Starting /dee2/code/volunteer_pipeline.sh SRR11389816 current disk space = 1544542826496 free memory = 1599725808 SRR11389816 SRAfilesize 9fbeee36483219d08adaecbe9aec9fbc SRR11389816.sra SRR11389816.sra file validated SRR11389816 is paired end SRR11389816 is conventional basespace SRR11389816 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92325 32.0 32.0 32.0 32.0 32.0 2 30.98675 32.0 32.0 32.0 32.0 32.0 3 31.08175 32.0 32.0 32.0 32.0 32.0 4 31.21225 32.0 32.0 32.0 32.0 32.0 5 31.30525 32.0 32.0 32.0 32.0 32.0 6 34.168 36.0 36.0 36.0 32.0 36.0 7 34.178 36.0 36.0 36.0 32.0 36.0 8 34.0455 36.0 36.0 36.0 32.0 36.0 9 34.0635 36.0 36.0 36.0 32.0 36.0 10-11 34.0565 36.0 36.0 36.0 32.0 36.0 12-13 34.120374999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.088499999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.072125 36.0 36.0 36.0 32.0 36.0 18-19 33.992125 36.0 36.0 36.0 32.0 36.0 20-21 34.034499999999994 36.0 36.0 36.0 32.0 36.0 22-23 33.879999999999995 36.0 36.0 36.0 32.0 36.0 24-25 33.745000000000005 36.0 36.0 36.0 32.0 36.0 26-27 33.835499999999996 36.0 36.0 36.0 32.0 36.0 28-29 33.7235 36.0 36.0 36.0 32.0 36.0 30-31 33.506125 36.0 36.0 36.0 26.5 36.0 32-33 33.55225 36.0 36.0 36.0 27.0 36.0 34-35 33.591125 36.0 36.0 36.0 29.5 36.0 36-37 33.462231115557785 36.0 36.0 36.0 24.0 36.0 38-39 33.40832916458229 36.0 36.0 36.0 24.0 36.0 40-41 33.30737886998833 36.0 36.0 36.0 20.5 36.0 42-43 33.154101373273065 36.0 36.0 36.0 21.0 36.0 44-45 32.95128975707488 36.0 36.0 36.0 17.5 36.0 46-47 33.07496950531798 36.0 36.0 36.0 17.5 36.0 48-49 33.17314133480179 36.0 36.0 36.0 21.0 36.0 50-51 33.11441848781713 36.0 36.0 36.0 21.0 36.0 52-53 32.88499721901339 36.0 36.0 36.0 14.0 36.0 54-55 32.88209792695669 36.0 36.0 36.0 14.0 36.0 56-57 32.867519487909036 36.0 36.0 36.0 14.0 36.0 58-59 32.69730741112331 36.0 32.0 36.0 14.0 36.0 60-61 32.60804857414057 36.0 36.0 36.0 14.0 36.0 62-63 32.5606485322119 36.0 36.0 36.0 14.0 36.0 64-65 32.70018157541787 36.0 36.0 36.0 14.0 36.0 66-67 32.69736764434606 36.0 32.0 36.0 14.0 36.0 68-69 32.58371937775706 36.0 34.0 36.0 14.0 36.0 70-71 32.5965947425358 36.0 34.0 36.0 14.0 36.0 72-73 32.367477953886265 36.0 32.0 36.0 14.0 36.0 74-75 32.408217425492666 36.0 32.0 36.0 14.0 36.0 76 32.04954268292683 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 11.0 25 13.0 26 34.0 27 66.0 28 100.0 29 155.0 30 235.0 31 342.0 32 498.0 33 726.0 34 1044.0 35 774.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.04352176088044 9.504752376188094 12.38119059529765 41.070535267633815 2 23.43671835917959 14.057028514257128 32.06603301650826 30.440220110055026 3 23.81190595297649 17.45872936468234 23.961980990495245 34.76738369184592 4 29.48974487243622 22.686343171585793 19.28464232116058 28.53926963481741 5 29.539769884942473 27.188594297148573 21.435717858929465 21.83591795897949 6 24.987493746873437 28.414207103551774 24.437218609304654 22.161080540270135 7 19.28464232116058 25.012506253126567 33.291645822911455 22.411205602801402 8 20.36018009004502 24.58729364682341 28.73936968484242 26.313156578289142 9 22.861430715357677 19.13456728364182 31.36568284142071 26.638319159579787 10-11 24.64982491245623 29.027013506753374 22.348674337168582 23.974487243621812 12-13 25.387693846923458 22.24862431215608 23.186593296648326 29.177088544272134 14-15 23.411705852926463 24.7623811905953 24.54977488744372 27.276138069034516 16-17 25.400200100050025 24.387193596798397 23.736868434217108 26.475737868934466 18-19 23.71185592796398 23.224112056028016 25.025012506253123 28.039019509754876 20-21 25.46273136568284 22.32366183091546 26.113056528264135 26.100550275137568 22-23 23.611805902951478 25.937968984492244 24.112056028014006 26.338169084542272 24-25 25.025012506253123 22.948974487243625 24.524762381190595 27.501250625312657 26-27 24.037018509254626 23.411705852926463 24.187093546773387 28.36418209104552 28-29 25.11255627813907 25.087543771885944 23.36168084042021 26.43821910955478 30-31 24.69984992496248 23.66183091545773 24.249624812406203 27.388694347173587 32-33 23.974487243621812 24.6248124062031 24.16208104052026 27.238619309654826 34-35 25.912956478239117 24.349674837418707 23.67433716858429 26.063031515757878 36-37 25.60030015007504 24.087043521760883 23.611805902951478 26.700850425212607 38-39 24.23711855927964 23.874437218609305 25.30015007503752 26.588294147073537 40-41 24.796697109971223 23.58313524333792 23.270361566370575 28.349806080320278 42-43 24.248873309964946 24.349023535302955 24.56184276414622 26.84026039058588 44-45 24.58051590282995 23.340846481342346 24.61808164287503 27.460555972952665 46-47 26.813682495927825 23.60606440295702 23.079814559579003 26.50043854153615 48-49 24.102435350238512 24.278182274667337 25.081596786341954 26.537785588752193 50-51 25.03139914594323 23.348404923386084 25.45842753077116 26.161768399899522 52-53 25.302114803625376 22.721550855991943 23.590130916414903 28.386203423967775 54-55 25.646198461732446 23.855755894590846 23.98184339931913 26.516202244357583 56-57 24.64317291903499 23.83478590375142 24.681066060376406 26.840975116837186 58-59 23.869823983791314 24.376345447638343 25.047486387235658 26.706344181334686 60-61 26.5871000507872 23.18435754189944 23.98425596749619 26.244286439817166 62-63 24.52614171225035 23.03778145274138 25.849128609591652 26.586948225416613 64-65 25.798619984666498 22.284692052133913 25.45361615129057 26.46307181190902 66-67 25.35934291581109 23.921971252566735 24.063141683778234 26.65554414784394 68-69 24.88075286837695 24.494005414464354 23.153280907567357 27.47196080959134 70-71 25.578988226161208 25.50135851986027 22.732565661793245 26.187087592185275 72-73 24.713541666666668 24.700520833333332 23.411458333333332 27.174479166666664 74-75 24.802220680083277 21.568355308813324 25.704371963913946 27.925052047189453 76 28.239329268292686 0.0 31.897865853658537 39.86280487804878 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 4.0 21 7.0 22 6.0 23 6.0 24 6.0 25 3.5 26 9.0 27 10.5 28 10.0 29 14.5 30 17.0 31 17.5 32 23.5 33 32.5 34 40.0 35 60.0 36 78.0 37 89.5 38 99.0 39 125.5 40 157.0 41 157.5 42 153.5 43 178.0 44 197.0 45 222.5 46 265.0 47 236.0 48 182.0 49 178.0 50 180.5 51 154.5 52 134.0 53 132.5 54 135.0 55 132.5 56 119.5 57 114.0 58 112.5 59 113.5 60 113.0 61 112.0 62 116.0 63 108.0 64 94.0 65 92.5 66 75.5 67 60.0 68 74.5 69 81.5 70 81.0 71 82.0 72 71.0 73 61.5 74 55.0 75 50.5 76 42.0 77 26.0 78 18.5 79 17.0 80 12.5 81 8.0 82 7.5 83 5.5 84 4.0 85 2.5 86 2.0 87 3.0 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 1.0 40 1.0 41 1.0 42 2.0 43 0.0 44 0.0 45 1.0 46 3.0 47 5.0 48 2.0 49 1.0 50 0.0 51 6.0 52 6.0 53 3.0 54 1.0 55 4.0 56 5.0 57 5.0 58 5.0 59 6.0 60 4.0 61 3.0 62 5.0 63 10.0 64 10.0 65 8.0 66 8.0 67 9.0 68 9.0 69 6.0 70 7.0 71 9.0 72 24.0 73 70.0 74 311.0 75 823.0 76 2624.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.15773353751915 97.125 2 0.6636038795303726 1.3 3 0.1276161306789178 0.375 4 0.025523226135783564 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 44 1.0999999999999999 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389816 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.67925 32.0 32.0 32.0 32.0 32.0 2 30.293 32.0 32.0 32.0 21.0 32.0 3 30.09175 32.0 32.0 32.0 21.0 32.0 4 30.08225 32.0 32.0 32.0 21.0 32.0 5 30.18325 32.0 32.0 32.0 21.0 32.0 6 33.3075 36.0 36.0 36.0 21.0 36.0 7 33.40525 36.0 36.0 36.0 21.0 36.0 8 33.38275 36.0 36.0 36.0 21.0 36.0 9 33.28425 36.0 36.0 36.0 21.0 36.0 10-11 33.128125 36.0 36.0 36.0 21.0 36.0 12-13 33.178875 36.0 36.0 36.0 21.0 36.0 14-15 33.038125 36.0 36.0 36.0 21.0 36.0 16-17 33.039500000000004 36.0 36.0 36.0 17.5 36.0 18-19 33.191374999999994 36.0 36.0 36.0 21.0 36.0 20-21 32.914874999999995 36.0 36.0 36.0 14.0 36.0 22-23 33.09825 36.0 36.0 36.0 17.5 36.0 24-25 32.93025 36.0 36.0 36.0 21.0 36.0 26-27 32.82825 36.0 36.0 36.0 14.0 36.0 28-29 32.80175 36.0 36.0 36.0 14.0 36.0 30-31 32.652125 36.0 36.0 36.0 14.0 36.0 32-33 32.753375 36.0 36.0 36.0 14.0 36.0 34-35 32.510625 36.0 36.0 36.0 14.0 36.0 36-37 32.70957633492103 36.0 36.0 36.0 14.0 36.0 38-39 32.6326146903986 36.0 36.0 36.0 14.0 36.0 40-41 32.640628337231405 36.0 36.0 36.0 14.0 36.0 42-43 32.723278902073886 36.0 36.0 36.0 14.0 36.0 44-45 32.380587644399796 36.0 34.0 36.0 14.0 36.0 46-47 32.564763414302405 36.0 36.0 36.0 14.0 36.0 48-49 32.46422613532809 36.0 36.0 36.0 14.0 36.0 50-51 32.604078173857474 36.0 34.0 36.0 14.0 36.0 52-53 32.4360331167928 36.0 34.0 36.0 14.0 36.0 54-55 32.32175709375245 36.0 32.0 36.0 14.0 36.0 56-57 32.54138140443585 36.0 34.0 36.0 14.0 36.0 58-59 32.31401205075828 36.0 34.0 36.0 14.0 36.0 60-61 32.25373868408161 36.0 32.0 36.0 14.0 36.0 62-63 32.014274474157475 36.0 32.0 36.0 14.0 36.0 64-65 31.72067268487342 36.0 32.0 36.0 14.0 36.0 66-67 31.814892357726553 36.0 32.0 36.0 14.0 36.0 68-69 31.904229634613223 36.0 32.0 36.0 14.0 36.0 70-71 31.97686250103306 36.0 32.0 36.0 14.0 36.0 72-73 31.79479990848569 36.0 32.0 36.0 14.0 36.0 74-75 31.749610351986867 36.0 32.0 36.0 14.0 36.0 76 31.180908391070055 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 19.0 16 33.0 17 22.0 18 17.0 19 7.0 20 7.0 21 10.0 22 10.0 23 17.0 24 26.0 25 43.0 26 58.0 27 87.0 28 110.0 29 152.0 30 240.0 31 309.0 32 390.0 33 665.0 34 981.0 35 780.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.020316027088036 17.155756207674944 11.537496864810635 34.28643090042638 2 30.574366691748185 22.447955856533735 27.13819914722849 19.839478304489592 3 27.02431687139634 25.595387315116568 21.007771371270994 26.372524442216093 4 29.606417648533466 30.985209325645524 17.974429681624468 21.43394334419654 5 30.78465780897468 30.358485836049137 18.776635748307847 20.080220606668338 6 24.04714142427282 33.19959879638917 20.837512537612838 21.915747241725175 7 24.165621079046424 15.909661229611041 33.29987452948557 26.624843161856965 8 23.6518685728618 23.375971908703285 24.37923250564334 28.592927012791574 9 24.341279799247175 21.104140526976163 27.352572145545796 27.202007528230865 10-11 27.628607277289834 26.3237139272271 19.523212045169387 26.524466750313675 12-13 27.79524588102126 20.39994969186266 23.229782417305998 28.575022009810088 14-15 26.752233547250537 24.462061155152888 23.002390839310433 25.783314458286142 16-17 28.420655861289106 23.621057921849477 23.26925493152406 24.689031285337354 18-19 27.71704988063827 23.595929136826236 23.26925493152406 25.41776605101143 20-21 28.12224877373915 23.93409634008301 23.456169035341468 24.487485850836375 22-23 28.461828700792353 23.443592001006163 23.380706829329647 24.713872468871838 24-25 27.793120763243785 24.290735626412253 22.37007280944012 25.54607080090384 26-27 26.68927405174579 25.533785481034915 23.09721175584024 24.679728711379052 28-29 26.825895663104966 24.600879949717157 23.58265241986172 24.990571967316153 30-31 27.208747015206736 24.531858740731433 23.312806334045494 24.946587910016337 32-33 26.58291457286432 24.14572864321608 24.334170854271356 24.937185929648244 34-35 27.622158020349204 23.564878784072352 23.6904911443286 25.122472051249844 36-37 26.08913998744507 23.992467043314498 24.243565599497803 25.674827369742626 38-39 26.297273526824977 24.29953511747707 24.24927754743058 25.15391380826737 40-41 27.78405524168236 24.055241682360325 22.498430634023855 25.66227244193346 42-43 27.47266557747895 23.47618449164258 23.614427548070882 25.43672238280759 44-45 26.58371040723982 23.592257415786825 23.881347410759176 25.94268476621418 46-47 27.97836205812052 23.826896464964147 22.89596175619575 25.298779720719587 48-49 27.517962939619313 23.824530442455565 23.761502584142193 24.89600403378293 50-51 26.88375615297236 24.813833144011106 22.81963902562161 25.48277167739493 52-53 29.1056088933805 23.54724608388075 21.728145528044468 25.61899949469429 54-55 27.775667806051395 24.129636662868716 22.572477528801112 25.52221800227877 56-57 28.86663286004057 23.5420892494929 22.718052738336713 24.87322515212982 58-59 28.867420871996952 23.312571501207575 22.931231727469175 24.888775899326298 60-61 26.97947214076246 23.179905648348846 22.822899400739512 27.017722810149174 62-63 27.110203039203167 24.211467245562506 23.44528157323458 25.233048141999742 64-65 28.159076330981396 23.771648492623477 22.7325208466966 25.336754329698525 66-67 25.843854676629736 24.967791806235507 23.048183457871684 26.140170059263077 68-69 26.665804114374435 24.479234053564497 23.36654159658429 25.488420235476777 70-71 27.001039501039504 24.454261954261955 22.31029106029106 26.234407484407484 72-73 26.45440251572327 25.57651991614256 21.894654088050313 26.07442348008386 74-75 26.87604224569205 21.664813785436355 24.305169538632573 27.15397443023902 76 28.96764252696456 0.0 32.70416024653313 38.32819722650231 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 7.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.5 18 2.5 19 2.5 20 1.5 21 3.0 22 5.0 23 5.0 24 4.0 25 4.5 26 6.0 27 9.5 28 10.5 29 12.0 30 12.5 31 12.5 32 21.0 33 29.5 34 36.0 35 55.0 36 78.0 37 89.0 38 103.5 39 126.5 40 135.5 41 139.5 42 151.5 43 175.0 44 194.0 45 193.0 46 185.0 47 186.5 48 173.0 49 160.5 50 168.0 51 156.5 52 141.0 53 121.0 54 114.0 55 122.0 56 122.0 57 125.5 58 130.0 59 126.5 60 130.0 61 131.5 62 123.0 63 116.5 64 108.5 65 100.5 66 102.5 67 105.5 68 94.0 69 84.5 70 82.5 71 80.0 72 72.0 73 64.0 74 57.5 75 47.5 76 34.0 77 24.0 78 19.5 79 18.0 80 13.5 81 10.5 82 8.5 83 5.5 84 4.0 85 2.5 86 2.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 1.5 98 1.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.3 7 0.375 8 0.325 9 0.375 10-11 0.375 12-13 0.6125 14-15 0.6625 16-17 0.5125000000000001 18-19 0.5125000000000001 20-21 0.6125 22-23 0.6125 24-25 0.42500000000000004 26-27 0.475 28-29 0.5625 30-31 0.5375 32-33 0.5 34-35 0.4875 36-37 0.16294810729506143 38-39 0.23815492604662825 40-41 0.12539184952978058 42-43 0.13805220883534136 44-45 0.10045203415369162 46-47 0.12564392511622063 48-49 0.13846928499496478 50-51 0.20153671747071422 52-53 0.050505050505050504 54-55 0.10117617301125584 56-57 0.05068423720223011 58-59 0.05081946385465633 60-61 0.08917197452229299 62-63 0.05105296745373325 64-65 0.05128862674701885 66-67 0.05150656708730364 68-69 0.051726367515841205 70-71 0.05194805194805195 72-73 0.05238344683080147 74-75 0.05555555555555555 76 0.07698229407236336 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 0.0 37 0.0 38 0.0 39 1.0 40 1.0 41 1.0 42 4.0 43 0.0 44 0.0 45 1.0 46 3.0 47 5.0 48 2.0 49 1.0 50 1.0 51 6.0 52 6.0 53 3.0 54 1.0 55 4.0 56 6.0 57 5.0 58 5.0 59 6.0 60 4.0 61 3.0 62 5.0 63 11.0 64 9.0 65 8.0 66 8.0 67 8.0 68 9.0 69 7.0 70 10.0 71 14.0 72 26.0 73 80.0 74 250.0 75 877.0 76 2598.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14054600606673 98.05 2 0.8088978766430739 1.6 3 0.02527805864509606 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879172 spots for SRR11389816.sra Written 879172 spots for SRR11389816.sra Read 879186 spots for SRR11389816.sra Written 879186 spots for SRR11389816.sra SRR ids: ['SRR11389816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b3w57j4_ SRR11389816.sra spots: 17583454 blocks: [[1, 879172], [879173, 1758344], [1758345, 2637516], [2637517, 3516688], [3516689, 4395860], [4395861, 5275032], [5275033, 6154204], [6154205, 7033376], [7033377, 7912548], [7912549, 8791720], [8791721, 9670892], [9670893, 10550064], [10550065, 11429236], [11429237, 12308408], [12308409, 13187580], [13187581, 14066752], [14066753, 14945924], [14945925, 15825096], [15825097, 16704268], [16704269, 17583454]] SRR11389816 file size 3321978 SRR11389816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389816 SRR11389816_1.fastq SRR11389816_2.fastq Input file: SRR11389816_1.fastq Paired file: SRR11389816_2.fastq trimmed: SRR11389816-trimmed-pair1.fastq, SRR11389816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:19:35 2024 >> started Sat Dec 7 07:19:50 2024 >> done (15.629s) 17583454 read pairs processed; of these: 716 ( 0.00%) short read pairs filtered out after trimming by size control 272044 ( 1.55%) empty read pairs filtered out after trimming by size control 17310694 (98.45%) read pairs available; of these: 21125 ( 0.12%) trimmed read pairs available after processing 17289569 (99.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 3 0.00% 20 17 0.00% 21 5 0.00% 22 13 0.00% 23 9 0.00% 24 27 0.00% 25 16 0.00% 26 24 0.00% 27 17 0.00% 28 22 0.00% 29 12 0.00% 30 27 0.00% 31 28 0.00% 32 27 0.00% 33 34 0.00% 34 37 0.00% 35 2368 0.01% 36 2487 0.01% 37 2908 0.02% 38 3274 0.02% 39 4157 0.02% 40 4783 0.03% 41 5727 0.03% 42 6333 0.04% 43 6945 0.04% 44 7471 0.04% 45 8106 0.05% 46 8787 0.05% 47 9658 0.06% 48 10532 0.06% 49 11470 0.07% 50 12854 0.07% 51 13826 0.08% 52 15009 0.09% 53 16777 0.10% 54 17839 0.10% 55 19429 0.11% 56 20627 0.12% 57 22183 0.13% 58 24184 0.14% 59 25446 0.15% 60 27109 0.16% 61 29150 0.17% 62 30781 0.18% 63 33184 0.19% 64 35476 0.20% 65 37893 0.22% 66 40111 0.23% 67 42942 0.25% 68 42718 0.25% 69 44639 0.26% 70 48280 0.28% 71 55139 0.32% 72 67068 0.39% 73 190846 1.10% 74 1210903 7.00% 75 7278894 42.05% 76 7812051 45.13% 17310694 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=10.41 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.8 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=2.3 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=123.66 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=18.9 sequence=CCGCCGCCGCCTCC SRR11389816 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:20:18 Started mapping on | Dec 07 07:20:18 Finished on | Dec 07 07:21:46 Mapping speed, Million of reads per hour | 708.16 Number of input reads | 17310694 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 15404931 Uniquely mapped reads % | 88.99% Average mapped length | 148.95 Number of splices: Total | 6739716 Number of splices: Annotated (sjdb) | 6413454 Number of splices: GT/AG | 6639169 Number of splices: GC/AG | 87936 Number of splices: AT/AC | 2983 Number of splices: Non-canonical | 9628 Mismatch rate per base, % | 0.86% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1086404 % of reads mapped to multiple loci | 6.28% Number of reads mapped to too many loci | 60372 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 1.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 819360 819360 819360 N_multimapping 1086404 1086404 1086404 N_noFeature 562219 14841843 835094 N_ambiguous 375608 2510 89990 UnstrandedReadsAssigned:14467104 PositiveStrandReadsAssigned:560578 NegativeStrandReadsAssigned:14479847 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389816-trimmed-pair1.fastq SRR11389816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,310,694 reads, 15,358,363 reads pseudoaligned [quant] estimated average fragment length: 152.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,315 rounds 52973 SRR11389816.ke.tsv 35125 SRR11389816.se.tsv 88098 total ==> SRR11389816.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 784.391 0 0 PNS24247 1044 892.255 26.3055 2.71829 PNS24249 1928 1776.25 136.39 7.07968 PNS24246 1044 892.255 26.3055 2.71829 PNS24248 1044 892.255 26.3055 2.71829 PNS24244 1471 1319.25 15.694 1.09684 PNS24243 293 150.464 0 0 KQK14069 1603 1451.25 921.887 58.5695 KQK14071 474 323.725 84.0286 23.9326 ==> SRR11389816.se.tsv <== BRADI_1g14170v3 1090 BRADI_1g53295v3 46 BRADI_1g59795v3 297 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 167 BRADI_1g74790v3 276 BRADI_1g09890v3 0 BRADI_1g77505v3 289 BRADI_1g48960v3 0 SRR11389816 completed mapping pipeline successfully