Starting /dee2/code/volunteer_pipeline.sh SRR11389818 current disk space = 1544575098880 free memory = 1603844604 SRR11389818 SRAfilesize 1fcde6055b97ef8cc7d0c069e7df5c36 SRR11389818.sra SRR11389818.sra file validated SRR11389818 is paired end SRR11389818 is conventional basespace SRR11389818 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07 32.0 32.0 32.0 32.0 32.0 2 31.00025 32.0 32.0 32.0 32.0 32.0 3 31.1285 32.0 32.0 32.0 32.0 32.0 4 31.19275 32.0 32.0 32.0 32.0 32.0 5 31.26775 32.0 32.0 32.0 32.0 32.0 6 34.05625 36.0 36.0 36.0 32.0 36.0 7 34.01625 36.0 36.0 36.0 32.0 36.0 8 33.98525 36.0 36.0 36.0 32.0 36.0 9 34.06125 36.0 36.0 36.0 32.0 36.0 10-11 34.021874999999994 36.0 36.0 36.0 32.0 36.0 12-13 34.075 36.0 36.0 36.0 32.0 36.0 14-15 34.064750000000004 36.0 36.0 36.0 32.0 36.0 16-17 33.98325 36.0 36.0 36.0 32.0 36.0 18-19 33.883375 36.0 36.0 36.0 32.0 36.0 20-21 34.059875 36.0 36.0 36.0 32.0 36.0 22-23 33.806124999999994 36.0 36.0 36.0 32.0 36.0 24-25 33.757125 36.0 36.0 36.0 29.5 36.0 26-27 33.7645 36.0 36.0 36.0 32.0 36.0 28-29 33.611625000000004 36.0 36.0 36.0 26.5 36.0 30-31 33.495000000000005 36.0 36.0 36.0 24.0 36.0 32-33 33.53275 36.0 36.0 36.0 27.0 36.0 34-35 33.629125 36.0 36.0 36.0 29.5 36.0 36-37 33.321455363840954 36.0 36.0 36.0 21.0 36.0 38-39 33.36339754816112 36.0 36.0 36.0 21.0 36.0 40-41 33.26560153316352 36.0 36.0 36.0 21.0 36.0 42-43 33.133483596293516 36.0 36.0 36.0 17.5 36.0 44-45 32.985251294870984 36.0 36.0 36.0 17.5 36.0 46-47 33.11796059655384 36.0 36.0 36.0 17.5 36.0 48-49 33.080005704668984 36.0 36.0 36.0 21.0 36.0 50-51 33.022136816392674 36.0 36.0 36.0 17.5 36.0 52-53 32.932413463037776 36.0 36.0 36.0 14.0 36.0 54-55 32.8997915134045 36.0 36.0 36.0 14.0 36.0 56-57 32.87259689350536 36.0 36.0 36.0 14.0 36.0 58-59 32.631612286726515 36.0 32.0 36.0 14.0 36.0 60-61 32.52063154020635 36.0 34.0 36.0 14.0 36.0 62-63 32.58002396702314 36.0 36.0 36.0 14.0 36.0 64-65 32.749652999776046 36.0 34.0 36.0 14.0 36.0 66-67 32.648186875300084 36.0 34.0 36.0 14.0 36.0 68-69 32.61947877725251 36.0 34.0 36.0 14.0 36.0 70-71 32.49617319121519 36.0 32.0 36.0 14.0 36.0 72-73 32.41720052529405 36.0 34.0 36.0 14.0 36.0 74-75 32.252597636466845 36.0 32.0 36.0 14.0 36.0 76 32.067674858223064 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 5.0 24 9.0 25 11.0 26 27.0 27 70.0 28 102.0 29 167.0 30 224.0 31 332.0 32 504.0 33 738.0 34 1077.0 35 728.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.80845211302826 11.277819454863716 10.677669417354338 44.236059014753685 2 22.780695173793447 13.703425856464117 36.98424606151538 26.531632908227053 3 22.05551387846962 17.154288572143038 23.005751437859466 37.78444611152788 4 28.40710177544386 22.755688922230558 18.02950737684421 30.807701925481368 5 28.80720180045011 26.331582895723933 22.305576394098527 22.55563890972743 6 24.756189047261813 29.557389347336834 23.55588897224306 22.13053263315829 7 18.95473868467117 24.306076519129782 33.48337084271068 23.25581395348837 8 20.38009502375594 23.58089522380595 29.057264316079017 26.981745436359088 9 22.030507626906726 19.854963740935233 31.90797699424856 26.206551637909474 10-11 24.493623405851466 28.019504876219052 21.85546386596649 25.63140785196299 12-13 26.39409852463116 21.630407601900476 22.74318579644911 29.232308077019255 14-15 23.69342335583896 23.493373343335833 26.04401100275069 26.76919229807452 16-17 25.018754688672168 23.655913978494624 24.293573393348336 27.031757939484873 18-19 24.981245311327832 22.343085771442862 24.843710927731934 27.831957989497376 20-21 25.468867216804203 23.243310827706924 25.081270317579396 26.206551637909474 22-23 25.656414103525883 24.74368592148037 24.15603900975244 25.44386096524131 24-25 24.706176544136035 23.293323330832706 25.006251562890725 26.994248562140534 26-27 23.99349837459365 23.943485871467868 24.681170292573142 27.38184546136534 28-29 26.19404851212803 24.3935983995999 23.593398349587396 25.818954738684667 30-31 24.431107776944234 23.768442110527634 24.793698424606152 27.00675168792198 32-33 24.23105776444111 24.618654663665918 24.381095273818453 26.76919229807452 34-35 26.19404851212803 24.256064016004 23.193298324581146 26.356589147286826 36-37 25.456364091022753 24.031007751937985 23.705926481620406 26.806701675418854 38-39 23.967975981986488 23.592694520890667 25.881911433575183 26.55741806354766 40-41 26.023282012767556 22.831393165602705 24.571285517586684 26.57403930404306 42-43 24.931129476584022 23.7290257951415 24.192336589030806 27.147508139243676 44-45 24.68949943545352 23.108769288671436 25.166227574959226 27.035503700915818 46-47 26.978146194423513 23.122331072594825 23.536799799045465 26.362722933936194 48-49 25.229530876619293 23.94667337441831 24.14790592378317 26.675889825179222 50-51 25.14804082146907 23.6361345596573 24.555877535592792 26.659947083280837 52-53 24.97793468667255 23.137057117639642 23.578363384188627 28.306644811499183 54-55 26.504044489383215 22.446916076845298 23.72345803842265 27.325581395348834 56-57 24.278115501519757 24.189463019250255 24.886018237082066 26.646403242147926 58-59 25.244817499682053 22.879308152104795 24.91415490270889 26.96171944550426 60-61 26.559510141599695 22.91108559765276 24.543946932006634 25.985457328740914 62-63 25.73953131002689 22.89665770265079 24.779101037264695 26.58470995005763 64-65 25.025759917568262 23.5059247810407 25.07727975270479 26.391035548686244 66-67 25.399091499026603 24.075275794938353 23.893575600259574 26.63205710577547 68-69 25.33699777516032 24.577934825284647 23.3869912315142 26.698076168040828 70-71 25.68083146954348 24.496776739902646 23.102223391658992 26.720168398894884 72-73 25.992300544271867 23.762113367848134 23.655913978494624 26.589672109385372 74-75 26.060008451894635 20.171855190871955 26.285392308775883 27.48274404845753 76 29.073724007561434 0.0 32.24952741020794 38.67674858223062 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.5 19 5.5 20 7.5 21 11.5 22 10.5 23 7.5 24 5.5 25 5.5 26 6.5 27 9.5 28 11.5 29 11.0 30 11.0 31 14.5 32 22.5 33 33.5 34 42.0 35 53.0 36 69.0 37 82.5 38 105.5 39 133.0 40 150.0 41 161.5 42 168.0 43 186.5 44 218.0 45 209.5 46 182.5 47 178.0 48 179.5 49 158.5 50 131.5 51 141.0 52 152.5 53 145.0 54 132.0 55 128.5 56 139.5 57 143.0 58 140.5 59 133.5 60 132.5 61 131.5 62 119.5 63 116.0 64 105.0 65 92.0 66 90.5 67 91.5 68 92.0 69 85.5 70 69.0 71 58.0 72 54.0 73 43.5 74 39.0 75 42.0 76 38.0 77 31.0 78 24.5 79 18.5 80 13.0 81 8.0 82 8.0 83 8.0 84 5.0 85 2.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 2.0 38 0.0 39 1.0 40 3.0 41 0.0 42 0.0 43 6.0 44 3.0 45 2.0 46 2.0 47 3.0 48 3.0 49 4.0 50 3.0 51 0.0 52 3.0 53 5.0 54 6.0 55 3.0 56 4.0 57 11.0 58 7.0 59 6.0 60 5.0 61 10.0 62 5.0 63 13.0 64 14.0 65 17.0 66 11.0 67 20.0 68 13.0 69 7.0 70 13.0 71 14.0 72 27.0 73 58.0 74 291.0 75 759.0 76 2645.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48756729043835 96.05 2 1.3073570879261727 2.55 3 0.07690335811330429 0.22499999999999998 4 0.10253781081773904 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 31 0.775 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389818 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389818_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.71575 32.0 32.0 32.0 32.0 32.0 2 30.235 32.0 32.0 32.0 21.0 32.0 3 30.08775 32.0 32.0 32.0 21.0 32.0 4 29.9745 32.0 32.0 32.0 21.0 32.0 5 29.97875 32.0 32.0 32.0 21.0 32.0 6 33.23925 36.0 36.0 36.0 21.0 36.0 7 33.341 36.0 36.0 36.0 21.0 36.0 8 33.16325 36.0 36.0 36.0 21.0 36.0 9 33.2835 36.0 36.0 36.0 21.0 36.0 10-11 33.06175 36.0 36.0 36.0 21.0 36.0 12-13 33.07275 36.0 36.0 36.0 21.0 36.0 14-15 33.02575 36.0 36.0 36.0 21.0 36.0 16-17 33.090374999999995 36.0 36.0 36.0 17.5 36.0 18-19 33.112125 36.0 36.0 36.0 17.5 36.0 20-21 32.55875 36.0 34.0 36.0 14.0 36.0 22-23 33.109125 36.0 36.0 36.0 17.5 36.0 24-25 32.91075 36.0 36.0 36.0 21.0 36.0 26-27 32.7855 36.0 36.0 36.0 14.0 36.0 28-29 32.809875000000005 36.0 36.0 36.0 14.0 36.0 30-31 32.702625 36.0 36.0 36.0 14.0 36.0 32-33 32.780125 36.0 36.0 36.0 14.0 36.0 34-35 32.561125000000004 36.0 34.0 36.0 14.0 36.0 36-37 32.74213791808511 36.0 36.0 36.0 14.0 36.0 38-39 32.71527081243731 36.0 36.0 36.0 14.0 36.0 40-41 32.7706645808214 36.0 36.0 36.0 14.0 36.0 42-43 32.73343373493976 36.0 36.0 36.0 14.0 36.0 44-45 32.459547701034936 36.0 34.0 36.0 14.0 36.0 46-47 32.54301722981168 36.0 34.0 36.0 14.0 36.0 48-49 32.53296831779075 36.0 36.0 36.0 14.0 36.0 50-51 32.633137860791386 36.0 36.0 36.0 14.0 36.0 52-53 32.37764003200395 36.0 32.0 36.0 14.0 36.0 54-55 32.41940835889393 36.0 32.0 36.0 14.0 36.0 56-57 32.61421983856093 36.0 34.0 36.0 14.0 36.0 58-59 32.270764900344574 36.0 32.0 36.0 14.0 36.0 60-61 32.46385838864856 36.0 34.0 36.0 14.0 36.0 62-63 32.045672429941845 36.0 32.0 36.0 14.0 36.0 64-65 31.89588461183463 36.0 32.0 36.0 14.0 36.0 66-67 31.723860888742117 36.0 32.0 36.0 14.0 36.0 68-69 31.990356833822457 36.0 32.0 36.0 14.0 36.0 70-71 32.07568045105609 36.0 32.0 36.0 14.0 36.0 72-73 31.76694296351898 36.0 32.0 36.0 14.0 36.0 74-75 31.72704250062694 36.0 32.0 36.0 14.0 36.0 76 31.61441013460016 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 16.0 16 23.0 17 19.0 18 11.0 19 9.0 20 8.0 21 10.0 22 17.0 23 21.0 24 30.0 25 29.0 26 54.0 27 95.0 28 138.0 29 155.0 30 252.0 31 305.0 32 447.0 33 636.0 34 935.0 35 777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.659147869674186 18.596491228070175 9.874686716791981 37.86967418546366 2 29.07268170426065 22.05513784461153 29.79949874686717 19.072681704260653 3 26.252505010020037 26.177354709418836 19.914829659318638 27.655310621242485 4 28.331663326653306 31.83867735470942 16.708416833667332 23.12124248496994 5 29.859719438877757 30.185370741482963 19.839679358717436 20.115230460921843 6 24.705587572037082 32.52317714858432 21.748935103983964 21.022300175394637 7 23.609022556390975 17.167919799498748 31.97994987468672 27.24310776942356 8 24.805813079428717 21.92432974191932 24.27962916562265 28.990228013029316 9 24.379854673014282 21.874216988223502 26.634928589325984 27.110999749436232 10-11 28.1540005016303 26.84976172560823 18.798595435164284 26.197642337597195 12-13 28.069294501631937 20.574943509917148 22.985187044941 28.37057494350992 14-15 27.29098669344715 23.487321114737636 23.39944765252322 25.82224453929199 16-17 28.16972131559126 22.985187044941 22.382626161185037 26.462465478282702 18-19 26.575445643986946 23.085613858900324 23.524981169972385 26.813959327140346 20-21 26.550338940497113 23.16093396936982 23.98945518453427 26.299271905598793 22-23 27.55460708009038 23.186040672859654 23.060507155410495 26.198845091639466 24-25 27.809834420471653 23.833416959357752 22.202709483191168 26.154039136979428 26-27 26.248431618569633 25.10664993726474 23.41279799247177 25.232120451693852 28-29 26.56289229224203 24.190308812452923 22.77178006527743 26.47501883002762 30-31 26.973766788000503 23.697753232082338 22.932094891427138 26.39638508849002 32-33 27.011422116229443 23.258441069411322 23.64754612777708 26.08259068658215 34-35 27.40619902120718 23.5537708620906 23.290249717655918 25.74978039904631 36-37 26.888331242158092 23.350062735257215 23.613550815558344 26.14805520702635 38-39 26.73279758915118 24.66097438473129 23.593671521848318 25.012556504269213 40-41 28.0225988700565 23.414940364092907 21.745134965473948 26.817325800376647 42-43 26.774720442266613 23.33207689408217 23.14361100640784 26.74959165724337 44-45 26.57351460221551 23.476837865055387 23.753776435045317 26.19587109768379 46-47 26.959919334509706 24.716410385681876 22.485505419712627 25.83816486009579 48-49 27.098321342925658 23.046825697336867 23.56430644957718 26.290546510160297 50-51 27.543016194331983 24.44331983805668 22.381072874493928 25.63259109311741 52-53 28.260594560404805 24.237824161922834 21.669829222011387 25.83175205566097 54-55 28.4790054547761 23.252568818977544 22.212355702143853 26.0560700241025 56-57 27.280813214739517 23.659466327827193 23.303684879288436 25.756035578144854 58-59 29.025261546312837 23.488134728247 21.79127328400102 25.69533044143914 60-61 27.903700857984376 23.408887181457295 22.48687411960558 26.200537840952748 62-63 28.11616551015163 23.19455152916988 23.066049858648164 25.623233102030323 64-65 27.63702171664943 23.229058945191312 22.078593588417785 27.05532574974147 66-67 27.884865850481894 24.068767908309454 21.945819223756185 26.100547017452463 68-69 25.764536028350175 24.438902743142144 23.756398477490485 26.040162751017192 70-71 27.00277154546654 24.020060710043552 23.478949452289825 25.498218292200082 72-73 25.92147435897436 24.586004273504273 22.235576923076923 27.256944444444443 74-75 27.198743575099943 22.01599086236436 24.229011993146774 26.55625356938892 76 28.83168316831683 0.0 31.326732673267326 39.84158415841584 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.5 19 4.5 20 6.0 21 6.0 22 5.0 23 4.0 24 6.5 25 6.5 26 4.0 27 5.5 28 11.5 29 14.5 30 11.5 31 17.0 32 29.0 33 33.0 34 43.0 35 62.0 36 71.0 37 82.0 38 98.0 39 106.5 40 127.5 41 148.0 42 157.0 43 166.5 44 174.5 45 171.5 46 165.5 47 165.0 48 167.0 49 160.0 50 147.5 51 141.0 52 137.5 53 141.5 54 134.0 55 126.0 56 137.0 57 140.5 58 137.0 59 147.5 60 156.5 61 150.0 62 140.5 63 121.5 64 112.0 65 108.5 66 113.5 67 122.5 68 101.0 69 79.5 70 76.5 71 80.0 72 69.0 73 54.5 74 47.0 75 43.0 76 42.0 77 30.5 78 22.0 79 21.5 80 15.5 81 10.5 82 7.5 83 6.0 84 5.0 85 4.0 86 2.0 87 0.0 88 0.5 89 0.5 90 0.0 91 1.0 92 2.0 93 1.0 94 0.0 95 1.0 96 2.0 97 1.0 98 0.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.2 4 0.2 5 0.2 6 0.22499999999999998 7 0.25 8 0.22499999999999998 9 0.22499999999999998 10-11 0.325 12-13 0.42500000000000004 14-15 0.42500000000000004 16-17 0.42500000000000004 18-19 0.42500000000000004 20-21 0.42500000000000004 22-23 0.42500000000000004 24-25 0.35000000000000003 26-27 0.375 28-29 0.42500000000000004 30-31 0.41250000000000003 32-33 0.41250000000000003 34-35 0.3875 36-37 0.1378273399323393 38-39 0.15045135406218654 40-41 0.07527286413248024 42-43 0.11295180722891565 44-45 0.1131648434552999 46-47 0.12588116817724068 48-49 0.12605571662674903 50-51 0.16420361247947454 52-53 0.050575293968896186 54-55 0.08871989860583017 56-57 0.05080010160020319 58-59 0.0510073960724305 60-61 0.07677543186180423 62-63 0.05137426149499101 64-65 0.03876469828143171 66-67 0.0520697734964853 68-69 0.02624327516074006 70-71 0.02638870563398865 72-73 0.040048057669203045 74-75 0.028546959748786755 76 0.0395882818685669 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 1.0 37 2.0 38 0.0 39 1.0 40 3.0 41 0.0 42 0.0 43 6.0 44 3.0 45 2.0 46 2.0 47 3.0 48 3.0 49 5.0 50 3.0 51 1.0 52 3.0 53 5.0 54 6.0 55 3.0 56 4.0 57 10.0 58 8.0 59 7.0 60 5.0 61 10.0 62 4.0 63 14.0 64 15.0 65 16.0 66 10.0 67 19.0 68 13.0 69 7.0 70 15.0 71 17.0 72 39.0 73 78.0 74 290.0 75 832.0 76 2526.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39162624457492 96.35000000000001 2 1.327546591779423 2.6 3 0.15317845289762574 0.44999999999999996 4 0.10211896859841717 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025529742149604292 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGAGG 10 0.009140795 130.0238 70 >>END_MODULE Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136976 spots for SRR11389818.sra Written 1136976 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra Read 1136960 spots for SRR11389818.sra Written 1136960 spots for SRR11389818.sra SRR ids: ['SRR11389818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_no6zak3d SRR11389818.sra spots: 22739216 blocks: [[1, 1136960], [1136961, 2273920], [2273921, 3410880], [3410881, 4547840], [4547841, 5684800], [5684801, 6821760], [6821761, 7958720], [7958721, 9095680], [9095681, 10232640], [10232641, 11369600], [11369601, 12506560], [12506561, 13643520], [13643521, 14780480], [14780481, 15917440], [15917441, 17054400], [17054401, 18191360], [18191361, 19328320], [19328321, 20465280], [20465281, 21602240], [21602241, 22739216]] SRR11389818 file size 4287456 SRR11389818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389818 SRR11389818_1.fastq SRR11389818_2.fastq Input file: SRR11389818_1.fastq Paired file: SRR11389818_2.fastq trimmed: SRR11389818-trimmed-pair1.fastq, SRR11389818-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:22:57 2024 >> started Sat Dec 7 07:23:14 2024 >> done (17.539s) 22739216 read pairs processed; of these: 936 ( 0.00%) short read pairs filtered out after trimming by size control 372022 ( 1.64%) empty read pairs filtered out after trimming by size control 22366258 (98.36%) read pairs available; of these: 38357 ( 0.17%) trimmed read pairs available after processing 22327901 (99.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 0 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 14 0.00% 25 5 0.00% 26 14 0.00% 27 15 0.00% 28 23 0.00% 29 26 0.00% 30 35 0.00% 31 40 0.00% 32 44 0.00% 33 35 0.00% 34 51 0.00% 35 5184 0.02% 36 5736 0.03% 37 6397 0.03% 38 7642 0.03% 39 8906 0.04% 40 10611 0.05% 41 12350 0.06% 42 13768 0.06% 43 14698 0.07% 44 16415 0.07% 45 17337 0.08% 46 18278 0.08% 47 20324 0.09% 48 22143 0.10% 49 23957 0.11% 50 26165 0.12% 51 28575 0.13% 52 31208 0.14% 53 33458 0.15% 54 35439 0.16% 55 38069 0.17% 56 40617 0.18% 57 42832 0.19% 58 46141 0.21% 59 48803 0.22% 60 51304 0.23% 61 54714 0.24% 62 58662 0.26% 63 61452 0.27% 64 65946 0.29% 65 68296 0.31% 66 72178 0.32% 67 76672 0.34% 68 75667 0.34% 69 79500 0.36% 70 83617 0.37% 71 94664 0.42% 72 110593 0.49% 73 266752 1.19% 74 1498926 6.70% 75 9044477 40.44% 76 10027456 44.83% 22366258 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=11 prefix-density=0.71 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=26.60 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.4 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=24 prefix-density=0.74 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.18 sequence-density-rank=25 fanout-score=80.82 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=15.1 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGC SRR11389818 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:23:47 Started mapping on | Dec 07 07:23:47 Finished on | Dec 07 07:25:18 Mapping speed, Million of reads per hour | 884.82 Number of input reads | 22366258 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 19527247 Uniquely mapped reads % | 87.31% Average mapped length | 148.36 Number of splices: Total | 7965446 Number of splices: Annotated (sjdb) | 7596153 Number of splices: GT/AG | 7858318 Number of splices: GC/AG | 93616 Number of splices: AT/AC | 2674 Number of splices: Non-canonical | 10838 Mismatch rate per base, % | 0.86% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1804163 % of reads mapped to multiple loci | 8.07% Number of reads mapped to too many loci | 77054 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 1.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1034848 1034848 1034848 N_multimapping 1804163 1804163 1804163 N_noFeature 585494 18896764 891570 N_ambiguous 429132 2747 109290 UnstrandedReadsAssigned:18512621 PositiveStrandReadsAssigned:627736 NegativeStrandReadsAssigned:18526387 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389818 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389818-trimmed-pair1.fastq SRR11389818-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,366,258 reads, 20,007,061 reads pseudoaligned [quant] estimated average fragment length: 151.794 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR11389818.ke.tsv 35125 SRR11389818.se.tsv 88098 total ==> SRR11389818.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 785.272 0 0 PNS24247 1044 893.206 22.2557 1.74614 PNS24249 1928 1777.21 83.3379 3.2862 PNS24246 1044 893.206 22.2557 1.74614 PNS24248 1044 893.206 22.2557 1.74614 PNS24244 1471 1320.21 28.895 1.5338 PNS24243 293 151.341 0 0 KQK14069 1603 1452.21 18.0266 0.869912 KQK14071 474 324.381 4.97337 1.07445 ==> SRR11389818.se.tsv <== BRADI_1g14170v3 23 BRADI_1g53295v3 15 BRADI_1g59795v3 336 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 213 BRADI_1g74790v3 241 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR11389818 completed mapping pipeline successfully