Starting /dee2/code/volunteer_pipeline.sh SRR11389819 current disk space = 1544566730752 free memory = 1597630824 SRR11389819 SRAfilesize cc6e1310ca8293ccbfa747146370a658 SRR11389819.sra SRR11389819.sra file validated SRR11389819 is paired end SRR11389819 is conventional basespace SRR11389819 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.97075 32.0 32.0 32.0 32.0 32.0 2 30.95875 32.0 32.0 32.0 32.0 32.0 3 31.2035 32.0 32.0 32.0 32.0 32.0 4 31.13025 32.0 32.0 32.0 32.0 32.0 5 31.21625 32.0 32.0 32.0 32.0 32.0 6 34.02925 36.0 36.0 36.0 32.0 36.0 7 34.14225 36.0 36.0 36.0 32.0 36.0 8 34.30175 36.0 36.0 36.0 32.0 36.0 9 34.1935 36.0 36.0 36.0 32.0 36.0 10-11 34.031625000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.243125000000006 36.0 36.0 36.0 32.0 36.0 14-15 34.231125000000006 36.0 36.0 36.0 32.0 36.0 16-17 34.168 36.0 36.0 36.0 32.0 36.0 18-19 34.042375 36.0 36.0 36.0 32.0 36.0 20-21 34.080875000000006 36.0 36.0 36.0 32.0 36.0 22-23 33.919875000000005 36.0 36.0 36.0 32.0 36.0 24-25 33.850625 36.0 36.0 36.0 32.0 36.0 26-27 33.8675 36.0 36.0 36.0 32.0 36.0 28-29 33.747375000000005 36.0 36.0 36.0 32.0 36.0 30-31 33.62675 36.0 36.0 36.0 29.5 36.0 32-33 33.576125 36.0 36.0 36.0 27.0 36.0 34-35 33.712 36.0 36.0 36.0 32.0 36.0 36-37 33.62672004003002 36.0 36.0 36.0 27.0 36.0 38-39 33.52639479609707 36.0 36.0 36.0 27.0 36.0 40-41 33.48423817863397 36.0 36.0 36.0 27.0 36.0 42-43 33.30846699441741 36.0 36.0 36.0 21.0 36.0 44-45 33.150097186854914 36.0 36.0 36.0 21.0 36.0 46-47 33.20536592257753 36.0 36.0 36.0 17.5 36.0 48-49 33.34282245096652 36.0 36.0 36.0 24.0 36.0 50-51 33.1803216681099 36.0 36.0 36.0 21.0 36.0 52-53 33.27253402090189 36.0 36.0 36.0 21.0 36.0 54-55 33.076301929540655 36.0 36.0 36.0 17.5 36.0 56-57 33.13084841194464 36.0 36.0 36.0 14.0 36.0 58-59 32.78625202929909 36.0 34.0 36.0 14.0 36.0 60-61 32.792300344862475 36.0 36.0 36.0 14.0 36.0 62-63 32.64151651290849 36.0 34.0 36.0 14.0 36.0 64-65 32.88497803134632 36.0 36.0 36.0 14.0 36.0 66-67 32.8495334784194 36.0 36.0 36.0 14.0 36.0 68-69 32.873980315792046 36.0 36.0 36.0 14.0 36.0 70-71 32.88384185058074 36.0 36.0 36.0 14.0 36.0 72-73 32.66467274436049 36.0 34.0 36.0 14.0 36.0 74-75 32.56841497876225 36.0 34.0 36.0 14.0 36.0 76 32.55996914770536 36.0 36.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 7.0 25 20.0 26 44.0 27 59.0 28 95.0 29 132.0 30 187.0 31 305.0 32 471.0 33 705.0 34 1111.0 35 858.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.32724543407556 10.407805854390793 12.809607205404053 40.4553415061296 2 24.418313735301474 14.861145859394545 31.473605203902927 29.246935201401055 3 22.316737553164874 17.513134851138354 24.568426319739807 35.60170127595696 4 30.197648236177134 24.518388791593697 17.112834625969477 28.171128346259692 5 28.77157868401301 26.319739804853644 21.641230923192396 23.267450587940957 6 25.569176882662 30.873154866149612 23.892919689767325 19.664748561421067 7 20.84063047285464 24.993745308981737 32.47435576682512 21.691268451338505 8 21.290968226169625 24.26820115086315 28.546409807355516 25.894420815611706 9 21.26594946209657 21.240930698023515 31.423567675756818 26.069552164123095 10-11 24.64348261195897 28.67150362772079 21.36602451838879 25.31898924193145 12-13 25.068801601200903 23.129847385539154 23.254941205904426 28.546409807355516 14-15 24.305729296972732 22.842131598699027 25.531648736552416 27.32049036777583 16-17 25.03127345509132 25.03127345509132 23.217413059794847 26.720040030022517 18-19 24.756067050287715 24.405804353264948 24.55591693770328 26.28221165874406 20-21 25.40655491618714 23.705278959219413 25.181386039529645 25.706780085063798 22-23 25.31898924193145 24.856142106579934 23.079809857393045 26.745058794095574 24-25 24.468351263447584 24.043032274205654 24.280710532899676 27.207905929447087 26-27 24.355766825118838 23.95546659994996 23.742807105328996 27.9459594696022 28-29 26.65749311983988 24.74355766825119 22.742056542406804 25.856892669502123 30-31 24.06805103827871 25.456592444333246 24.180635476607456 26.294721040780583 32-33 24.618463847885916 24.00550412809607 24.130597948461347 27.24543407555667 34-35 25.856892669502123 24.230673004753562 23.58018513885414 26.332249186890166 36-37 25.64423317488116 24.768576432324245 23.755316487365523 25.83187390542907 38-39 25.40655491618714 24.993745308981737 24.11808856642482 25.481611208406306 40-41 26.55741806354766 23.667750813109834 23.01726294721041 26.7575681761321 42-43 24.759043685066967 23.77018400300413 23.995493803980473 27.47527850794843 44-45 24.818341267852666 23.841142570784264 24.53019293410173 26.81032322726134 46-47 25.940320962888663 23.98445336008024 22.63039117352056 27.444834503510528 48-49 24.73307373445547 23.238286647406103 24.896369802788595 27.13226981534983 50-51 25.695230904743926 23.73222599723166 23.958726563483076 26.613816534541336 52-53 25.097693180385733 24.101853019034415 22.6522122778268 28.14824152275306 54-55 25.53325760444276 24.08178720181749 23.160419033194497 27.22453616054525 56-57 25.13274336283186 23.38811630847029 23.742098609355246 27.737041719342603 58-59 25.589652548820695 24.90489475019021 22.432158255135683 27.073294445853413 60-61 25.70556826849733 23.099415204678362 24.37070938215103 26.824307144673277 62-63 25.369520897043834 23.76401630988787 24.31192660550459 26.55453618756371 64-65 26.338028169014084 23.86683738796415 23.367477592829704 26.42765685019206 66-67 26.421404682274247 23.642912271674813 23.462824800617444 26.472858245433496 68-69 24.473446181677218 24.744799069647243 24.150407029331955 26.631347719343584 70-71 26.67186079729905 24.17867809375406 22.59446825087651 26.55499285807038 72-73 25.727773406766325 23.760818253343825 23.367427222659323 27.143981117230524 74-75 26.146532438478747 20.74944071588367 24.930089485458613 28.173937360178968 76 28.924026224450444 0.0 32.009255688391825 39.06671808715773 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 3.5 20 4.5 21 6.5 22 5.0 23 3.5 24 4.5 25 5.5 26 9.0 27 11.5 28 11.0 29 11.0 30 12.5 31 22.0 32 30.5 33 36.0 34 47.5 35 56.0 36 74.0 37 95.5 38 113.5 39 132.0 40 143.5 41 161.0 42 177.0 43 195.0 44 202.0 45 208.5 46 220.5 47 195.5 48 177.0 49 168.5 50 155.0 51 150.0 52 133.0 53 126.5 54 128.5 55 118.5 56 111.5 57 107.0 58 102.0 59 109.5 60 118.5 61 115.5 62 110.5 63 110.5 64 112.0 65 108.0 66 98.0 67 91.0 68 87.5 69 85.5 70 81.5 71 75.5 72 61.0 73 58.5 74 61.5 75 54.5 76 46.0 77 33.5 78 23.0 79 15.0 80 8.5 81 4.5 82 7.0 83 9.5 84 6.5 85 3.0 86 2.5 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 3.0 43 1.0 44 2.0 45 1.0 46 2.0 47 5.0 48 3.0 49 3.0 50 5.0 51 4.0 52 1.0 53 2.0 54 5.0 55 3.0 56 2.0 57 8.0 58 6.0 59 5.0 60 4.0 61 5.0 62 4.0 63 12.0 64 10.0 65 7.0 66 12.0 67 8.0 68 7.0 69 9.0 70 13.0 71 20.0 72 22.0 73 66.0 74 320.0 75 823.0 76 2593.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8253319713994 96.75 2 0.9703779366700716 1.9 3 0.15321756894790603 0.44999999999999996 4 0.0 0.0 5 0.02553626149131767 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02553626149131767 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 31 0.775 TruSeq Adapter, Index 19 (97% over 38bp) GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389819 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389819_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68875 32.0 32.0 32.0 32.0 32.0 2 30.21625 32.0 32.0 32.0 21.0 32.0 3 30.026 32.0 32.0 32.0 21.0 32.0 4 30.019 32.0 32.0 32.0 21.0 32.0 5 29.981 32.0 32.0 32.0 21.0 32.0 6 33.116 36.0 36.0 36.0 21.0 36.0 7 33.30825 36.0 36.0 36.0 21.0 36.0 8 33.18375 36.0 36.0 36.0 21.0 36.0 9 33.2695 36.0 36.0 36.0 21.0 36.0 10-11 33.248000000000005 36.0 36.0 36.0 21.0 36.0 12-13 33.187749999999994 36.0 36.0 36.0 21.0 36.0 14-15 33.070625 36.0 36.0 36.0 21.0 36.0 16-17 33.088750000000005 36.0 36.0 36.0 17.5 36.0 18-19 33.137125 36.0 36.0 36.0 21.0 36.0 20-21 32.754375 36.0 36.0 36.0 14.0 36.0 22-23 32.952375 36.0 36.0 36.0 17.5 36.0 24-25 32.965875 36.0 36.0 36.0 17.5 36.0 26-27 32.857375000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.7665 36.0 36.0 36.0 14.0 36.0 30-31 32.76575 36.0 36.0 36.0 14.0 36.0 32-33 32.717875 36.0 36.0 36.0 14.0 36.0 34-35 32.64625 36.0 36.0 36.0 14.0 36.0 36-37 32.777308065405144 36.0 36.0 36.0 14.0 36.0 38-39 32.64221218961625 36.0 36.0 36.0 14.0 36.0 40-41 32.681088537747684 36.0 36.0 36.0 14.0 36.0 42-43 32.5268199242163 36.0 36.0 36.0 14.0 36.0 44-45 32.589073191169305 36.0 36.0 36.0 14.0 36.0 46-47 32.499241173536944 36.0 36.0 36.0 14.0 36.0 48-49 32.48671958433144 36.0 36.0 36.0 14.0 36.0 50-51 32.60156858416459 36.0 36.0 36.0 14.0 36.0 52-53 32.38835559233448 36.0 32.0 36.0 14.0 36.0 54-55 32.427824802908816 36.0 34.0 36.0 14.0 36.0 56-57 32.55686185430183 36.0 34.0 36.0 14.0 36.0 58-59 32.348161932580034 36.0 32.0 36.0 14.0 36.0 60-61 32.33041721029798 36.0 32.0 36.0 14.0 36.0 62-63 31.993561416292536 36.0 32.0 36.0 14.0 36.0 64-65 32.02374299650649 36.0 32.0 36.0 14.0 36.0 66-67 31.842803797291413 36.0 32.0 36.0 14.0 36.0 68-69 31.96077874074507 36.0 32.0 36.0 14.0 36.0 70-71 32.09832095820842 36.0 32.0 36.0 14.0 36.0 72-73 31.749307821275426 36.0 32.0 36.0 14.0 36.0 74-75 31.82401275145243 36.0 32.0 36.0 14.0 36.0 76 31.561457929430013 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 14.0 16 23.0 17 23.0 18 16.0 19 10.0 20 12.0 21 13.0 22 12.0 23 26.0 24 23.0 25 40.0 26 68.0 27 92.0 28 109.0 29 153.0 30 206.0 31 296.0 32 429.0 33 610.0 34 996.0 35 809.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.584754262788366 16.424272818455364 11.334002006018054 35.65697091273822 2 30.165496489468406 22.542627883650955 26.78034102306921 20.511534603811434 3 27.06766917293233 25.88972431077694 20.025062656641605 27.017543859649123 4 30.67669172932331 30.30075187969925 16.56641604010025 22.45614035087719 5 30.902255639097742 31.278195488721806 18.195488721804512 19.62406015037594 6 24.160401002506266 32.83208020050125 20.726817042606516 22.280701754385966 7 24.448345035105316 16.52457372116349 31.318956870611835 27.708124373119357 8 23.583959899749374 22.205513784461154 24.561403508771928 29.64912280701754 9 24.417147154675355 22.386563048383053 25.31962897969416 27.87666081724743 10-11 28.662980648404123 26.72782106056798 19.200804222166372 25.408394068861522 12-13 28.33228445563247 20.15103838892385 22.819383259911895 28.697293895531782 14-15 27.310501133215816 23.59607151850919 23.8730798287585 25.220347519516494 16-17 28.24446680080483 22.22082494969819 22.849597585513077 26.685110663983902 18-19 28.231891348088535 22.849597585513077 23.12625754527163 25.792253521126764 20-21 27.174323473882943 23.58716173694147 22.75645059786029 26.482064191315292 22-23 27.77847702957835 24.25424795468848 22.693517935808686 25.27375707992448 24-25 27.000879507475812 23.897474557105163 21.975122502826988 27.126523432592037 26-27 26.20724346076459 25.15090543259557 22.409456740442657 26.23239436619718 28-29 27.899371069182386 23.559748427672954 22.427672955974842 26.113207547169807 30-31 27.5940133316564 22.18588856747579 23.254936485976607 26.96516161489121 32-33 26.37998239657991 25.273481705016977 23.02275870740601 25.32377719099711 34-35 27.385892116182575 24.443606186344777 22.771281277505345 25.399220419967307 36-37 27.522935779816514 23.312806334045494 22.872942063591807 26.291315822546185 38-39 26.927430511885298 23.858634134071185 24.097597786441955 25.11633756760156 40-41 29.160382101558575 23.01407742584213 21.832579185520363 25.992961287078938 42-43 27.965781859353378 23.235627122908543 23.084664737702855 25.713926280035228 44-45 27.557568893922234 23.618975714105954 23.304391594312317 25.51906379765949 46-47 27.443324937027707 23.866498740554157 22.6448362720403 26.045340050377835 48-49 26.82311380267474 23.971738581882413 23.64370426444613 25.561443350996722 50-51 27.105995446496333 23.425246648115355 23.24816594991146 26.220591955476852 52-53 28.018223234624145 23.146038977474056 23.19665907365224 25.639078714249557 54-55 27.727791154479785 23.267013052845012 22.95019642630845 26.05499936636675 56-57 28.074628759994923 23.137453991623303 23.12476202563777 25.663155222744006 58-59 29.485874268261643 22.639348434716215 22.537541359124457 25.337235937897685 60-61 27.965777039969353 23.572979185289235 22.04060784063338 26.420635934108034 62-63 28.06344333589153 23.906369915579432 22.499360450243028 25.53082629828601 64-65 28.015414258188827 23.044315992292873 22.003853564547207 26.936416184971097 66-67 27.04272621659997 24.654705047115012 22.97663611720666 25.32593261907835 68-69 26.344434365686148 23.62316962550214 23.960088117143968 26.072307891667744 70-71 27.84364820846906 23.452768729641694 22.644951140065146 26.058631921824105 72-73 27.442964525913226 23.38124752736384 22.590003956217856 26.585783990505078 74-75 27.992170022371365 20.777404921700224 24.091163310961967 27.139261744966444 76 30.244280728964718 0.0 31.98914307871268 37.7665761923226 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 6.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 2.0 11 4.0 12 3.5 13 2.5 14 1.5 15 1.0 16 1.5 17 2.0 18 4.0 19 3.5 20 1.0 21 1.0 22 3.0 23 5.0 24 4.0 25 7.0 26 7.5 27 8.0 28 10.5 29 10.5 30 15.0 31 24.5 32 30.5 33 29.0 34 38.5 35 55.0 36 56.0 37 55.0 38 84.5 39 113.0 40 127.0 41 144.0 42 150.5 43 158.5 44 166.0 45 179.0 46 190.5 47 180.5 48 163.0 49 157.5 50 157.5 51 148.5 52 148.5 53 140.0 54 125.5 55 118.0 56 118.0 57 122.0 58 125.0 59 132.0 60 138.5 61 134.5 62 123.0 63 112.0 64 103.0 65 112.5 66 125.5 67 123.0 68 104.5 69 89.0 70 83.0 71 79.5 72 79.5 73 67.5 74 59.0 75 60.0 76 48.0 77 31.0 78 22.0 79 20.0 80 18.5 81 13.0 82 6.0 83 3.5 84 4.5 85 4.5 86 2.0 87 1.5 88 2.5 89 1.5 90 0.5 91 1.0 92 1.0 93 1.0 94 2.0 95 2.0 96 1.0 97 2.0 98 2.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.25 4 0.25 5 0.25 6 0.25 7 0.3 8 0.25 9 0.27499999999999997 10-11 0.525 12-13 0.6875 14-15 0.7250000000000001 16-17 0.6 18-19 0.6 20-21 0.6875 22-23 0.6875 24-25 0.5125000000000001 26-27 0.6 28-29 0.625 30-31 0.6125 32-33 0.5875 34-35 0.5875 36-37 0.22570532915360503 38-39 0.28843742162026587 40-41 0.2257336343115124 42-43 0.25097251850922325 44-45 0.18839487565938207 46-47 0.17601206939904449 48-49 0.18889308651303363 50-51 0.2649173710104705 52-53 0.13901175281182862 54-55 0.15184107301024927 56-57 0.10143273741600102 58-59 0.05087763927753752 60-61 0.14027033919918389 62-63 0.11498658489842851 64-65 0.06418485237483953 66-67 0.06449948400412797 68-69 0.0 70-71 0.0 72-73 0.026367831245880026 74-75 0.02795638803466592 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 12.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 3.0 43 1.0 44 2.0 45 2.0 46 2.0 47 4.0 48 3.0 49 3.0 50 5.0 51 4.0 52 1.0 53 2.0 54 5.0 55 4.0 56 3.0 57 8.0 58 6.0 59 5.0 60 4.0 61 4.0 62 3.0 63 12.0 64 10.0 65 8.0 66 12.0 67 8.0 68 7.0 69 8.0 70 19.0 71 21.0 72 29.0 73 61.0 74 280.0 75 858.0 76 2579.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67617107942974 96.89999999999999 2 1.120162932790224 2.1999999999999997 3 0.10183299389002036 0.3 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.02545824847250509 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02545824847250509 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831466 spots for SRR11389819.sra Written 831466 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra Read 831448 spots for SRR11389819.sra Written 831448 spots for SRR11389819.sra SRR ids: ['SRR11389819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rkff7v6 SRR11389819.sra spots: 16628978 blocks: [[1, 831448], [831449, 1662896], [1662897, 2494344], [2494345, 3325792], [3325793, 4157240], [4157241, 4988688], [4988689, 5820136], [5820137, 6651584], [6651585, 7483032], [7483033, 8314480], [8314481, 9145928], [9145929, 9977376], [9977377, 10808824], [10808825, 11640272], [11640273, 12471720], [12471721, 13303168], [13303169, 14134616], [14134617, 14966064], [14966065, 15797512], [15797513, 16628978]] SRR11389819 file size 3140450 SRR11389819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389819 SRR11389819_1.fastq SRR11389819_2.fastq Input file: SRR11389819_1.fastq Paired file: SRR11389819_2.fastq trimmed: SRR11389819-trimmed-pair1.fastq, SRR11389819-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:23:00 2024 >> started Sat Dec 7 07:23:15 2024 >> done (14.829s) 16628978 read pairs processed; of these: 726 ( 0.00%) short read pairs filtered out after trimming by size control 242042 ( 1.46%) empty read pairs filtered out after trimming by size control 16386210 (98.54%) read pairs available; of these: 22315 ( 0.14%) trimmed read pairs available after processing 16363895 (99.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 2 0.00% 20 21 0.00% 21 4 0.00% 22 23 0.00% 23 9 0.00% 24 41 0.00% 25 11 0.00% 26 32 0.00% 27 17 0.00% 28 30 0.00% 29 22 0.00% 30 37 0.00% 31 19 0.00% 32 39 0.00% 33 28 0.00% 34 28 0.00% 35 2095 0.01% 36 2401 0.01% 37 2630 0.02% 38 3013 0.02% 39 3671 0.02% 40 4277 0.03% 41 5264 0.03% 42 5851 0.04% 43 6432 0.04% 44 7004 0.04% 45 7623 0.05% 46 8192 0.05% 47 9010 0.05% 48 9937 0.06% 49 10738 0.07% 50 11982 0.07% 51 13287 0.08% 52 14773 0.09% 53 16046 0.10% 54 17234 0.11% 55 18863 0.12% 56 20228 0.12% 57 21342 0.13% 58 23189 0.14% 59 24815 0.15% 60 26197 0.16% 61 28275 0.17% 62 29887 0.18% 63 32376 0.20% 64 34891 0.21% 65 36479 0.22% 66 39211 0.24% 67 41767 0.25% 68 41645 0.25% 69 43568 0.27% 70 47376 0.29% 71 53688 0.33% 72 65453 0.40% 73 178495 1.09% 74 1100737 6.72% 75 6749639 41.19% 76 7566245 46.17% 16386210 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=24.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.5 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=24 prefix-density=0.59 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=97.60 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=2.3 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCAC SRR11389819 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:23:46 Started mapping on | Dec 07 07:23:46 Finished on | Dec 07 07:25:06 Mapping speed, Million of reads per hour | 737.38 Number of input reads | 16386210 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 14296758 Uniquely mapped reads % | 87.25% Average mapped length | 148.97 Number of splices: Total | 5846980 Number of splices: Annotated (sjdb) | 5584586 Number of splices: GT/AG | 5767964 Number of splices: GC/AG | 68575 Number of splices: AT/AC | 2027 Number of splices: Non-canonical | 8414 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1205658 % of reads mapped to multiple loci | 7.36% Number of reads mapped to too many loci | 63428 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 1.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 883794 883794 883794 N_multimapping 1205658 1205658 1205658 N_noFeature 459629 13790616 708995 N_ambiguous 331190 2100 77081 UnstrandedReadsAssigned:13505939 PositiveStrandReadsAssigned:504042 NegativeStrandReadsAssigned:13510682 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389819 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389819-trimmed-pair1.fastq SRR11389819-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,386,210 reads, 14,546,799 reads pseudoaligned [quant] estimated average fragment length: 151.67 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52973 SRR11389819.ke.tsv 35125 SRR11389819.se.tsv 88098 total ==> SRR11389819.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 785.458 0 0 PNS24247 1044 893.33 12.771 1.36854 PNS24249 1928 1777.33 90.666 4.88341 PNS24246 1044 893.33 12.771 1.36854 PNS24248 1044 893.33 12.771 1.36854 PNS24244 1471 1320.33 18.0211 1.30661 PNS24243 293 152.029 0 0 KQK14069 1603 1452.33 773.101 50.9586 KQK14071 474 324.955 119.574 35.2258 ==> SRR11389819.se.tsv <== BRADI_1g14170v3 989 BRADI_1g53295v3 8 BRADI_1g59795v3 475 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 218 BRADI_1g74790v3 174 BRADI_1g09890v3 0 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR11389819 completed mapping pipeline successfully