Starting /dee2/code/volunteer_pipeline.sh SRR11389820 current disk space = 1544559149056 free memory = 1596931340 SRR11389820 SRAfilesize d6151728b64982bc7bd8c44f66b7aac5 SRR11389820.sra SRR11389820.sra file validated SRR11389820 is paired end SRR11389820 is conventional basespace SRR11389820 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.87825 32.0 32.0 32.0 32.0 32.0 2 30.91325 32.0 32.0 32.0 32.0 32.0 3 30.9175 32.0 32.0 32.0 32.0 32.0 4 31.12925 32.0 32.0 32.0 32.0 32.0 5 30.9465 32.0 32.0 32.0 32.0 32.0 6 33.84975 36.0 36.0 36.0 32.0 36.0 7 33.85375 36.0 36.0 36.0 32.0 36.0 8 33.665 36.0 36.0 36.0 32.0 36.0 9 33.86775 36.0 36.0 36.0 32.0 36.0 10-11 33.765875 36.0 36.0 36.0 32.0 36.0 12-13 33.89125 36.0 36.0 36.0 32.0 36.0 14-15 33.83625 36.0 36.0 36.0 32.0 36.0 16-17 33.86125 36.0 36.0 36.0 32.0 36.0 18-19 33.79925 36.0 36.0 36.0 32.0 36.0 20-21 33.780875 36.0 36.0 36.0 32.0 36.0 22-23 33.517250000000004 36.0 36.0 36.0 27.0 36.0 24-25 33.479 36.0 36.0 36.0 27.0 36.0 26-27 33.43275 36.0 36.0 36.0 21.0 36.0 28-29 33.562250000000006 36.0 36.0 36.0 26.5 36.0 30-31 33.385374999999996 36.0 36.0 36.0 21.0 36.0 32-33 33.29325 36.0 36.0 36.0 24.0 36.0 34-35 33.280249999999995 36.0 36.0 36.0 21.0 36.0 36-37 33.18436288766539 36.0 36.0 36.0 21.0 36.0 38-39 33.27249937327651 36.0 36.0 36.0 21.0 36.0 40-41 33.12509954167288 36.0 36.0 36.0 17.5 36.0 42-43 33.09491014181067 36.0 36.0 36.0 17.5 36.0 44-45 33.01821150464707 36.0 36.0 36.0 17.5 36.0 46-47 33.05808619688998 36.0 36.0 36.0 14.0 36.0 48-49 32.90070504226794 36.0 34.0 36.0 14.0 36.0 50-51 33.00589838354189 36.0 36.0 36.0 17.5 36.0 52-53 32.77838300913177 36.0 34.0 36.0 14.0 36.0 54-55 32.8717425962884 36.0 34.0 36.0 14.0 36.0 56-57 32.68169538506568 36.0 32.0 36.0 14.0 36.0 58-59 32.672887699142436 36.0 32.0 36.0 14.0 36.0 60-61 32.46159590553194 36.0 32.0 36.0 14.0 36.0 62-63 32.43120247449554 36.0 34.0 36.0 14.0 36.0 64-65 32.65866142080817 36.0 34.0 36.0 14.0 36.0 66-67 32.47736726238667 36.0 32.0 36.0 14.0 36.0 68-69 32.32567985425359 36.0 32.0 36.0 14.0 36.0 70-71 32.489112042142736 36.0 32.0 36.0 14.0 36.0 72-73 32.36313320817937 36.0 32.0 36.0 14.0 36.0 74-75 32.223491362086094 36.0 32.0 36.0 14.0 36.0 76 31.969142857142856 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 12.0 25 19.0 26 39.0 27 74.0 28 93.0 29 194.0 30 272.0 31 298.0 32 506.0 33 777.0 34 1064.0 35 635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.70533700826861 9.922325231771485 12.653470308193434 41.71886745176647 2 23.527937860185418 14.382360310699072 32.52317714858432 29.5665246805312 3 22.525682786269105 17.514407416687547 24.455023803558003 35.50488599348534 4 29.29090453520421 23.778501628664493 19.243297419193183 27.68729641693811 5 29.04034076672513 27.662240040090204 21.473314958656978 21.824104234527688 6 22.876472062139815 31.846654973690804 24.705587572037082 20.571285392132296 7 19.293410172889 24.630418441493358 35.50488599348534 20.571285392132296 8 20.596341768980206 25.156602355299423 29.491355549987468 24.7557003257329 9 20.42094713104485 21.799047857679778 32.29766975695315 25.482335254322226 10-11 23.690804309696816 28.67702330243047 22.813831120020044 24.818341267852666 12-13 23.816086193936357 23.1520922074668 25.35705337008269 27.674768228514157 14-15 22.60085191681283 24.968679528940115 25.98346279128038 26.447005762966675 16-17 25.156602355299423 23.966424455023805 24.743172137308946 26.13380105236783 18-19 23.79102981708845 23.72838887496868 25.35705337008269 27.123527937860185 20-21 24.09170633926334 24.492608368829867 25.093961413179656 26.321723878727138 22-23 24.40491104986219 25.732899022801302 24.780756702580806 25.0814332247557 24-25 23.66574793284891 25.14407416687547 24.04159358556753 27.148584314708092 26-27 23.34001503382611 25.206715108995237 25.169130543723377 26.284139313455274 28-29 25.407166123778502 25.895765472312704 23.82861438236031 24.868454021548484 30-31 23.427712352793787 24.680531195189175 24.880982209972437 27.0107742420446 32-33 23.164620395890754 25.231771485843147 24.906038586820344 26.69756953144575 34-35 23.415184164369833 24.680531195189175 25.444750689050366 26.45953395139063 36-37 24.251159293144504 24.22609349542549 25.567113673392655 25.955633538037347 38-39 24.931060416144398 23.990975181749814 24.367009275507645 26.710955126598147 40-41 24.586258776328986 24.37311935807422 24.611334002006018 26.429287863590773 42-43 24.557660936127494 24.871376584264024 25.636842765717155 24.934119713891327 44-45 23.938708867118812 24.74252700326551 24.905802562170308 26.412961567445365 46-47 24.93712273641851 24.32092555331992 23.616700201207244 27.125251509054326 48-49 23.939584644430457 25.122718691000628 25.185651353052236 25.752045311516675 50-51 24.086671705719326 24.59057697152935 25.686570924666164 25.636180398085163 52-53 23.424104891578416 24.94957135653051 23.940998487140696 27.685325264750375 54-55 24.813833144011106 24.422567209390383 24.64975388110564 26.113845765492872 56-57 23.912493677288822 23.621648963075366 25.682852807283762 26.783004552352047 58-59 24.55628803245436 24.125253549695742 25.621196754563897 25.697261663286003 60-61 25.022227867394893 24.247427918201446 24.450654134383335 26.279690080020323 62-63 23.809523809523807 24.789915966386555 25.40106951871658 25.999490705373056 64-65 25.921673682867713 24.110218140068888 24.64600076540375 25.32210741165965 66-67 23.701713993348683 24.9424405218726 24.405218726016884 26.950626758761832 68-69 25.057766367137358 24.91655969191271 24.698331193838253 25.32734274711168 70-71 24.516877093532592 25.534656016490597 24.078845658335478 25.869621231641332 72-73 24.59782044628957 24.351323300467048 24.364296834457708 26.686559418785677 74-75 24.637481010910093 21.834000828614833 26.142797956083413 27.385720204391657 76 28.41904761904762 0.0 34.55238095238095 37.028571428571425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 5.5 20 7.5 21 9.0 22 9.5 23 10.0 24 8.0 25 5.5 26 7.5 27 11.5 28 19.0 29 24.5 30 31.0 31 38.5 32 41.0 33 45.5 34 60.5 35 74.0 36 94.0 37 117.5 38 127.5 39 141.5 40 159.0 41 166.5 42 169.0 43 189.5 44 202.0 45 200.5 46 200.5 47 191.0 48 177.0 49 170.5 50 163.5 51 145.5 52 131.0 53 122.0 54 117.5 55 117.5 56 120.0 57 119.5 58 125.0 59 127.5 60 117.0 61 113.0 62 112.0 63 102.5 64 95.0 65 76.5 66 67.0 67 76.0 68 77.0 69 68.5 70 58.5 71 60.5 72 53.0 73 41.5 74 38.0 75 35.5 76 36.0 77 36.0 78 29.0 79 22.0 80 13.0 81 5.0 82 3.5 83 2.0 84 1.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.22499999999999998 16-17 0.22499999999999998 18-19 0.22499999999999998 20-21 0.22499999999999998 22-23 0.22499999999999998 24-25 0.22499999999999998 26-27 0.22499999999999998 28-29 0.22499999999999998 30-31 0.22499999999999998 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 10.0 36 1.0 37 0.0 38 0.0 39 0.0 40 2.0 41 1.0 42 3.0 43 2.0 44 0.0 45 4.0 46 2.0 47 2.0 48 1.0 49 2.0 50 2.0 51 1.0 52 2.0 53 2.0 54 3.0 55 4.0 56 4.0 57 7.0 58 2.0 59 5.0 60 3.0 61 6.0 62 4.0 63 2.0 64 7.0 65 5.0 66 4.0 67 8.0 68 8.0 69 6.0 70 8.0 71 11.0 72 24.0 73 80.0 74 283.0 75 854.0 76 2625.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7153134635149 96.05 2 0.8992805755395683 1.7500000000000002 3 0.20554984583761562 0.6 4 0.07708119218910585 0.3 5 0.025693730729701953 0.125 6 0.0 0.0 7 0.025693730729701953 0.17500000000000002 8 0.0 0.0 9 0.025693730729701953 0.22499999999999998 >10 0.025693730729701953 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 31 0.775 TruSeq Adapter, Index 3 (97% over 36bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 7 0.17500000000000002 No Hit CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCGTC 15 0.0021684759 69.15 50 >>END_MODULE SRR11389820 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73575 32.0 32.0 32.0 32.0 32.0 2 30.25125 32.0 32.0 32.0 21.0 32.0 3 30.0055 32.0 32.0 32.0 21.0 32.0 4 30.05325 32.0 32.0 32.0 21.0 32.0 5 30.188 32.0 32.0 32.0 21.0 32.0 6 32.9695 36.0 36.0 36.0 21.0 36.0 7 33.30375 36.0 36.0 36.0 21.0 36.0 8 33.01775 36.0 36.0 36.0 21.0 36.0 9 33.21975 36.0 36.0 36.0 21.0 36.0 10-11 33.021874999999994 36.0 36.0 36.0 17.5 36.0 12-13 33.0745 36.0 36.0 36.0 21.0 36.0 14-15 32.920500000000004 36.0 36.0 36.0 21.0 36.0 16-17 33.02225 36.0 36.0 36.0 17.5 36.0 18-19 32.9975 36.0 36.0 36.0 17.5 36.0 20-21 32.648375 36.0 36.0 36.0 14.0 36.0 22-23 32.912499999999994 36.0 36.0 36.0 17.5 36.0 24-25 32.893125 36.0 36.0 36.0 21.0 36.0 26-27 32.73375 36.0 36.0 36.0 14.0 36.0 28-29 32.59025 36.0 36.0 36.0 14.0 36.0 30-31 32.64375 36.0 36.0 36.0 14.0 36.0 32-33 32.792 36.0 36.0 36.0 14.0 36.0 34-35 32.616875 36.0 36.0 36.0 14.0 36.0 36-37 32.591582848401536 36.0 36.0 36.0 14.0 36.0 38-39 32.632555807842145 36.0 36.0 36.0 14.0 36.0 40-41 32.64053926293144 36.0 34.0 36.0 14.0 36.0 42-43 32.526976669011304 36.0 36.0 36.0 14.0 36.0 44-45 32.623458343820786 36.0 36.0 36.0 14.0 36.0 46-47 32.45476329250202 36.0 34.0 36.0 14.0 36.0 48-49 32.61748230925747 36.0 34.0 36.0 14.0 36.0 50-51 32.39608031348314 36.0 32.0 36.0 14.0 36.0 52-53 32.36215424042864 36.0 32.0 36.0 14.0 36.0 54-55 32.404935042251644 36.0 32.0 36.0 14.0 36.0 56-57 32.39488952220654 36.0 32.0 36.0 14.0 36.0 58-59 32.216042084689 36.0 32.0 36.0 14.0 36.0 60-61 32.02878364271992 36.0 32.0 36.0 14.0 36.0 62-63 31.887760183235706 36.0 32.0 36.0 14.0 36.0 64-65 31.863591435206832 36.0 32.0 36.0 14.0 36.0 66-67 31.666204381020563 36.0 32.0 36.0 14.0 36.0 68-69 31.9269594121416 36.0 32.0 36.0 14.0 36.0 70-71 31.91815619101635 36.0 32.0 36.0 14.0 36.0 72-73 31.851955122520515 36.0 32.0 36.0 14.0 36.0 74-75 31.67708299379138 36.0 32.0 36.0 14.0 36.0 76 31.52691432903715 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 8.0 16 27.0 17 17.0 18 16.0 19 5.0 20 15.0 21 9.0 22 13.0 23 15.0 24 30.0 25 49.0 26 49.0 27 108.0 28 108.0 29 161.0 30 263.0 31 303.0 32 442.0 33 667.0 34 992.0 35 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.24497991967871 17.193775100401606 12.123493975903614 34.437751004016064 2 28.973135827265878 24.077328646748683 27.11523976901833 19.83429575696711 3 28.614457831325304 25.8785140562249 20.707831325301203 24.799196787148595 4 30.24598393574297 30.97389558232932 17.06827309236948 21.711847389558233 5 29.61847389558233 30.57228915662651 20.833333333333336 18.97590361445783 6 24.52309236947791 33.93574297188755 21.20983935742972 20.33132530120482 7 23.204419889502763 16.800602712204924 34.15369161225515 25.841285786037165 8 25.464590657960823 23.0286288297338 23.832245102963334 27.674535409342038 9 24.15871421396283 22.074334505273733 26.594676042189853 27.17227523857358 10-11 27.431515456144762 26.70268911786881 20.36943955767781 25.49635586830862 12-13 26.761449421238048 22.420734776044288 23.38953195772521 27.42828384499245 14-15 26.42506606266516 24.81439536932176 23.581225619730716 25.179312948282373 16-17 28.00553319919517 24.056841046277665 22.49748490945674 25.440140845070424 18-19 26.914853477549993 23.581939378694504 23.896365237077095 25.606841906678408 20-21 26.056869652742826 24.408656265727227 24.383492702566684 25.150981378963262 22-23 27.805737292400607 25.025163563160547 23.15047810770005 24.018621036738804 24-25 26.00226215910519 24.97172301118512 23.7275355033304 25.298479326379287 26-27 26.430277882560038 25.097447504086507 24.20470262793914 24.26757198541431 28-29 26.493898603597938 24.242043024279784 23.235627122908543 26.028431249213735 30-31 26.021884039743426 25.015721292919128 24.097597786441955 24.864796880895483 32-33 26.597082494969822 23.91851106639839 24.55985915492958 24.924547283702214 34-35 26.80749402741104 25.235760090531873 23.81491261159311 24.141833270463977 36-37 27.16639416425607 24.889950949566092 22.852471387246887 25.091183498930953 38-39 26.77403120281832 24.49672873678913 23.980875691997987 24.748364368394565 40-41 27.563215498804883 23.91495785633413 23.285947917977104 25.235878726883886 42-43 25.94737504721138 25.091275336774522 23.379075915900792 25.582273700113305 44-45 27.29678638941399 25.494643982356646 23.982356647763076 23.226212980466286 46-47 26.609442060085836 25.47336531178995 23.23908104014138 24.678111587982833 48-49 26.355022109917876 25.104232469993683 23.48704990524321 25.05369551484523 50-51 25.970904490828588 24.832384566729917 24.62998102466793 24.56672991777356 52-53 27.131292689096888 25.284593979256258 22.830761447002278 24.753351884644573 54-55 27.583586626139816 24.316109422492403 22.27710233029382 25.82320162107396 56-57 27.679817328428264 23.98832931625016 24.24203983255106 24.08981352277052 58-59 27.755880483153213 24.017800381436746 23.432930705657977 24.793388429752067 60-61 26.462715105162527 25.124282982791584 23.237731038878266 25.17527087316762 62-63 26.94863276258625 25.632507027855866 23.588039867109632 23.83082034244825 64-65 26.967874056060413 24.369640343018048 23.76807884295405 24.89440675796749 66-67 26.943802925327176 25.352835514498334 23.287143956889917 24.41621760328458 68-69 26.258205689277897 24.533401982237095 24.80370704080319 24.40468528768181 70-71 26.110537190082646 24.418904958677686 24.65134297520661 24.819214876033058 72-73 25.960161437312852 25.582606431454234 23.929175888556177 24.528056242676737 74-75 26.56314986829336 22.833772355469293 25.02426174961874 25.578816026618608 76 28.072837632776938 0.0 35.09104704097117 36.83611532625189 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 9.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 4.0 19 5.0 20 4.5 21 8.5 22 11.0 23 7.5 24 7.5 25 11.5 26 13.5 27 15.0 28 17.0 29 19.0 30 17.5 31 26.0 32 35.5 33 43.0 34 53.0 35 57.0 36 73.5 37 97.5 38 126.0 39 149.0 40 151.5 41 158.0 42 154.0 43 154.5 44 170.5 45 184.5 46 192.5 47 173.0 48 159.5 49 163.5 50 155.0 51 139.0 52 127.5 53 127.5 54 131.0 55 134.0 56 128.0 57 120.5 58 127.0 59 126.0 60 120.0 61 120.5 62 117.5 63 112.0 64 104.5 65 87.0 66 81.5 67 90.0 68 90.5 69 75.0 70 63.5 71 61.5 72 56.5 73 49.5 74 47.0 75 47.0 76 40.0 77 34.0 78 22.0 79 11.5 80 12.5 81 14.0 82 8.0 83 2.0 84 1.5 85 1.5 86 2.5 87 3.0 88 2.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.42500000000000004 3 0.4 4 0.4 5 0.4 6 0.4 7 0.44999999999999996 8 0.44999999999999996 9 0.44999999999999996 10-11 0.525 12-13 0.65 14-15 0.6625 16-17 0.6 18-19 0.6125 20-21 0.65 22-23 0.65 24-25 0.5375 26-27 0.5875 28-29 0.6375 30-31 0.6125 32-33 0.6 34-35 0.5875 36-37 0.17576898932831136 38-39 0.18837121687806105 40-41 0.13819095477386936 42-43 0.15084852294154621 44-45 0.13843443241882708 46-47 0.17641129032258063 48-49 0.1765670324126624 50-51 0.2145922746781116 52-53 0.12632642748863063 54-55 0.1391172378904768 56-57 0.11403953370501775 58-59 0.08892276422764227 60-61 0.1273074474856779 62-63 0.1276161306789178 64-65 0.1022887098836466 66-67 0.08973208563004743 68-69 0.05146018268364853 70-71 0.05162622612287042 72-73 0.07805385716144139 74-75 0.06927126627874758 76 0.0758150113722517 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 17.0 36 1.0 37 0.0 38 1.0 39 0.0 40 2.0 41 0.0 42 3.0 43 3.0 44 0.0 45 4.0 46 2.0 47 2.0 48 1.0 49 2.0 50 2.0 51 1.0 52 2.0 53 2.0 54 3.0 55 4.0 56 4.0 57 7.0 58 2.0 59 6.0 60 3.0 61 6.0 62 4.0 63 2.0 64 7.0 65 5.0 66 3.0 67 8.0 68 9.0 69 5.0 70 6.0 71 11.0 72 33.0 73 87.0 74 262.0 75 840.0 76 2638.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59836901121305 96.72500000000001 2 1.1977573904179408 2.35 3 0.1783893985728848 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844702 spots for SRR11389820.sra Written 844702 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra Read 844695 spots for SRR11389820.sra Written 844695 spots for SRR11389820.sra SRR ids: ['SRR11389820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k1p2ie10 SRR11389820.sra spots: 16893907 blocks: [[1, 844695], [844696, 1689390], [1689391, 2534085], [2534086, 3378780], [3378781, 4223475], [4223476, 5068170], [5068171, 5912865], [5912866, 6757560], [6757561, 7602255], [7602256, 8446950], [8446951, 9291645], [9291646, 10136340], [10136341, 10981035], [10981036, 11825730], [11825731, 12670425], [12670426, 13515120], [13515121, 14359815], [14359816, 15204510], [15204511, 16049205], [16049206, 16893907]] SRR11389820 file size 3192793 SRR11389820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389820 SRR11389820_1.fastq SRR11389820_2.fastq Input file: SRR11389820_1.fastq Paired file: SRR11389820_2.fastq trimmed: SRR11389820-trimmed-pair1.fastq, SRR11389820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:23:20 2024 >> started Sat Dec 7 07:23:33 2024 >> done (13.635s) 16893907 read pairs processed; of these: 771 ( 0.00%) short read pairs filtered out after trimming by size control 190152 ( 1.13%) empty read pairs filtered out after trimming by size control 16702984 (98.87%) read pairs available; of these: 26440 ( 0.16%) trimmed read pairs available after processing 16676544 (99.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 59 0.00% 19 5 0.00% 20 131 0.00% 21 6 0.00% 22 163 0.00% 23 17 0.00% 24 185 0.00% 25 23 0.00% 26 169 0.00% 27 28 0.00% 28 141 0.00% 29 20 0.00% 30 86 0.00% 31 20 0.00% 32 72 0.00% 33 36 0.00% 34 68 0.00% 35 1775 0.01% 36 2155 0.01% 37 2346 0.01% 38 2690 0.02% 39 3194 0.02% 40 3894 0.02% 41 4544 0.03% 42 5158 0.03% 43 5656 0.03% 44 6206 0.04% 45 6631 0.04% 46 7181 0.04% 47 7717 0.05% 48 8754 0.05% 49 9086 0.05% 50 10104 0.06% 51 11249 0.07% 52 12379 0.07% 53 13806 0.08% 54 14441 0.09% 55 15923 0.10% 56 17004 0.10% 57 18225 0.11% 58 19656 0.12% 59 20770 0.12% 60 22385 0.13% 61 23417 0.14% 62 25377 0.15% 63 27626 0.17% 64 29705 0.18% 65 31469 0.19% 66 33632 0.20% 67 35881 0.21% 68 35917 0.22% 69 37720 0.23% 70 40834 0.24% 71 47096 0.28% 72 58522 0.35% 73 180787 1.08% 74 1171569 7.01% 75 7137156 42.73% 76 7532118 45.09% 16702984 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.63 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=20.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.1 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=106.15 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=17.5 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGCCGGCTGGTGGTGCGCGCATCGGCCGTAGGAGGGTTCCGGAAGGCGGCGGGGG SRR11389820 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:24:08 Started mapping on | Dec 07 07:24:08 Finished on | Dec 07 07:25:34 Mapping speed, Million of reads per hour | 699.19 Number of input reads | 16702984 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 14538742 Uniquely mapped reads % | 87.04% Average mapped length | 149.10 Number of splices: Total | 6027475 Number of splices: Annotated (sjdb) | 5727791 Number of splices: GT/AG | 5940595 Number of splices: GC/AG | 75902 Number of splices: AT/AC | 2430 Number of splices: Non-canonical | 8548 Mismatch rate per base, % | 0.94% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1287344 % of reads mapped to multiple loci | 7.71% Number of reads mapped to too many loci | 45343 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 876898 876898 876898 N_multimapping 1287344 1287344 1287344 N_noFeature 513102 13968767 814786 N_ambiguous 354518 2826 91395 UnstrandedReadsAssigned:13671122 PositiveStrandReadsAssigned:567149 NegativeStrandReadsAssigned:13632561 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389820-trimmed-pair1.fastq SRR11389820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,702,984 reads, 14,781,283 reads pseudoaligned [quant] estimated average fragment length: 157.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR11389820.ke.tsv 35125 SRR11389820.se.tsv 88098 total ==> SRR11389820.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.873 0 0 PNS24247 1044 887.808 10.409 1.12222 PNS24249 1928 1771.81 99.1986 5.35892 PNS24246 1044 887.808 10.409 1.12222 PNS24248 1044 887.808 10.409 1.12222 PNS24244 1471 1314.81 59.5744 4.33696 PNS24243 293 147.529 0 0 KQK14069 1603 1446.81 152.013 10.0568 KQK14071 474 319.305 10.8014 3.23791 ==> SRR11389820.se.tsv <== BRADI_1g14170v3 180 BRADI_1g53295v3 8 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 236 BRADI_1g74790v3 281 BRADI_1g09890v3 0 BRADI_1g77505v3 244 BRADI_1g48960v3 0 SRR11389820 completed mapping pipeline successfully