Starting /dee2/code/volunteer_pipeline.sh SRR11389822 current disk space = 1544528433152 free memory = 1476894424 SRR11389822 SRAfilesize 2b9b10fd40d9e89833ae478129e688cc SRR11389822.sra SRR11389822.sra file validated SRR11389822 is paired end SRR11389822 is conventional basespace SRR11389822 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.88625 32.0 32.0 32.0 32.0 32.0 2 30.92675 32.0 32.0 32.0 32.0 32.0 3 31.0435 32.0 32.0 32.0 32.0 32.0 4 31.089 32.0 32.0 32.0 32.0 32.0 5 31.0785 32.0 32.0 32.0 32.0 32.0 6 33.98475 36.0 36.0 36.0 32.0 36.0 7 33.98375 36.0 36.0 36.0 32.0 36.0 8 33.9745 36.0 36.0 36.0 32.0 36.0 9 34.06775 36.0 36.0 36.0 32.0 36.0 10-11 33.9055 36.0 36.0 36.0 32.0 36.0 12-13 34.011250000000004 36.0 36.0 36.0 32.0 36.0 14-15 34.084375 36.0 36.0 36.0 32.0 36.0 16-17 33.99225 36.0 36.0 36.0 32.0 36.0 18-19 33.834374999999994 36.0 36.0 36.0 32.0 36.0 20-21 34.0085 36.0 36.0 36.0 32.0 36.0 22-23 33.7705 36.0 36.0 36.0 32.0 36.0 24-25 33.567375 36.0 36.0 36.0 27.0 36.0 26-27 33.6175 36.0 36.0 36.0 26.5 36.0 28-29 33.681375 36.0 36.0 36.0 26.5 36.0 30-31 33.440375 36.0 36.0 36.0 26.5 36.0 32-33 33.34725 36.0 36.0 36.0 21.0 36.0 34-35 33.380250000000004 36.0 36.0 36.0 21.0 36.0 36-37 33.28476738369184 36.0 36.0 36.0 24.0 36.0 38-39 33.333791895947975 36.0 36.0 36.0 24.0 36.0 40-41 33.16444953149579 36.0 36.0 36.0 20.5 36.0 42-43 33.10032524393295 36.0 36.0 36.0 17.5 36.0 44-45 33.024901310526076 36.0 36.0 36.0 21.0 36.0 46-47 32.9613266583229 36.0 36.0 36.0 14.0 36.0 48-49 33.03917396745932 36.0 36.0 36.0 21.0 36.0 50-51 32.88740337549629 36.0 36.0 36.0 14.0 36.0 52-53 32.67243107769424 36.0 34.0 36.0 14.0 36.0 54-55 32.76190464962494 36.0 36.0 36.0 14.0 36.0 56-57 32.66998160731234 36.0 34.0 36.0 14.0 36.0 58-59 32.4545951632888 36.0 32.0 36.0 14.0 36.0 60-61 32.35639033922176 36.0 32.0 36.0 14.0 36.0 62-63 32.3712223280271 36.0 32.0 36.0 14.0 36.0 64-65 32.60011982043896 36.0 34.0 36.0 14.0 36.0 66-67 32.459221664028625 36.0 32.0 36.0 14.0 36.0 68-69 32.338972332753855 36.0 32.0 36.0 14.0 36.0 70-71 32.430721494570165 36.0 32.0 36.0 14.0 36.0 72-73 32.33953672807779 36.0 32.0 36.0 14.0 36.0 74-75 32.05687202327344 36.0 32.0 36.0 14.0 36.0 76 32.047988187523075 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 8.0 25 16.0 26 36.0 27 59.0 28 124.0 29 176.0 30 239.0 31 346.0 32 563.0 33 807.0 34 993.0 35 628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.06803401700851 9.954977488744372 14.282141070535268 39.694847423711856 2 25.53776888444222 13.856928464232116 29.214607303651825 31.390695347673837 3 23.28664332166083 19.084542271135568 22.886443221610804 34.742371185592795 4 29.739869934967484 24.212106053026513 17.70885442721361 28.339169584792394 5 28.789394697348676 27.838919459729865 20.485242621310658 22.886443221610804 6 22.486243121560783 31.41570785392696 23.986993496748372 22.11105552776388 7 18.459229614807406 24.83741870935468 32.46623311655828 24.23711855927964 8 21.46073036518259 23.461730865432717 28.989494747373683 26.088044022011005 9 21.810905452726363 19.909954977488745 32.06603301650826 26.21310655327664 10-11 25.41270635317659 26.92596298149075 22.02351175587794 25.63781890945473 12-13 25.025012506253123 22.71135567783892 24.262131065532767 28.001500750375186 14-15 24.337168584292147 24.68734367183592 24.524762381190595 26.450725362681343 16-17 25.125062531265634 23.699349674837418 24.112056028014006 27.063531765882942 18-19 23.461730865432717 25.212606303151574 24.349674837418707 26.975987993997 20-21 25.387693846923458 23.999499749874936 23.58679339669835 27.026013006503252 22-23 24.262131065532767 24.72486243121561 24.12456228114057 26.88844422211106 24-25 24.974987493746873 24.487243621810904 24.399699849924964 26.138069034517258 26-27 23.974487243621812 25.050025012506254 23.51175587793897 27.463731865932967 28-29 25.625312656328163 24.287143571785894 23.51175587793897 26.575787893946973 30-31 23.88694347173587 24.174587293646823 24.562281140570285 27.37618809404702 32-33 24.024512256128062 23.974487243621812 25.087543771885944 26.91345672836418 34-35 25.050025012506254 24.712356178089045 23.774387193596798 26.463231615807903 36-37 24.912456228114056 23.56178089044522 23.84942471235618 27.67633816908454 38-39 25.850425212606304 23.649324662331164 23.374187093546773 27.126063031515756 40-41 24.027517198248905 24.752970606629145 24.065040650406505 27.15447154471545 42-43 25.50662997247936 23.73029772329247 23.817863397548162 26.945208906680012 44-45 24.224224224224226 24.11161161161161 23.94894894894895 27.715215215215217 46-47 25.982478097622025 23.2540675844806 23.153942428035045 27.609511889862326 48-49 24.58072590738423 23.817271589486857 24.93116395494368 26.670838548185234 50-51 26.023794614902947 23.994990607388857 23.14339386349405 26.83782091421415 52-53 25.526315789473685 23.959899749373434 23.333333333333332 27.18045112781955 54-55 24.360581745235706 24.360581745235706 24.49849548645938 26.78034102306921 56-57 24.52948557089084 23.312421580928483 24.604767879548305 27.55332496863237 58-59 25.932437523546405 24.337561220645483 22.918498053497427 26.81150320231069 60-61 25.342551854179764 24.135763670647393 23.63293526084224 26.88874921433061 62-63 24.89610880241783 24.26646518070772 23.48570708978718 27.35171892708727 64-65 26.50283553875236 23.415248897290486 23.705103969754255 26.3768115942029 66-67 25.381799823299257 22.857503470907485 24.22062350119904 27.54007320459422 68-69 25.04741433809584 23.226703755215578 23.568086989505627 28.157794917182954 70-71 25.48472943860094 23.976682296286906 22.696743125079205 27.84184514003295 72-73 25.947670708359922 23.24186343331206 23.12699425654116 27.683471601786852 74-75 26.09457092819615 20.74632897750236 25.245857470025594 27.913242624275895 76 29.014396456256918 0.0 30.67552602436323 40.310077519379846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.5 22 2.5 23 4.5 24 5.5 25 3.0 26 6.5 27 10.0 28 10.5 29 12.5 30 18.0 31 23.0 32 30.0 33 40.0 34 49.5 35 60.5 36 74.0 37 90.0 38 108.5 39 131.0 40 145.0 41 153.0 42 164.0 43 179.0 44 193.5 45 205.5 46 208.5 47 190.5 48 186.0 49 183.0 50 167.0 51 154.0 52 135.5 53 122.0 54 113.5 55 120.0 56 121.0 57 119.5 58 125.5 59 113.5 60 103.5 61 106.5 62 104.5 63 99.5 64 103.0 65 107.0 66 90.0 67 78.0 68 81.5 69 88.5 70 85.0 71 70.0 72 65.0 73 56.5 74 51.5 75 54.0 76 47.5 77 38.0 78 28.5 79 21.5 80 14.5 81 9.5 82 8.0 83 3.5 84 4.0 85 4.5 86 2.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 2.0 45 0.0 46 0.0 47 0.0 48 0.0 49 2.0 50 1.0 51 2.0 52 0.0 53 1.0 54 2.0 55 1.0 56 2.0 57 2.0 58 1.0 59 3.0 60 1.0 61 5.0 62 3.0 63 0.0 64 3.0 65 3.0 66 3.0 67 2.0 68 7.0 69 3.0 70 5.0 71 12.0 72 27.0 73 58.0 74 269.0 75 868.0 76 2709.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389822 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389822_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.37375 32.0 32.0 32.0 21.0 32.0 2 30.00625 32.0 32.0 32.0 21.0 32.0 3 29.73025 32.0 32.0 32.0 14.0 32.0 4 29.74025 32.0 32.0 32.0 14.0 32.0 5 29.79625 32.0 32.0 32.0 14.0 32.0 6 32.855 36.0 36.0 36.0 21.0 36.0 7 32.86025 36.0 36.0 36.0 21.0 36.0 8 32.9795 36.0 36.0 36.0 21.0 36.0 9 32.74125 36.0 32.0 36.0 14.0 36.0 10-11 32.715 36.0 36.0 36.0 14.0 36.0 12-13 32.913375 36.0 36.0 36.0 21.0 36.0 14-15 32.717749999999995 36.0 34.0 36.0 17.5 36.0 16-17 32.8155 36.0 36.0 36.0 17.5 36.0 18-19 32.723625 36.0 36.0 36.0 17.5 36.0 20-21 32.465 36.0 34.0 36.0 14.0 36.0 22-23 32.4905 36.0 32.0 36.0 14.0 36.0 24-25 32.579375 36.0 32.0 36.0 14.0 36.0 26-27 32.321875 36.0 32.0 36.0 14.0 36.0 28-29 32.435 36.0 34.0 36.0 14.0 36.0 30-31 32.426249999999996 36.0 36.0 36.0 14.0 36.0 32-33 32.372 36.0 32.0 36.0 14.0 36.0 34-35 32.249375 36.0 32.0 36.0 14.0 36.0 36-37 32.400150338261085 36.0 32.0 36.0 14.0 36.0 38-39 32.30055124029066 36.0 34.0 36.0 14.0 36.0 40-41 32.282789126411615 36.0 32.0 36.0 14.0 36.0 42-43 32.182957393483704 36.0 32.0 36.0 14.0 36.0 44-45 32.08571661098584 36.0 32.0 36.0 14.0 36.0 46-47 32.06945837512538 36.0 32.0 36.0 14.0 36.0 48-49 32.04939819458375 36.0 32.0 36.0 14.0 36.0 50-51 32.16583415228079 36.0 32.0 36.0 14.0 36.0 52-53 31.984559377353754 36.0 32.0 36.0 14.0 36.0 54-55 32.05413500198128 36.0 32.0 36.0 14.0 36.0 56-57 32.029244462520516 36.0 32.0 36.0 14.0 36.0 58-59 31.7319723939308 36.0 32.0 36.0 14.0 36.0 60-61 31.76268746513439 36.0 32.0 36.0 14.0 36.0 62-63 31.385437951918185 36.0 32.0 36.0 14.0 36.0 64-65 31.395691717081363 36.0 32.0 36.0 14.0 36.0 66-67 31.16750186609573 36.0 32.0 36.0 14.0 36.0 68-69 31.426380657836503 36.0 32.0 36.0 14.0 36.0 70-71 31.52712503263806 36.0 32.0 36.0 14.0 36.0 72-73 31.17204176600037 36.0 32.0 36.0 14.0 36.0 74-75 31.14294176247074 36.0 32.0 36.0 14.0 36.0 76 30.634861006761835 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 7.0 16 13.0 17 22.0 18 12.0 19 12.0 20 7.0 21 12.0 22 18.0 23 32.0 24 39.0 25 58.0 26 69.0 27 110.0 28 160.0 29 233.0 30 290.0 31 390.0 32 491.0 33 659.0 34 845.0 35 509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.39734269240411 15.542742541990473 13.487089496114315 35.5728252694911 2 30.030105368790768 23.75815353738083 24.560963371801304 21.650777722027094 3 26.98571786519669 26.910548734652966 19.468804810824356 26.634928589325984 4 30.2179904785768 29.140566274116765 17.263843648208468 23.37759959909797 5 29.9173139564019 31.27035830618892 18.84239538962666 19.96993234778251 6 24.17940365823102 33.19969932347783 20.596341768980206 22.02455524931095 7 23.0383554775633 17.021809977437954 32.589621459012285 27.350213085986464 8 25.31328320802005 21.954887218045112 23.408521303258144 29.32330827067669 9 24.93734335839599 22.13032581453634 26.36591478696742 26.56641604010025 10-11 28.673520561685056 26.49197592778335 19.45837512537613 25.376128385155468 12-13 28.30259691381257 20.56203738552252 22.80767783214151 28.327687868523398 14-15 26.77876772493412 23.578868113941525 24.356882921320118 25.28548123980424 16-17 28.41735640832706 22.56082267368949 22.36017055430148 26.661650363681964 18-19 27.125658389766745 23.714572360170553 23.814898419864562 25.344870830198147 20-21 27.424413498933635 23.485133609333836 23.19658763015933 25.8938652615732 22-23 27.562413749843184 23.372224313135114 22.24313135114791 26.82223058587379 24-25 27.19408224674022 23.119358074222667 22.91875626880642 26.76780341023069 26-27 27.097178683385582 24.601880877742946 22.043887147335422 26.257053291536046 28-29 26.962628542763984 24.140958113870077 22.987208427389014 25.909204915976925 30-31 26.602282704126427 24.181612943684936 23.11551486266148 26.100589489527152 32-33 26.962628542763984 24.20366190117883 23.564083270629546 25.269626285427638 34-35 27.82445141065831 24.100313479623825 21.80564263322884 26.269592476489027 36-37 27.373040752351095 23.09717868338558 23.54858934169279 25.981191222570533 38-39 27.15987460815047 24.46394984326019 22.620689655172413 25.755485893416928 40-41 27.53605015673981 23.197492163009404 22.382445141065833 26.884012539184955 42-43 28.35465262101831 23.6017055430148 22.53574115876599 25.5079006772009 44-45 26.10713837661523 25.00313636933885 23.3596788357797 25.530046418266217 46-47 27.606977036014555 24.01807002133266 22.650269795457397 25.724683147195382 48-49 27.594428410089094 23.629062617643367 23.051825825072157 25.724683147195382 50-51 27.225919879442422 23.82267989451212 22.99384654024865 25.957553685796807 52-53 27.62562814070352 23.756281407035175 22.135678391959797 26.482412060301506 54-55 28.585795097423006 23.733500942803268 21.923318667504716 25.757385292269014 56-57 27.67295597484277 23.345911949685537 22.80503144654088 26.176100628930815 58-59 28.48507744616547 21.999748142551315 23.27162825840574 26.24354615287747 60-61 27.467540652968616 23.723685869154167 22.5513677045254 26.25740577335182 62-63 28.74100265184998 23.828766258365956 21.985099128677863 25.4451319611062 64-65 27.647207480414455 23.224665150366437 22.453879201415212 26.674248167803892 66-67 27.582278481012658 23.27848101265823 23.443037974683545 25.696202531645568 68-69 27.67494929006085 24.492900608519268 22.591277890466532 25.24087221095335 70-71 27.64361972547026 23.28418912048805 22.458057956278594 26.61413319776309 72-73 27.85458269329237 22.900665642601126 22.91346646185356 26.331285202252946 74-75 26.932498639085466 22.019597169297768 23.707131192161132 27.34077299945563 76 30.590003757985716 0.0 30.32694475760992 39.08305148440436 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 2.0 20 2.0 21 0.5 22 1.0 23 3.0 24 3.5 25 5.5 26 6.0 27 6.5 28 12.5 29 17.0 30 14.5 31 13.5 32 18.0 33 25.0 34 37.5 35 52.0 36 69.5 37 86.0 38 95.0 39 106.5 40 122.0 41 136.0 42 149.5 43 168.0 44 184.0 45 179.0 46 171.5 47 169.5 48 177.0 49 166.0 50 140.5 51 139.0 52 145.0 53 136.0 54 123.0 55 122.5 56 120.0 57 114.5 58 110.5 59 123.0 60 132.5 61 128.5 62 131.0 63 120.5 64 108.0 65 121.5 66 117.0 67 101.5 68 102.0 69 99.0 70 87.0 71 72.5 72 74.0 73 73.5 74 61.5 75 56.5 76 50.5 77 38.0 78 26.0 79 22.0 80 17.5 81 13.0 82 10.5 83 6.0 84 5.0 85 3.5 86 1.5 87 0.0 88 1.0 89 2.0 90 1.5 91 1.0 92 1.0 93 0.5 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.35000000000000003 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.27499999999999997 8 0.25 9 0.25 10-11 0.3 12-13 0.36250000000000004 14-15 0.3875 16-17 0.325 18-19 0.325 20-21 0.36250000000000004 22-23 0.36250000000000004 24-25 0.3 26-27 0.3125 28-29 0.325 30-31 0.3375 32-33 0.325 34-35 0.3125 36-37 0.08769731896767727 38-39 0.08769731896767727 40-41 0.07517854905400326 42-43 0.07518796992481204 44-45 0.08774128854349461 46-47 0.08776328986960882 48-49 0.08776328986960882 50-51 0.100363818843307 52-53 0.07532011046949535 54-55 0.08791760864104496 56-57 0.07541478129713425 58-59 0.07550018875047187 60-61 0.07557626905151782 62-63 0.07570977917981073 64-65 0.06313928526329082 66-67 0.07589172780166961 68-69 0.025348542458808618 70-71 0.025412960609911054 72-73 0.038387715930902115 74-75 0.04081077404434771 76 0.03756574004507889 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 2.0 45 0.0 46 0.0 47 0.0 48 0.0 49 2.0 50 1.0 51 2.0 52 0.0 53 1.0 54 2.0 55 1.0 56 2.0 57 3.0 58 1.0 59 3.0 60 1.0 61 5.0 62 3.0 63 0.0 64 3.0 65 4.0 66 2.0 67 4.0 68 6.0 69 5.0 70 4.0 71 13.0 72 25.0 73 71.0 74 297.0 75 865.0 76 2662.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34426229508196 98.475 2 0.605296343001261 1.2 3 0.0 0.0 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025220680958385876 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506331 spots for SRR11389822.sra Written 506331 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra Read 506326 spots for SRR11389822.sra Written 506326 spots for SRR11389822.sra SRR ids: ['SRR11389822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ubcx997q SRR11389822.sra spots: 10126525 blocks: [[1, 506326], [506327, 1012652], [1012653, 1518978], [1518979, 2025304], [2025305, 2531630], [2531631, 3037956], [3037957, 3544282], [3544283, 4050608], [4050609, 4556934], [4556935, 5063260], [5063261, 5569586], [5569587, 6075912], [6075913, 6582238], [6582239, 7088564], [7088565, 7594890], [7594891, 8101216], [8101217, 8607542], [8607543, 9113868], [9113869, 9620194], [9620195, 10126525]] SRR11389822 file size 1911079 SRR11389822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389822 SRR11389822_1.fastq SRR11389822_2.fastq Input file: SRR11389822_1.fastq Paired file: SRR11389822_2.fastq trimmed: SRR11389822-trimmed-pair1.fastq, SRR11389822-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:26:34 2024 >> started Sat Dec 7 07:27:55 2024 >> done (81.574s) 10126525 read pairs processed; of these: 413 ( 0.00%) short read pairs filtered out after trimming by size control 78961 ( 0.78%) empty read pairs filtered out after trimming by size control 10047151 (99.22%) read pairs available; of these: 24141 ( 0.24%) trimmed read pairs available after processing 10023010 (99.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 8 0.00% 27 2 0.00% 28 7 0.00% 29 2 0.00% 30 9 0.00% 31 2 0.00% 32 5 0.00% 33 6 0.00% 34 6 0.00% 35 602 0.01% 36 673 0.01% 37 779 0.01% 38 908 0.01% 39 1043 0.01% 40 1231 0.01% 41 1507 0.01% 42 1672 0.02% 43 1914 0.02% 44 2041 0.02% 45 2277 0.02% 46 2542 0.03% 47 2627 0.03% 48 3059 0.03% 49 3284 0.03% 50 3586 0.04% 51 4075 0.04% 52 4488 0.04% 53 4839 0.05% 54 5164 0.05% 55 5759 0.06% 56 6320 0.06% 57 6629 0.07% 58 7248 0.07% 59 7871 0.08% 60 8271 0.08% 61 8580 0.09% 62 9037 0.09% 63 10302 0.10% 64 10838 0.11% 65 11477 0.11% 66 12799 0.13% 67 13454 0.13% 68 13244 0.13% 69 14048 0.14% 70 15185 0.15% 71 17853 0.18% 72 24208 0.24% 73 94126 0.94% 74 703472 7.00% 75 4262907 42.43% 76 4735147 47.13% 10047151 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=18 prefix-density=0.21 prefix-fanout=3.7 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=158.26 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=18.2 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=177.52 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=19.8 sequence=GCCGCCGCCACCCT SRR11389822 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:32:30 Started mapping on | Dec 07 07:32:31 Finished on | Dec 07 07:46:25 Mapping speed, Million of reads per hour | 43.37 Number of input reads | 10047151 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9060960 Uniquely mapped reads % | 90.18% Average mapped length | 149.42 Number of splices: Total | 3961465 Number of splices: Annotated (sjdb) | 3778255 Number of splices: GT/AG | 3905856 Number of splices: GC/AG | 48311 Number of splices: AT/AC | 1817 Number of splices: Non-canonical | 5481 Mismatch rate per base, % | 1.12% Deletion rate per base | 0.01% Deletion average length | 1.80 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 389960 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 24317 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 596231 596231 596231 N_multimapping 389960 389960 389960 N_noFeature 310142 8764429 435129 N_ambiguous 212147 1145 41772 UnstrandedReadsAssigned:8538671 PositiveStrandReadsAssigned:295386 NegativeStrandReadsAssigned:8584059 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389822 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389822-trimmed-pair1.fastq SRR11389822-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,047,151 reads, 8,960,784 reads pseudoaligned [quant] estimated average fragment length: 183.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52973 SRR11389822.ke.tsv 35125 SRR11389822.se.tsv 88098 total ==> SRR11389822.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.653 0 0 PNS24247 1044 861.541 6.45181 1.13335 PNS24249 1928 1745.54 99.5126 8.62793 PNS24246 1044 861.541 6.45181 1.13335 PNS24248 1044 861.541 6.45181 1.13335 PNS24244 1471 1288.54 20.132 2.36455 PNS24243 293 129.427 0 0 KQK14069 1603 1420.54 383.43 40.8499 KQK14071 474 294.042 36.6741 18.876 ==> SRR11389822.se.tsv <== BRADI_1g14170v3 470 BRADI_1g53295v3 32 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 158 BRADI_1g74790v3 114 BRADI_1g09890v3 0 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR11389822 completed mapping pipeline successfully