Starting /dee2/code/volunteer_pipeline.sh SRR11389817 current disk space = 1544582754304 free memory = 1601923988 SRR11389817 SRAfilesize e4e5334df6043c7953d4127ea6903ea4 SRR11389817.sra SRR11389817.sra file validated SRR11389817 is paired end SRR11389817 is conventional basespace SRR11389817 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89375 32.0 32.0 32.0 32.0 32.0 2 30.93475 32.0 32.0 32.0 32.0 32.0 3 30.96525 32.0 32.0 32.0 32.0 32.0 4 30.973 32.0 32.0 32.0 32.0 32.0 5 31.147 32.0 32.0 32.0 32.0 32.0 6 33.968 36.0 36.0 36.0 32.0 36.0 7 33.80275 36.0 36.0 36.0 32.0 36.0 8 33.86675 36.0 36.0 36.0 32.0 36.0 9 33.928 36.0 36.0 36.0 32.0 36.0 10-11 33.9385 36.0 36.0 36.0 32.0 36.0 12-13 33.900875 36.0 36.0 36.0 32.0 36.0 14-15 34.003875 36.0 36.0 36.0 32.0 36.0 16-17 33.86425 36.0 36.0 36.0 32.0 36.0 18-19 33.780375 36.0 36.0 36.0 32.0 36.0 20-21 33.97025 36.0 36.0 36.0 32.0 36.0 22-23 33.743875 36.0 36.0 36.0 32.0 36.0 24-25 33.577625 36.0 36.0 36.0 27.0 36.0 26-27 33.573625 36.0 36.0 36.0 26.5 36.0 28-29 33.544 36.0 36.0 36.0 26.5 36.0 30-31 33.41125 36.0 36.0 36.0 26.5 36.0 32-33 33.4 36.0 36.0 36.0 27.0 36.0 34-35 33.547625 36.0 36.0 36.0 29.5 36.0 36-37 33.234093186372746 36.0 36.0 36.0 21.0 36.0 38-39 33.41120643996116 36.0 36.0 36.0 24.0 36.0 40-41 33.19337848006019 36.0 36.0 36.0 20.5 36.0 42-43 33.14866175691225 36.0 36.0 36.0 21.0 36.0 44-45 32.86651363295634 36.0 36.0 36.0 14.0 36.0 46-47 33.215166615167476 36.0 36.0 36.0 21.0 36.0 48-49 33.03172688004829 36.0 36.0 36.0 17.5 36.0 50-51 33.09699155740037 36.0 36.0 36.0 17.5 36.0 52-53 32.90946779750533 36.0 36.0 36.0 14.0 36.0 54-55 32.951823400485736 36.0 36.0 36.0 14.0 36.0 56-57 32.845427684672224 36.0 34.0 36.0 14.0 36.0 58-59 32.78074472095834 36.0 34.0 36.0 14.0 36.0 60-61 32.35966882534731 36.0 32.0 36.0 14.0 36.0 62-63 32.46529725908704 36.0 34.0 36.0 14.0 36.0 64-65 32.568672098419036 36.0 32.0 36.0 14.0 36.0 66-67 32.58762666111407 36.0 32.0 36.0 14.0 36.0 68-69 32.5572144979357 36.0 32.0 36.0 14.0 36.0 70-71 32.451831088933005 36.0 32.0 36.0 14.0 36.0 72-73 32.33790421498662 36.0 32.0 36.0 14.0 36.0 74-75 32.377862892202394 36.0 32.0 36.0 14.0 36.0 76 31.99686643164904 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 5.0 24 6.0 25 11.0 26 33.0 27 75.0 28 122.0 29 146.0 30 247.0 31 371.0 32 451.0 33 744.0 34 1090.0 35 689.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.965931863727455 10.170340681362726 9.794589178356713 47.069138276553105 2 22.82064128256513 13.72745490981964 36.19739478957916 27.25450901803607 3 23.22144288577154 16.132264529058116 23.42184368737475 37.22444889779559 4 26.828657314629258 23.071142284569138 19.38877755511022 30.711422845691384 5 28.882765531062127 26.528056112224448 22.26953907815631 22.319639278557112 6 23.822645290581164 28.907815631262523 23.697394789579157 23.572144288577153 7 19.138276553106213 24.849699398797593 32.94088176352705 23.071142284569138 8 20.516032064128257 23.897795591182362 30.01002004008016 25.576152304609217 9 21.092184368737474 20.66633266533066 33.09118236472946 25.150300601202403 10-11 25.513527054108216 28.569639278557112 21.20490981963928 24.71192384769539 12-13 25.35070140280561 22.382264529058116 23.43436873747495 28.83266533066132 14-15 23.634769539078157 24.07314629258517 25.613727454909817 26.678356713426854 16-17 26.365230460921847 23.12124248496994 23.509519038076153 27.004008016032067 18-19 25.0375751503006 23.42184368737475 23.72244488977956 27.81813627254509 20-21 25.162825651302605 22.970941883767534 25.313126252505008 26.553106212424847 22-23 25.30060120240481 24.574148296593187 22.92084168336673 27.204408817635272 24-25 25.0375751503006 22.632765531062123 24.774549098196395 27.55511022044088 26-27 25.71392785571142 22.908316633266534 24.912324649298597 26.465430861723448 28-29 25.37575150300601 23.40931863727455 23.76002004008016 27.45490981963928 30-31 24.549098196392784 22.88326653306613 24.849699398797593 27.71793587174349 32-33 24.06062124248497 23.785070140280563 25.35070140280561 26.803607214428858 34-35 24.874749498997996 23.609719438877754 24.486472945891784 27.029058116232463 36-37 25.0 23.73496993987976 23.897795591182362 27.367234468937873 38-39 24.962406015037594 24.398496240601503 23.99749373433584 26.64160401002506 40-41 25.106596438424884 24.968648106345622 23.200401304238778 26.72435415099072 42-43 25.282308657465496 22.72271016311167 25.119196988707653 26.87578419071518 44-45 24.302938960060285 24.08942476764632 24.96860085405677 26.639035418236624 46-47 25.99019238023387 22.771281277505345 24.644788130265308 26.593738211995472 48-49 25.358851674641148 23.860488541928984 23.55829765802065 27.222362125409216 50-51 26.34300126103405 23.203026481715007 24.237074401008826 26.216897856242117 52-53 25.41045718615812 22.4046476382925 24.21065925738823 27.97423591816115 54-55 26.015951386251423 22.572477528801112 23.395366502088873 28.016204582858588 56-57 23.930973226747877 23.740642050501208 25.28866895064078 27.03971577211014 58-59 25.904228222109015 23.013245033112582 24.057564951604686 27.024961793173713 60-61 26.46381999488622 23.344413193556633 23.13986192789568 27.051904883661464 62-63 25.285439384220652 23.2071840923669 24.23348300192431 27.273893521488134 64-65 26.184023744999358 22.58355916892502 23.83533359143115 27.39708349464447 66-67 24.883298755186722 23.651452282157674 23.029045643153527 28.436203319502074 68-69 24.517978113600833 23.501823866597185 24.76550286607608 27.2146951537259 70-71 26.109148017275224 23.766522706452033 23.570213322863502 26.55411595340924 72-73 25.527983104540652 24.44561774023231 22.294086589229146 27.732312565997887 74-75 25.439954948613263 21.399408700549063 25.003519639588905 28.15711671124877 76 28.90716803760282 0.0 31.766549157853508 39.32628280454367 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 2.5 20 4.0 21 5.0 22 5.0 23 3.5 24 1.5 25 1.5 26 4.5 27 5.5 28 7.0 29 10.0 30 12.5 31 20.0 32 28.0 33 32.0 34 39.0 35 48.0 36 66.5 37 95.5 38 106.0 39 115.0 40 132.5 41 164.0 42 198.5 43 227.5 44 223.5 45 192.0 46 183.0 47 162.0 48 156.0 49 163.5 50 150.5 51 153.0 52 149.0 53 131.5 54 130.5 55 141.0 56 139.5 57 126.0 58 127.5 59 131.5 60 121.5 61 123.0 62 131.0 63 113.0 64 99.0 65 100.0 66 91.5 67 80.0 68 86.0 69 82.0 70 76.0 71 77.5 72 70.5 73 59.5 74 46.5 75 41.0 76 32.0 77 25.0 78 21.5 79 18.0 80 15.5 81 11.5 82 6.0 83 2.5 84 2.5 85 2.0 86 0.5 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.2 6 0.2 7 0.2 8 0.2 9 0.2 10-11 0.2 12-13 0.2 14-15 0.2 16-17 0.2 18-19 0.2 20-21 0.2 22-23 0.2 24-25 0.2 26-27 0.2 28-29 0.2 30-31 0.2 32-33 0.2 34-35 0.2 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 8.0 36 0.0 37 0.0 38 4.0 39 1.0 40 0.0 41 1.0 42 2.0 43 2.0 44 2.0 45 1.0 46 5.0 47 1.0 48 4.0 49 3.0 50 2.0 51 3.0 52 4.0 53 6.0 54 3.0 55 6.0 56 3.0 57 8.0 58 10.0 59 8.0 60 4.0 61 7.0 62 9.0 63 14.0 64 9.0 65 9.0 66 10.0 67 10.0 68 6.0 69 8.0 70 13.0 71 14.0 72 24.0 73 74.0 74 301.0 75 848.0 76 2553.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4579799537394 95.775 2 1.2850167052171677 2.5 3 0.20560267283474687 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02570033410434336 0.2 9 0.0 0.0 >10 0.02570033410434336 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 37 0.9249999999999999 TruSeq Adapter, Index 13 (97% over 38bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389817 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6155 32.0 32.0 32.0 32.0 32.0 2 30.18525 32.0 32.0 32.0 21.0 32.0 3 29.8585 32.0 32.0 32.0 21.0 32.0 4 29.951 32.0 32.0 32.0 21.0 32.0 5 29.978 32.0 32.0 32.0 21.0 32.0 6 33.19975 36.0 36.0 36.0 21.0 36.0 7 33.24125 36.0 36.0 36.0 21.0 36.0 8 33.10225 36.0 36.0 36.0 21.0 36.0 9 32.95625 36.0 36.0 36.0 21.0 36.0 10-11 33.067750000000004 36.0 36.0 36.0 21.0 36.0 12-13 33.1005 36.0 36.0 36.0 21.0 36.0 14-15 32.893375 36.0 36.0 36.0 17.5 36.0 16-17 33.05 36.0 36.0 36.0 21.0 36.0 18-19 32.923500000000004 36.0 36.0 36.0 17.5 36.0 20-21 32.7365 36.0 36.0 36.0 14.0 36.0 22-23 32.8505 36.0 36.0 36.0 17.5 36.0 24-25 32.884125 36.0 36.0 36.0 17.5 36.0 26-27 32.675625 36.0 36.0 36.0 14.0 36.0 28-29 32.777875 36.0 36.0 36.0 14.0 36.0 30-31 32.68675 36.0 36.0 36.0 14.0 36.0 32-33 32.5655 36.0 36.0 36.0 14.0 36.0 34-35 32.508125 36.0 34.0 36.0 14.0 36.0 36-37 32.68975903614458 36.0 36.0 36.0 14.0 36.0 38-39 32.53483952766605 36.0 36.0 36.0 14.0 36.0 40-41 32.598055968457516 36.0 36.0 36.0 14.0 36.0 42-43 32.65349898536518 36.0 36.0 36.0 14.0 36.0 44-45 32.4779754836447 36.0 34.0 36.0 14.0 36.0 46-47 32.42546221705956 36.0 34.0 36.0 14.0 36.0 48-49 32.44260720219348 36.0 34.0 36.0 14.0 36.0 50-51 32.5084491724726 36.0 34.0 36.0 14.0 36.0 52-53 32.45689753741966 36.0 32.0 36.0 14.0 36.0 54-55 32.42334758249214 36.0 34.0 36.0 14.0 36.0 56-57 32.5325576799693 36.0 34.0 36.0 14.0 36.0 58-59 32.22038245271548 36.0 32.0 36.0 14.0 36.0 60-61 32.262647735081586 36.0 32.0 36.0 14.0 36.0 62-63 31.92996807915226 36.0 32.0 36.0 14.0 36.0 64-65 31.851066169603655 36.0 32.0 36.0 14.0 36.0 66-67 31.9817999479031 36.0 32.0 36.0 14.0 36.0 68-69 31.920947404498087 36.0 32.0 36.0 14.0 36.0 70-71 31.837853592533275 36.0 32.0 36.0 14.0 36.0 72-73 31.71925723337411 36.0 32.0 36.0 14.0 36.0 74-75 31.753564196092228 36.0 32.0 36.0 14.0 36.0 76 31.383195916764823 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 0.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 15.0 16 25.0 17 15.0 18 4.0 19 9.0 20 4.0 21 10.0 22 16.0 23 24.0 24 29.0 25 39.0 26 69.0 27 101.0 28 139.0 29 170.0 30 229.0 31 299.0 32 473.0 33 610.0 34 990.0 35 707.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.45504771471622 19.21145153189352 9.668508287292818 36.66499246609744 2 30.16829942225571 21.50213514192414 29.264004019090677 19.065561416729466 3 24.347389558232933 27.28413654618474 19.80421686746988 28.56425702811245 4 29.743975903614455 30.747991967871485 16.29016064257028 23.217871485943775 5 30.42168674698795 31.099397590361445 17.670682730923694 20.80823293172691 6 24.75520964097414 33.61787597288476 20.96409741400954 20.66281697213156 7 24.15871421396283 16.09743847312908 33.274736313410344 26.46911099949774 8 25.65905096660808 21.164951041928195 23.47476776299272 29.701230228471005 9 24.460070316423906 21.79809141135108 26.670015067805124 27.071823204419886 10-11 27.727501256913023 26.784816490698844 18.96681749622926 26.520864756158876 12-13 28.33228445563247 20.15103838892385 23.348017621145374 28.1686595342983 14-15 26.988922457200403 23.904833836858007 23.992950654582074 25.113293051359513 16-17 28.636134876698538 22.395571212883745 22.52138902868646 26.446904881731253 18-19 27.818319073980874 22.64720684448918 22.99949672873679 26.534977352793156 20-21 27.0862177470107 23.28508495909377 23.511642542479546 26.117054751415985 22-23 28.370044052863435 23.247325361862806 22.013845185651356 26.368785399622404 24-25 26.423632935260844 23.972344437460716 22.576995600251415 27.027027027027028 26-27 26.848591549295776 25.27665995975855 21.919014084507044 25.95573440643863 28-29 26.887267237040763 24.584801207851033 21.602918973326624 26.925012581781584 30-31 26.34293621839225 24.153981632909797 23.172726129072842 26.33035601962511 32-33 26.393257013460815 24.38042521071833 23.86463706126557 25.36168071455529 34-35 27.867203219315893 23.767605633802816 22.1579476861167 26.20724346076459 36-37 26.936619718309856 24.446680080482896 22.522635814889334 26.094064386317907 38-39 26.887267237040763 24.345747357825868 23.062405636638147 25.70457976849522 40-41 28.09865357996728 23.291808229520576 22.57455643639109 26.034981754121052 42-43 27.414683289258278 23.25903538597154 23.536078579523988 25.790202745246187 44-45 27.108813516580504 23.780103391753876 22.771403353927624 26.339679737737992 46-47 27.43340487312208 24.113117030677945 22.560282792576693 25.89319530362328 48-49 26.722285425357096 23.878144355960053 23.321956769055745 26.0776134496271 50-51 27.118429385687143 24.53451551614946 22.507916402786574 25.839138695376825 52-53 28.2382762991128 23.548795944233206 22.585551330798477 25.627376425855513 54-55 27.53144454326007 24.20276966078008 22.373268962012453 25.892516833947404 56-57 27.876782077393074 23.85437881873727 22.874236252545824 25.394602851323828 58-59 29.449342021208636 22.818448958732592 22.53737064009199 25.194838379966782 60-61 28.27621614683609 23.142087023488642 22.78269798485432 25.798998844820947 62-63 27.83359093250902 24.18856259659969 22.82328696548171 25.154559505409583 64-65 28.229045213110503 22.52882497732867 23.733644254437102 25.508485555123723 66-67 27.079807316755634 24.03332899362062 22.809530009113395 26.07733368051035 68-69 27.484309623430963 24.42468619246862 23.548640167364017 24.5423640167364 70-71 27.441188066763043 24.65501379944802 22.552240767512156 25.35155736627678 72-73 26.399042934999333 24.05955071115247 22.610660640701848 26.930745713146354 74-75 27.19954808642847 21.183448665442732 24.09264228216354 27.52436096596526 76 28.59387274155538 0.0 32.992930086410055 38.413197172034565 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 8.5 2 0.5 3 1.0 4 1.5 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.5 19 2.5 20 1.5 21 1.5 22 2.5 23 3.5 24 5.0 25 6.0 26 4.5 27 5.0 28 8.5 29 12.5 30 13.0 31 12.5 32 18.0 33 29.0 34 44.0 35 61.5 36 79.5 37 88.5 38 93.0 39 103.5 40 111.5 41 128.0 42 146.5 43 167.5 44 184.0 45 181.0 46 178.0 47 174.5 48 174.5 49 168.0 50 150.0 51 150.5 52 146.0 53 136.0 54 143.5 55 148.5 56 136.5 57 131.5 58 138.5 59 134.5 60 130.0 61 139.5 62 148.0 63 139.5 64 119.0 65 110.5 66 100.5 67 83.5 68 83.0 69 81.0 70 79.0 71 83.5 72 74.0 73 60.0 74 55.0 75 50.0 76 38.5 77 26.5 78 23.0 79 19.5 80 16.0 81 12.5 82 8.5 83 5.5 84 4.5 85 2.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 1.0 98 0.5 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.475 3 0.4 4 0.4 5 0.4 6 0.42500000000000004 7 0.44999999999999996 8 0.42500000000000004 9 0.44999999999999996 10-11 0.5499999999999999 12-13 0.6875 14-15 0.7000000000000001 16-17 0.65 18-19 0.65 20-21 0.6875 22-23 0.6875 24-25 0.5625 26-27 0.6 28-29 0.65 30-31 0.6375 32-33 0.6375 34-35 0.6 36-37 0.2008032128514056 38-39 0.21343377275580663 40-41 0.15077271013946475 42-43 0.1634397787276842 44-45 0.18877422602567331 46-47 0.20158750157490235 48-49 0.1640585562847047 50-51 0.21486349848331646 52-53 0.12658227848101267 54-55 0.15222630978054041 56-57 0.11443102352193261 58-59 0.08935409752361502 60-61 0.11538461538461539 62-63 0.11578541103820918 64-65 0.10353306587291317 66-67 0.10404473923787229 68-69 0.052273915316257184 70-71 0.0394114555964267 72-73 0.053142022053939156 74-75 0.028236622899901174 76 0.03926187671770711 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 16.0 36 0.0 37 0.0 38 3.0 39 1.0 40 1.0 41 1.0 42 2.0 43 2.0 44 2.0 45 1.0 46 5.0 47 2.0 48 4.0 49 3.0 50 2.0 51 3.0 52 4.0 53 5.0 54 3.0 55 6.0 56 3.0 57 9.0 58 10.0 59 10.0 60 4.0 61 7.0 62 9.0 63 14.0 64 9.0 65 9.0 66 11.0 67 10.0 68 6.0 69 11.0 70 12.0 71 22.0 72 29.0 73 72.0 74 271.0 75 859.0 76 2547.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.46743295019157 96.375 2 1.3537675606641124 2.65 3 0.07662835249042146 0.22499999999999998 4 0.05108556832694764 0.2 5 0.0 0.0 6 0.02554278416347382 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02554278416347382 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151921 spots for SRR11389817.sra Written 1151921 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra Read 1151910 spots for SRR11389817.sra Written 1151910 spots for SRR11389817.sra SRR ids: ['SRR11389817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ndvftck0 SRR11389817.sra spots: 23038211 blocks: [[1, 1151910], [1151911, 2303820], [2303821, 3455730], [3455731, 4607640], [4607641, 5759550], [5759551, 6911460], [6911461, 8063370], [8063371, 9215280], [9215281, 10367190], [10367191, 11519100], [11519101, 12671010], [12671011, 13822920], [13822921, 14974830], [14974831, 16126740], [16126741, 17278650], [17278651, 18430560], [18430561, 19582470], [19582471, 20734380], [20734381, 21886290], [21886291, 23038211]] SRR11389817 file size 4348291 SRR11389817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389817 SRR11389817_1.fastq SRR11389817_2.fastq Input file: SRR11389817_1.fastq Paired file: SRR11389817_2.fastq trimmed: SRR11389817-trimmed-pair1.fastq, SRR11389817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:23:42 2024 >> started Sat Dec 7 07:24:02 2024 >> done (19.650s) 23038211 read pairs processed; of these: 982 ( 0.00%) short read pairs filtered out after trimming by size control 314902 ( 1.37%) empty read pairs filtered out after trimming by size control 22722327 (98.63%) read pairs available; of these: 37303 ( 0.16%) trimmed read pairs available after processing 22685024 (99.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 3 0.00% 21 5 0.00% 22 9 0.00% 23 9 0.00% 24 18 0.00% 25 18 0.00% 26 20 0.00% 27 24 0.00% 28 30 0.00% 29 33 0.00% 30 36 0.00% 31 37 0.00% 32 35 0.00% 33 48 0.00% 34 61 0.00% 35 4934 0.02% 36 5500 0.02% 37 6140 0.03% 38 6943 0.03% 39 8451 0.04% 40 9994 0.04% 41 11595 0.05% 42 12908 0.06% 43 14298 0.06% 44 15345 0.07% 45 15866 0.07% 46 17250 0.08% 47 18936 0.08% 48 20113 0.09% 49 21965 0.10% 50 23791 0.10% 51 26355 0.12% 52 28848 0.13% 53 30673 0.13% 54 33156 0.15% 55 35162 0.15% 56 36807 0.16% 57 39260 0.17% 58 42573 0.19% 59 44871 0.20% 60 47705 0.21% 61 50097 0.22% 62 53582 0.24% 63 56959 0.25% 64 60770 0.27% 65 63298 0.28% 66 67267 0.30% 67 71841 0.32% 68 70462 0.31% 69 74342 0.33% 70 79045 0.35% 71 90157 0.40% 72 106905 0.47% 73 265290 1.17% 74 1526237 6.72% 75 9246491 40.69% 76 10259756 45.15% 22722327 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=26.02 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.6 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.18 sequence-density-rank=26 fanout-score=94.02 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=16.8 sequence=GCCGCCGCCACCCT SRR11389817 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:24:39 Started mapping on | Dec 07 07:24:40 Finished on | Dec 07 07:26:12 Mapping speed, Million of reads per hour | 889.13 Number of input reads | 22722327 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 19877788 Uniquely mapped reads % | 87.48% Average mapped length | 148.50 Number of splices: Total | 8617224 Number of splices: Annotated (sjdb) | 8202601 Number of splices: GT/AG | 8497778 Number of splices: GC/AG | 105094 Number of splices: AT/AC | 2661 Number of splices: Non-canonical | 11691 Mismatch rate per base, % | 0.88% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1803366 % of reads mapped to multiple loci | 7.94% Number of reads mapped to too many loci | 75049 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1041173 1041173 1041173 N_multimapping 1803366 1803366 1803366 N_noFeature 641824 19249730 926277 N_ambiguous 451095 2608 112149 UnstrandedReadsAssigned:18784869 PositiveStrandReadsAssigned:625450 NegativeStrandReadsAssigned:18839362 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389817-trimmed-pair1.fastq SRR11389817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,722,327 reads, 20,302,436 reads pseudoaligned [quant] estimated average fragment length: 149.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR11389817.ke.tsv 35125 SRR11389817.se.tsv 88098 total ==> SRR11389817.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 787.843 0 0 PNS24247 1044 895.733 32.8708 2.57702 PNS24249 1928 1779.73 135.581 5.34971 PNS24246 1044 895.733 32.8708 2.57702 PNS24248 1044 895.733 32.8708 2.57702 PNS24244 1471 1322.73 49.8062 2.64421 PNS24243 293 152.55 0 0 KQK14069 1603 1454.73 1941.36 93.715 KQK14071 474 326.79 77.217 16.5932 ==> SRR11389817.se.tsv <== BRADI_1g14170v3 2072 BRADI_1g53295v3 15 BRADI_1g59795v3 282 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 179 BRADI_1g74790v3 206 BRADI_1g09890v3 0 BRADI_1g77505v3 250 BRADI_1g48960v3 0 SRR11389817 completed mapping pipeline successfully