14.0 32 22.0 33 25.5 34 31.5 35 41.0 36 53.5 37 66.5 38 84.5 39 101.0 40 107.5 41 122.0 42 142.0 43 165.0 44 177.0 45 157.5 46 144.5 47 156.0 48 166.5 49 168.0 50 165.0 51 154.5 52 142.0 53 138.0 54 144.5 55 137.5 56 127.5 57 134.5 58 133.0 59 131.0 60 128.0 61 125.5 62 124.5 63 130.5 64 135.0 65 119.5 66 117.0 67 123.0 68 115.0 69 100.5 70 89.5 71 82.0 72 81.0 73 77.5 74 64.0 75 58.5 76 49.0 77 36.0 78 32.0 79 30.0 80 24.0 81 13.5 82 7.0 83 6.0 84 6.0 85 4.0 86 1.5 87 1.0 88 2.5 89 2.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.2 6 0.25 7 0.3 8 0.25 9 0.27499999999999997 10-11 0.375 12-13 0.525 14-15 0.5499999999999999 16-17 0.43750000000000006 18-19 0.42500000000000004 20-21 0.5125000000000001 22-23 0.5499999999999999 24-25 0.375 26-27 0.42500000000000004 28-29 0.475 30-31 0.42500000000000004 32-33 0.4 34-35 0.3875 36-37 0.16286644951140067 38-39 0.20050125313283207 40-41 0.15048908954100826 42-43 0.1505457282649605 44-45 0.16323455549974886 46-47 0.15088645794039984 48-49 0.1761671070844344 50-51 0.1889168765743073 52-53 0.12607160867372666 54-55 0.1387487386478305 56-57 0.12627857052658165 58-59 0.12653422750854107 60-61 0.12667848999239928 62-63 0.12685525815045035 64-65 0.1271617497456765 66-67 0.12750223128904756 68-69 0.1021972406745018 70-71 0.10243277848911651 72-73 0.10309278350515465 74-75 0.0958904109589041 76 0.11219147344801794 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 1.0 38 0.0 39 2.0 40 2.0 41 0.0 42 1.0 43 2.0 44 2.0 45 3.0 46 3.0 47 0.0 48 3.0 49 2.0 50 0.0 51 3.0 52 2.0 53 1.0 54 0.0 55 3.0 56 3.0 57 5.0 58 3.0 59 1.0 60 4.0 61 1.0 62 5.0 63 5.0 64 4.0 65 5.0 66 7.0 67 2.0 68 4.0 69 4.0 70 6.0 71 9.0 72 26.0 73 85.0 74 264.0 75 844.0 76 2674.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0126582278481 97.775 2 0.8607594936708861 1.7000000000000002 3 0.0759493670886076 0.22499999999999998 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025316455696202535 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968650 spots for SRR11389815.sra Written 968650 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra Read 968645 spots for SRR11389815.sra Written 968645 spots for SRR11389815.sra SRR ids: ['SRR11389815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uqgydv5a SRR11389815.sra spots: 19372905 blocks: [[1, 968645], [968646, 1937290], [1937291, 2905935], [2905936, 3874580], [3874581, 4843225], [4843226, 5811870], [5811871, 6780515], [6780516, 7749160], [7749161, 8717805], [8717806, 9686450], [9686451, 10655095], [10655096, 11623740], [11623741, 12592385], [12592386, 13561030], [13561031, 14529675], [14529676, 15498320], [15498321, 16466965], [16466966, 17435610], [17435611, 18404255], [18404256, 19372905]] SRR11389815 file size 3669765 SRR11389815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389815 SRR11389815_1.fastq SRR11389815_2.fastq Input file: SRR11389815_1.fastq Paired file: SRR11389815_2.fastq trimmed: SRR11389815-trimmed-pair1.fastq, SRR11389815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:20:10 2024 >> started Sat Dec 7 07:21:43 2024 >> done (92.659s) 19372905 read pairs processed; of these: 807 ( 0.00%) short read pairs filtered out after trimming by size control 342267 ( 1.77%) empty read pairs filtered out after trimming by size control 19029831 (98.23%) read pairs available; of these: 21499 ( 0.11%) trimmed read pairs available after processing 19008332 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 10 0.00% 22 11 0.00% 23 12 0.00% 24 15 0.00% 25 12 0.00% 26 20 0.00% 27 17 0.00% 28 18 0.00% 29 17 0.00% 30 27 0.00% 31 31 0.00% 32 20 0.00% 33 31 0.00% 34 30 0.00% 35 2141 0.01% 36 2306 0.01% 37 2576 0.01% 38 3092 0.02% 39 3538 0.02% 40 4185 0.02% 41 4955 0.03% 42 5374 0.03% 43 6043 0.03% 44 6400 0.03% 45 6788 0.04% 46 7529 0.04% 47 7971 0.04% 48 8522 0.04% 49 9228 0.05% 50 10163 0.05% 51 11085 0.06% 52 12430 0.07% 53 13407 0.07% 54 14160 0.07% 55 15283 0.08% 56 16334 0.09% 57 17316 0.09% 58 18848 0.10% 59 20135 0.11% 60 21222 0.11% 61 22333 0.12% 62 23975 0.13% 63 25851 0.14% 64 27971 0.15% 65 29028 0.15% 66 31485 0.17% 67 33193 0.17% 68 33181 0.17% 69 34863 0.18% 70 37521 0.20% 71 43186 0.23% 72 56068 0.29% 73 186373 0.98% 74 1285987 6.76% 75 7963343 41.85% 76 8944165 47.00% 19029831 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=19 prefix-density=0.29 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=19.39 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.4 sequence=CTTCTTCTCCGGGTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=2.5 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=116.36 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=19.0 sequence=CCGCCGCCGCCTCC SRR11389815 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:25:18 Started mapping on | Dec 07 07:25:18 Finished on | Dec 07 07:37:06 Mapping speed, Million of reads per hour | 96.76 Number of input reads | 19029831 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 16810444 Uniquely mapped reads % | 88.34% Average mapped length | 149.32 Number of splices: Total | 7093393 Number of splices: Annotated (sjdb) | 6769706 Number of splices: GT/AG | 6993493 Number of splices: GC/AG | 86857 Number of splices: AT/AC | 2677 Number of splices: Non-canonical | 10366 Mismatch rate per base, % | 0.94% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1172742 % of reads mapped to multiple loci | 6.16% Number of reads mapped to too many loci | 87770 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 1.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1046646 1046646 1046646 N_multimapping 1172742 1172742 1172742 N_noFeature 573375 16248484 831239 N_ambiguous 395093 2390 94888 UnstrandedReadsAssigned:15841976 PositiveStrandReadsAssigned:559570 NegativeStrandReadsAssigned:15884317 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389815-trimmed-pair1.fastq SRR11389815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,029,831 reads, 16,754,373 reads pseudoaligned [quant] estimated average fragment length: 158.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR11389815.ke.tsv 35125 SRR11389815.se.tsv 88098 total ==> SRR11389815.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.315 30.3441 3.25528 PNS24247 1044 886.214 11.9332 1.12432 PNS24249 1928 1770.21 127.856 6.03067 PNS24246 1044 886.214 11.9332 1.12432 PNS24248 1044 886.214 11.9332 1.12432 PNS24244 1471 1313.21 0 0 PNS24243 293 143.43 0 0 KQK14069 1603 1445.21 1320.82 76.31 KQK14071 474 317.613 167.269 43.9731 ==> SRR11389815.se.tsv <== BRADI_1g14170v3 1698 BRADI_1g53295v3 25 BRADI_1g59795v3 336 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 197 BRADI_1g74790v3 145 BRADI_1g09890v3 0 BRADI_1g77505v3 235 BRADI_1g48960v3 0 SRR11389815 completed mapping pipeline successfully