Starting /dee2/code/volunteer_pipeline.sh SRR11389821 current disk space = 1544539516928 free memory = 1604349732 SRR11389821 SRAfilesize 73b47cc2444a149384a4f3c53948d198 SRR11389821.sra SRR11389821.sra file validated SRR11389821 is paired end SRR11389821 is conventional basespace SRR11389821 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89125 32.0 32.0 32.0 32.0 32.0 2 30.82925 32.0 32.0 32.0 32.0 32.0 3 31.0915 32.0 32.0 32.0 32.0 32.0 4 31.08875 32.0 32.0 32.0 32.0 32.0 5 31.146 32.0 32.0 32.0 32.0 32.0 6 33.9625 36.0 36.0 36.0 32.0 36.0 7 33.8925 36.0 36.0 36.0 32.0 36.0 8 33.90475 36.0 36.0 36.0 32.0 36.0 9 33.92675 36.0 36.0 36.0 32.0 36.0 10-11 33.976124999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.012375 36.0 36.0 36.0 32.0 36.0 14-15 34.05175 36.0 36.0 36.0 32.0 36.0 16-17 33.983625 36.0 36.0 36.0 32.0 36.0 18-19 34.023875 36.0 36.0 36.0 32.0 36.0 20-21 33.949 36.0 36.0 36.0 32.0 36.0 22-23 33.7825 36.0 36.0 36.0 29.5 36.0 24-25 33.806125 36.0 36.0 36.0 32.0 36.0 26-27 33.526250000000005 36.0 36.0 36.0 21.0 36.0 28-29 33.62575 36.0 36.0 36.0 32.0 36.0 30-31 33.6045 36.0 36.0 36.0 29.5 36.0 32-33 33.378625 36.0 36.0 36.0 24.0 36.0 34-35 33.369749999999996 36.0 36.0 36.0 21.0 36.0 36-37 33.43862557801857 36.0 36.0 36.0 24.0 36.0 38-39 33.27236377093801 36.0 36.0 36.0 21.0 36.0 40-41 33.242739108662995 36.0 36.0 36.0 17.5 36.0 42-43 33.09551827741612 36.0 36.0 36.0 17.5 36.0 44-45 33.144951140065146 36.0 36.0 36.0 21.0 36.0 46-47 33.134128790231316 36.0 36.0 36.0 17.5 36.0 48-49 33.053818286249175 36.0 36.0 36.0 17.5 36.0 50-51 32.99461009768664 36.0 36.0 36.0 17.5 36.0 52-53 32.9435782199014 36.0 36.0 36.0 14.0 36.0 54-55 32.91696692356345 36.0 36.0 36.0 14.0 36.0 56-57 32.89120480117367 36.0 34.0 36.0 14.0 36.0 58-59 32.635761672874054 36.0 32.0 36.0 14.0 36.0 60-61 32.50741436578823 36.0 34.0 36.0 14.0 36.0 62-63 32.42369634954905 36.0 32.0 36.0 14.0 36.0 64-65 32.787264396349734 36.0 36.0 36.0 14.0 36.0 66-67 32.7163245983348 36.0 34.0 36.0 14.0 36.0 68-69 32.392537200317335 36.0 32.0 36.0 14.0 36.0 70-71 32.37769777061962 36.0 32.0 36.0 14.0 36.0 72-73 32.25736509453723 36.0 32.0 36.0 14.0 36.0 74-75 32.214428612376715 36.0 32.0 36.0 14.0 36.0 76 32.35470868449982 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 8.0 25 11.0 26 33.0 27 62.0 28 105.0 29 167.0 30 235.0 31 370.0 32 516.0 33 768.0 34 1040.0 35 679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.011011011011014 10.91091091091091 11.236236236236236 41.84184184184184 2 24.04904904904905 13.238238238238237 34.55955955955956 28.153153153153156 3 23.973973973973976 16.566566566566568 24.024024024024023 35.43543543543544 4 26.926926926926924 23.3983983983984 19.51951951951952 30.155155155155157 5 29.27927927927928 27.602602602602605 21.92192192192192 21.196196196196198 6 24.374374374374376 30.58058058058058 23.773773773773772 21.27127127127127 7 19.26926926926927 24.524524524524523 34.209209209209206 21.996996996996998 8 21.62162162162162 22.972972972972975 29.504504504504503 25.900900900900904 9 21.946946946946948 20.295295295295297 32.25725725725725 25.5005005005005 10-11 24.436936936936938 27.239739739739736 23.06056056056056 25.262762762762765 12-13 24.436936936936938 21.646646646646648 25.713213213213216 28.203203203203202 14-15 24.524524524524523 24.974974974974977 24.41191191191191 26.08858858858859 16-17 25.575575575575577 23.44844844844845 24.16166166166166 26.814314314314313 18-19 24.386886886886888 24.637137137137138 24.674674674674673 26.3013013013013 20-21 24.5995995995996 23.923923923923923 24.71221221221221 26.764264264264266 22-23 24.71221221221221 24.44944944944945 24.88738738738739 25.95095095095095 24-25 25.075075075075077 23.035535535535537 24.41191191191191 27.47747747747748 26-27 24.8998998998999 24.637137137137138 23.86136136136136 26.601601601601605 28-29 25.25025025025025 23.686186186186188 24.86236236236236 26.2012012012012 30-31 24.436936936936938 23.823823823823822 24.14914914914915 27.59009009009009 32-33 24.66216216216216 24.56206206206206 24.386886886886888 26.38888888888889 34-35 24.61211211211211 23.285785785785787 24.78728728728729 27.314814814814813 36-37 24.389938681016144 23.97697409585784 24.077086722562882 27.556000500563133 38-39 24.058079859807236 23.87032169232695 25.084491175366132 26.98710727249969 40-41 25.7135703555333 23.923385077616423 23.510265398097147 26.852779168753127 42-43 25.037556334501755 23.885828743114672 24.57436154231347 26.50225338007011 44-45 25.018792282635932 23.202204961162614 25.00626409421198 26.772738661989475 46-47 25.322803058794037 23.86862228908111 24.081734988090762 26.726839664034095 48-49 24.63313683682428 23.403988461056063 24.520255863539443 27.442618838580206 50-51 24.79598242310107 23.32705586942875 24.105461393596986 27.771500313873194 52-53 25.37707390648567 23.215183509301156 23.78079436902966 27.62694821518351 54-55 25.43098024411728 23.25405813514534 24.23556058890147 27.079401031835914 56-57 25.368248772504092 24.27294473120987 23.907843384111796 26.450963112174243 58-59 25.248834572256516 23.44714627693083 24.2786947209273 27.025324429885345 60-61 24.908563501072013 23.622146550636902 23.95005675368899 27.519233194602094 62-63 25.082091437231625 23.553927759535238 24.81687294771407 26.54710785551907 64-65 26.153457211477686 23.625331816458093 24.04247250663633 26.178738465427887 66-67 25.67447751741609 23.153894870170994 24.825839138695375 26.34578847371754 68-69 26.031746031746035 23.65714285714286 24.24126984126984 26.06984126984127 70-71 26.43839103869654 22.69602851323829 23.918024439918533 26.947556008146638 72-73 24.731320368474925 24.513817809621287 23.23439099283521 27.52047082906858 74-75 26.656728554004605 19.948502507114785 24.569724894972218 28.825044043908388 76 28.545254672041043 0.0 34.224990839135216 37.229754488823744 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.5 19 5.5 20 6.5 21 7.5 22 7.5 23 6.5 24 6.0 25 6.0 26 5.0 27 8.0 28 14.0 29 15.0 30 14.0 31 15.5 32 23.0 33 30.5 34 45.5 35 62.5 36 68.0 37 75.5 38 98.0 39 129.5 40 148.5 41 163.0 42 173.5 43 174.5 44 182.0 45 189.0 46 189.0 47 189.0 48 182.5 49 162.0 50 147.0 51 140.5 52 140.0 53 142.0 54 141.0 55 137.5 56 135.0 57 134.5 58 134.0 59 136.0 60 130.5 61 119.5 62 114.5 63 106.5 64 103.0 65 108.5 66 99.5 67 88.0 68 87.5 69 87.0 70 78.0 71 69.5 72 67.0 73 57.5 74 43.5 75 34.5 76 26.5 77 18.5 78 14.0 79 13.0 80 9.0 81 4.5 82 3.5 83 3.5 84 2.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 1.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 3.0 44 0.0 45 2.0 46 1.0 47 1.0 48 1.0 49 3.0 50 1.0 51 3.0 52 2.0 53 3.0 54 1.0 55 0.0 56 3.0 57 1.0 58 1.0 59 2.0 60 3.0 61 3.0 62 2.0 63 2.0 64 1.0 65 6.0 66 3.0 67 6.0 68 5.0 69 4.0 70 6.0 71 6.0 72 22.0 73 65.0 74 285.0 75 818.0 76 2729.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67279224093926 96.65 2 0.9954058192955589 1.95 3 0.20418580908626852 0.6 4 0.10209290454313426 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 16 0.4 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCGG 15 0.002114893 69.5875 23 >>END_MODULE SRR11389821 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5895 32.0 32.0 32.0 32.0 32.0 2 30.14475 32.0 32.0 32.0 21.0 32.0 3 29.9915 32.0 32.0 32.0 21.0 32.0 4 30.065 32.0 32.0 32.0 21.0 32.0 5 30.1765 32.0 32.0 32.0 21.0 32.0 6 33.235 36.0 36.0 36.0 21.0 36.0 7 33.26425 36.0 36.0 36.0 21.0 36.0 8 33.32125 36.0 36.0 36.0 21.0 36.0 9 33.21625 36.0 36.0 36.0 21.0 36.0 10-11 33.139125 36.0 36.0 36.0 21.0 36.0 12-13 33.239375 36.0 36.0 36.0 21.0 36.0 14-15 32.933125000000004 36.0 36.0 36.0 21.0 36.0 16-17 33.090374999999995 36.0 36.0 36.0 17.5 36.0 18-19 33.222125 36.0 36.0 36.0 21.0 36.0 20-21 32.7225 36.0 36.0 36.0 14.0 36.0 22-23 33.034875 36.0 36.0 36.0 17.5 36.0 24-25 32.8765 36.0 36.0 36.0 17.5 36.0 26-27 32.887625 36.0 36.0 36.0 14.0 36.0 28-29 32.755250000000004 36.0 36.0 36.0 14.0 36.0 30-31 32.794 36.0 36.0 36.0 14.0 36.0 32-33 32.79775 36.0 36.0 36.0 14.0 36.0 34-35 32.7225 36.0 36.0 36.0 14.0 36.0 36-37 32.74062485777714 36.0 36.0 36.0 14.0 36.0 38-39 32.62420381284309 36.0 36.0 36.0 14.0 36.0 40-41 32.78864271124003 36.0 36.0 36.0 14.0 36.0 42-43 32.583020916791384 36.0 36.0 36.0 14.0 36.0 44-45 32.7249434815373 36.0 36.0 36.0 14.0 36.0 46-47 32.56303325616854 36.0 36.0 36.0 14.0 36.0 48-49 32.36716154356362 36.0 34.0 36.0 14.0 36.0 50-51 32.69571418210019 36.0 34.0 36.0 14.0 36.0 52-53 32.371784792713875 36.0 32.0 36.0 14.0 36.0 54-55 32.36453910560621 36.0 32.0 36.0 14.0 36.0 56-57 32.43813885996278 36.0 32.0 36.0 14.0 36.0 58-59 32.26113786517789 36.0 32.0 36.0 14.0 36.0 60-61 32.04450407930062 36.0 32.0 36.0 14.0 36.0 62-63 31.906909338042816 36.0 32.0 36.0 14.0 36.0 64-65 31.88062234399463 36.0 32.0 36.0 14.0 36.0 66-67 31.701762096485357 36.0 32.0 36.0 14.0 36.0 68-69 31.84120887796606 36.0 32.0 36.0 14.0 36.0 70-71 31.891971536230535 36.0 32.0 36.0 14.0 36.0 72-73 31.69394703982094 36.0 32.0 36.0 14.0 36.0 74-75 31.566984631880878 36.0 32.0 36.0 14.0 36.0 76 31.24378296910324 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 8.0 16 10.0 17 7.0 18 7.0 19 6.0 20 6.0 21 11.0 22 11.0 23 26.0 24 29.0 25 36.0 26 73.0 27 110.0 28 124.0 29 175.0 30 279.0 31 332.0 32 499.0 33 683.0 34 952.0 35 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.386756960120394 17.85803862553298 10.634562327564586 37.12064208678204 2 28.549924736578024 22.10235825388861 29.07676869041646 20.27094831911691 3 26.322386563048383 25.946352469290552 19.62897969415894 28.102281273502133 4 28.879418400601654 29.330659313111056 18.250188017046877 23.539734269240412 5 30.859864627726246 30.13286537979443 19.4785660566558 19.528703935823515 6 24.417147154675355 32.389069942341436 20.75708197543244 22.436700927550763 7 22.930255895634723 16.53286502759659 33.54239839438033 26.99448068238836 8 24.974924774322968 20.737211634904714 24.623871614844532 29.663991975927782 9 24.454477050413846 21.595184349134687 26.31050915475295 27.63982944569852 10-11 27.94929718875502 26.229919678714857 19.139056224899598 26.68172690763052 12-13 27.846192510681078 19.52751947725559 23.033425483789895 29.592862528273432 14-15 25.339366515837103 24.20814479638009 24.233283056812468 26.21920563097034 16-17 27.22821993472257 23.085613858900324 22.24453929199096 27.44162691438614 18-19 26.952046196334422 23.085613858900324 23.110720562390156 26.85161938237509 20-21 26.664991203820055 22.832369942196532 23.573762251822068 26.928876602161345 22-23 27.69192109561503 24.11106922980274 22.892323156175397 25.304686518406832 24-25 26.925972396486824 24.00250941028858 23.03638644918444 26.03513174404015 26-27 27.127793120763243 24.328395681647 22.721566658297764 25.82224453929199 28-29 26.651595076613916 24.49133383571967 22.55714644561668 26.29992464204974 30-31 25.765946760421897 23.593671521848318 23.254645906579608 27.385735811150173 32-33 26.387145367813208 24.22796886768767 23.826261611850363 25.558624152648758 34-35 27.943760984182774 23.738388149635952 21.91815214662315 26.399698719558124 36-37 27.28413654618474 23.01706827309237 22.853915662650603 26.84487951807229 38-39 26.824061283435892 23.910586462388547 22.78035916112018 26.48499309305538 40-41 27.419962335216574 23.86691776522285 22.033898305084744 26.679221594475834 42-43 27.464523420821298 24.19942232826824 22.56687178199171 25.76918246891875 44-45 26.928876602161345 23.711987936667505 22.744408142749435 26.614727318421714 46-47 26.839391271538172 23.74544082505345 23.292667588982518 26.122500314425857 48-49 25.82431412031211 23.59677825320916 23.131135162345835 27.447772464132896 50-51 26.219589058363795 23.98840287407034 23.484180007563342 26.30782806000252 52-53 27.843631778058008 23.78310214375788 21.97982345523329 26.39344262295082 54-55 27.370281530109835 23.532382274965283 22.5097841181669 26.587552076757987 56-57 26.682661952266702 23.790882687207983 22.805909837100643 26.720545523424676 58-59 29.360465116279073 23.066228513650152 22.04246713852376 25.530839231547013 60-61 26.92989116679322 23.943305492280437 22.943558592761327 26.18324474816502 62-63 28.699949315762797 23.378104409528635 22.351748606183477 25.57019766852509 64-65 28.468171443063657 23.433933553132132 22.19122495561755 25.90667004818666 66-67 26.769152585440224 23.758099352051836 23.440477702960234 26.032270359547706 68-69 26.158940397350992 24.707080998471728 23.06418746816098 26.069791136016303 70-71 26.902451481103167 23.518896833503575 23.212461695607765 26.366189989785493 72-73 26.874115983026876 23.38948180532339 22.913719943422915 26.82268226822682 74-75 27.54990429313645 21.39732020782062 24.665025977577248 26.387749521465683 76 28.232189973614773 0.0 32.22766679231059 39.540143234074634 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 6.0 2 1.0 3 1.5 4 1.5 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 1.5 21 2.0 22 3.5 23 4.5 24 5.5 25 7.0 26 5.0 27 4.5 28 10.5 29 15.0 30 16.5 31 17.5 32 16.5 33 19.5 34 36.0 35 53.0 36 62.0 37 76.0 38 102.5 39 127.0 40 135.5 41 139.0 42 140.5 43 152.0 44 164.5 45 154.0 46 151.5 47 167.0 48 162.5 49 156.0 50 160.0 51 146.0 52 133.5 53 138.5 54 144.0 55 139.5 56 127.5 57 116.0 58 111.5 59 144.0 60 170.0 61 144.0 62 126.5 63 120.0 64 120.5 65 114.5 66 99.0 67 95.5 68 90.5 69 95.0 70 93.5 71 84.0 72 80.5 73 72.5 74 53.0 75 37.5 76 35.0 77 36.0 78 27.5 79 16.5 80 12.0 81 7.0 82 5.0 83 3.0 84 1.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.35000000000000003 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.35000000000000003 8 0.3 9 0.325 10-11 0.4 12-13 0.525 14-15 0.5499999999999999 16-17 0.42500000000000004 18-19 0.42500000000000004 20-21 0.525 22-23 0.5125000000000001 24-25 0.375 26-27 0.42500000000000004 28-29 0.475 30-31 0.44999999999999996 32-33 0.42500000000000004 34-35 0.42500000000000004 36-37 0.11282437006393381 38-39 0.15047021943573666 40-41 0.10033864291985452 42-43 0.07529175555276697 44-45 0.050238633509168545 46-47 0.07540530350634661 48-49 0.08801710046523324 50-51 0.1258970162407151 52-53 0.050415931434333254 54-55 0.05047318611987382 56-57 0.02524933720489837 58-59 0.025271670457417232 60-61 0.05059448520111307 62-63 0.050658561296859174 64-65 0.03802763341361389 66-67 0.025403277022735933 68-69 0.025464731347084286 70-71 0.025529742149604292 72-73 0.025710245532844837 74-75 0.027337342810278838 76 0.037678975131876416 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 1.0 37 0.0 38 1.0 39 0.0 40 1.0 41 1.0 42 1.0 43 3.0 44 0.0 45 2.0 46 1.0 47 1.0 48 1.0 49 4.0 50 1.0 51 3.0 52 2.0 53 3.0 54 1.0 55 0.0 56 3.0 57 1.0 58 2.0 59 2.0 60 2.0 61 3.0 62 2.0 63 2.0 64 1.0 65 6.0 66 3.0 67 6.0 68 4.0 69 4.0 70 8.0 71 8.0 72 31.0 73 80.0 74 272.0 75 868.0 76 2654.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67819013726486 97.05 2 1.1692933401118455 2.3 3 0.12709710218607015 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563993 spots for SRR11389821.sra Written 563993 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra Read 563991 spots for SRR11389821.sra Written 563991 spots for SRR11389821.sra SRR ids: ['SRR11389821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_95233lz2 SRR11389821.sra spots: 11279822 blocks: [[1, 563991], [563992, 1127982], [1127983, 1691973], [1691974, 2255964], [2255965, 2819955], [2819956, 3383946], [3383947, 3947937], [3947938, 4511928], [4511929, 5075919], [5075920, 5639910], [5639911, 6203901], [6203902, 6767892], [6767893, 7331883], [7331884, 7895874], [7895875, 8459865], [8459866, 9023856], [9023857, 9587847], [9587848, 10151838], [10151839, 10715829], [10715830, 11279822]] SRR11389821 file size 2130020 SRR11389821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389821 SRR11389821_1.fastq SRR11389821_2.fastq Input file: SRR11389821_1.fastq Paired file: SRR11389821_2.fastq trimmed: SRR11389821-trimmed-pair1.fastq, SRR11389821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:24:30 2024 >> started Sat Dec 7 07:24:42 2024 >> done (11.484s) 11279822 read pairs processed; of these: 435 ( 0.00%) short read pairs filtered out after trimming by size control 58534 ( 0.52%) empty read pairs filtered out after trimming by size control 11220853 (99.48%) read pairs available; of these: 9800 ( 0.09%) trimmed read pairs available after processing 11211053 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 7 0.00% 34 4 0.00% 35 960 0.01% 36 1061 0.01% 37 1267 0.01% 38 1393 0.01% 39 1638 0.01% 40 2037 0.02% 41 2326 0.02% 42 2577 0.02% 43 2762 0.02% 44 3216 0.03% 45 3109 0.03% 46 3614 0.03% 47 3935 0.04% 48 4237 0.04% 49 4598 0.04% 50 5041 0.04% 51 5393 0.05% 52 5928 0.05% 53 6424 0.06% 54 7030 0.06% 55 7508 0.07% 56 7978 0.07% 57 8435 0.08% 58 9096 0.08% 59 9736 0.09% 60 10155 0.09% 61 10679 0.10% 62 11442 0.10% 63 12187 0.11% 64 13030 0.12% 65 13995 0.12% 66 14910 0.13% 67 15691 0.14% 68 15613 0.14% 69 16432 0.15% 70 17498 0.16% 71 20766 0.19% 72 28518 0.25% 73 109019 0.97% 74 760371 6.78% 75 4779152 42.59% 76 5260064 46.88% 11220853 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=16 prefix-density=0.60 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=22.13 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.4 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.18 sequence-density-rank=20 fanout-score=90.24 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=16.5 sequence=GCCGCCGCCACCCT SRR11389821 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:25:12 Started mapping on | Dec 07 07:25:12 Finished on | Dec 07 07:26:10 Mapping speed, Million of reads per hour | 696.47 Number of input reads | 11220853 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9758291 Uniquely mapped reads % | 86.97% Average mapped length | 149.43 Number of splices: Total | 4316488 Number of splices: Annotated (sjdb) | 4122614 Number of splices: GT/AG | 4259009 Number of splices: GC/AG | 50441 Number of splices: AT/AC | 1503 Number of splices: Non-canonical | 5535 Mismatch rate per base, % | 1.04% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 893008 % of reads mapped to multiple loci | 7.96% Number of reads mapped to too many loci | 39702 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 1.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 569554 569554 569554 N_multimapping 893008 893008 893008 N_noFeature 347107 9456464 477748 N_ambiguous 230951 1436 62733 UnstrandedReadsAssigned:9180233 PositiveStrandReadsAssigned:300391 NegativeStrandReadsAssigned:9217810 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389821-trimmed-pair1.fastq SRR11389821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,220,853 reads, 9,944,342 reads pseudoaligned [quant] estimated average fragment length: 176.802 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR11389821.ke.tsv 35125 SRR11389821.se.tsv 88098 total ==> SRR11389821.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.303 0 0 PNS24247 1044 868.198 13.8235 2.2687 PNS24249 1928 1752.2 75.2063 6.11576 PNS24246 1044 868.198 13.8235 2.2687 PNS24248 1044 868.198 13.8235 2.2687 PNS24244 1471 1295.2 10.3233 1.13569 PNS24243 293 129.995 0 0 KQK14069 1603 1427.2 352.27 35.1698 KQK14071 474 300.249 0 0 ==> SRR11389821.se.tsv <== BRADI_1g14170v3 367 BRADI_1g53295v3 8 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 159 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 138 BRADI_1g48960v3 0 SRR11389821 completed mapping pipeline successfully