Starting /dee2/code/volunteer_pipeline.sh SRR11389823 current disk space = 1544562159616 free memory = 1601914012 SRR11389823 SRAfilesize 7616dfa891f180a37729b75a6e8248a9 SRR11389823.sra SRR11389823.sra file validated SRR11389823 is paired end SRR11389823 is conventional basespace SRR11389823 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.859 32.0 32.0 32.0 32.0 32.0 2 30.90725 32.0 32.0 32.0 32.0 32.0 3 31.04925 32.0 32.0 32.0 32.0 32.0 4 31.088 32.0 32.0 32.0 32.0 32.0 5 31.2295 32.0 32.0 32.0 32.0 32.0 6 33.9005 36.0 36.0 36.0 32.0 36.0 7 33.88075 36.0 36.0 36.0 32.0 36.0 8 34.0165 36.0 36.0 36.0 32.0 36.0 9 34.01925 36.0 36.0 36.0 32.0 36.0 10-11 33.87025 36.0 36.0 36.0 32.0 36.0 12-13 34.015 36.0 36.0 36.0 32.0 36.0 14-15 33.94225 36.0 36.0 36.0 32.0 36.0 16-17 33.897125 36.0 36.0 36.0 32.0 36.0 18-19 33.85675 36.0 36.0 36.0 32.0 36.0 20-21 33.838499999999996 36.0 36.0 36.0 32.0 36.0 22-23 33.702875 36.0 36.0 36.0 29.5 36.0 24-25 33.605999999999995 36.0 36.0 36.0 29.5 36.0 26-27 33.480374999999995 36.0 36.0 36.0 21.0 36.0 28-29 33.513625000000005 36.0 36.0 36.0 21.0 36.0 30-31 33.508875 36.0 36.0 36.0 26.5 36.0 32-33 33.37625 36.0 36.0 36.0 24.0 36.0 34-35 33.402249999999995 36.0 36.0 36.0 21.0 36.0 36-37 33.34037358138934 36.0 36.0 36.0 21.0 36.0 38-39 33.44589686011382 36.0 36.0 36.0 24.0 36.0 40-41 33.099341705250566 36.0 36.0 36.0 17.5 36.0 42-43 33.12521653128327 36.0 36.0 36.0 17.5 36.0 44-45 33.207289579158314 36.0 36.0 36.0 21.0 36.0 46-47 33.09925091480895 36.0 36.0 36.0 17.5 36.0 48-49 33.063549761845074 36.0 36.0 36.0 17.5 36.0 50-51 32.84296146090051 36.0 34.0 36.0 14.0 36.0 52-53 32.76787954830615 36.0 36.0 36.0 14.0 36.0 54-55 32.678374575922376 36.0 34.0 36.0 14.0 36.0 56-57 32.72811405592208 36.0 32.0 36.0 14.0 36.0 58-59 32.46100017502873 36.0 32.0 36.0 14.0 36.0 60-61 32.454579032054774 36.0 32.0 36.0 14.0 36.0 62-63 32.33877674961305 36.0 32.0 36.0 14.0 36.0 64-65 32.55925634071251 36.0 32.0 36.0 14.0 36.0 66-67 32.437043607215934 36.0 32.0 36.0 14.0 36.0 68-69 32.27815164359778 36.0 32.0 36.0 14.0 36.0 70-71 32.3078135892728 36.0 32.0 36.0 14.0 36.0 72-73 32.13221746291167 36.0 32.0 36.0 14.0 36.0 74-75 32.17867735438688 36.0 32.0 36.0 14.0 36.0 76 31.762813318368874 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 4.0 25 14.0 26 30.0 27 58.0 28 110.0 29 180.0 30 280.0 31 372.0 32 553.0 33 741.0 34 1061.0 35 594.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.384096024006 10.152538134533634 14.228557139284822 39.23480870217554 2 24.281070267566893 15.428857214303576 28.107026756689173 32.18304576144036 3 24.256064016004 19.379844961240313 22.48062015503876 33.88347086771693 4 28.707176794198553 26.481620405101275 18.829707426856714 25.98149537384346 5 26.131532883220803 29.207301825456366 22.18054513628407 22.48062015503876 6 22.005501375343837 33.25831457864466 24.131032758189548 20.605151287821954 7 18.95473868467117 24.956239059764943 34.25856464116029 21.8304576144036 8 19.829957489372344 25.006251562890725 29.68242060515129 25.481370342585645 9 20.330082520630157 22.605651412853213 31.607901975493874 25.456364091022753 10-11 23.730932733183295 30.057514378594647 22.455613903475868 23.755938984746187 12-13 25.081270317579396 23.618404601150285 24.306076519129782 26.994248562140534 14-15 23.168292073018254 25.03125781445361 25.431357839459867 26.36909227306827 16-17 23.668417104276067 25.156289072268066 25.04376094023506 26.131532883220803 18-19 24.15603900975244 24.193548387096776 24.718679669917478 26.93173293323331 20-21 24.543635908977244 24.493623405851466 25.206301575393848 25.756439109777446 22-23 24.543635908977244 26.344086021505376 24.218554638659665 24.893723430857715 24-25 24.056014003500874 24.543635908977244 24.681170292573142 26.71917979494874 26-27 23.755938984746187 25.51887971992998 23.705926481620406 27.019254813703427 28-29 23.593398349587396 25.218804701175294 24.431107776944234 26.756689172293076 30-31 23.768442110527634 25.03125781445361 24.668667166791696 26.531632908227053 32-33 22.36809202300575 25.818954738684667 24.88122030507627 26.93173293323331 34-35 24.718679669917478 25.1937984496124 23.793448362090523 26.294073518379594 36-37 24.334125296986368 24.92184569213455 24.384144054020258 26.35988495685882 38-39 24.56535334584115 24.30268918073796 24.44027517198249 26.691682301438398 40-41 23.704630788485606 26.207759699624532 23.9549436795995 26.132665832290364 42-43 24.327031426067357 24.439714536121198 24.82784524852886 26.405408789282586 44-45 23.68486973947896 25.513527054108216 24.085671342685373 26.715931863727455 46-47 24.357849893497054 26.024307730860798 23.681242952011026 25.936599423631122 48-49 24.32940586613186 24.818250188017046 24.555026322386563 26.29731762346453 50-51 24.36669174818159 24.354150990719837 25.056433408577877 26.22272385252069 52-53 24.454203262233378 24.705144291091592 24.291091593475535 26.549560853199498 54-55 25.009416195856875 24.444444444444443 23.904582548650346 26.64155681104834 56-57 24.007038712921066 24.74861739567622 23.868778280542987 27.37556561085973 58-59 24.150088139007806 24.565600604381768 24.817426340972048 26.466884915638378 60-61 25.293005671077506 24.020163831127913 24.39823566477631 26.288594833018276 62-63 23.73437697260447 24.554980431763664 25.186213861886124 26.524428733745744 64-65 24.946209340589796 24.300721427667384 24.148841918744463 26.60422731299835 66-67 24.049188640973632 25.36764705882353 23.78296146044625 26.800202839756594 68-69 24.628099173553718 24.717101080737443 24.437380801017163 26.217418944691673 70-71 25.2005602954285 24.76760473704317 22.65376289316185 27.378072074366482 72-73 24.891053576006154 25.070494744937193 23.276083055626763 26.76236862342989 74-75 24.489795918367346 22.692255710231112 24.611433977564538 28.206514393837008 76 27.27272727272727 0.0 33.670033670033675 39.05723905723906 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 7.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.5 19 3.0 20 4.0 21 6.0 22 6.0 23 6.5 24 7.0 25 9.0 26 9.5 27 9.5 28 11.5 29 14.5 30 26.0 31 39.0 32 43.5 33 45.5 34 45.5 35 62.0 36 89.0 37 103.0 38 120.0 39 135.5 40 142.5 41 166.5 42 187.5 43 194.5 44 209.5 45 204.0 46 189.5 47 195.5 48 199.5 49 187.5 50 180.0 51 163.0 52 148.5 53 143.5 54 126.5 55 112.0 56 97.0 57 97.5 58 101.5 59 104.5 60 116.0 61 109.0 62 96.0 63 96.0 64 90.0 65 78.0 66 75.0 67 77.5 68 79.5 69 75.0 70 69.5 71 70.5 72 61.5 73 45.5 74 40.0 75 41.0 76 36.5 77 24.5 78 14.0 79 11.0 80 13.0 81 11.0 82 7.0 83 5.5 84 4.5 85 3.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 0.0 38 1.0 39 1.0 40 2.0 41 0.0 42 1.0 43 1.0 44 0.0 45 1.0 46 1.0 47 1.0 48 0.0 49 1.0 50 2.0 51 1.0 52 0.0 53 1.0 54 3.0 55 2.0 56 2.0 57 5.0 58 2.0 59 2.0 60 1.0 61 4.0 62 5.0 63 6.0 64 3.0 65 3.0 66 4.0 67 7.0 68 5.0 69 1.0 70 5.0 71 11.0 72 24.0 73 59.0 74 261.0 75 896.0 76 2673.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31697444978498 98.15 2 0.6071338224133569 1.2 3 0.025297242600556536 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05059448520111307 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 11 0.27499999999999997 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.025 17 0.0 0.0 0.0 0.0 0.025 18 0.0 0.0 0.0 0.0 0.025 19 0.0 0.0 0.0 0.0 0.025 20 0.0 0.0 0.0 0.0 0.025 21 0.0 0.0 0.0 0.0 0.025 22 0.0 0.0 0.0 0.0 0.025 23 0.0 0.0 0.0 0.0 0.025 24 0.0 0.0 0.0 0.0 0.025 25 0.0 0.0 0.0 0.0 0.025 26 0.0 0.0 0.0 0.0 0.025 27 0.0 0.0 0.0 0.0 0.025 28 0.0 0.0 0.0 0.0 0.025 29 0.0 0.0 0.0 0.0 0.025 30 0.0 0.0 0.0 0.0 0.025 31 0.0 0.0 0.0 0.0 0.025 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 40 0.0 0.0 0.0 0.0 0.025 41 0.0 0.0 0.0 0.0 0.025 42 0.0 0.0 0.0 0.0 0.025 43 0.0 0.0 0.0 0.0 0.025 44 0.0 0.0 0.0 0.0 0.025 45 0.0 0.0 0.0 0.0 0.025 46 0.0 0.0 0.0 0.0 0.025 47 0.0 0.0 0.0 0.0 0.025 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389823 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.519 32.0 32.0 32.0 32.0 32.0 2 30.10225 32.0 32.0 32.0 21.0 32.0 3 29.958 32.0 32.0 32.0 21.0 32.0 4 29.824 32.0 32.0 32.0 21.0 32.0 5 29.95275 32.0 32.0 32.0 21.0 32.0 6 33.064 36.0 36.0 36.0 21.0 36.0 7 33.14625 36.0 36.0 36.0 21.0 36.0 8 33.1055 36.0 36.0 36.0 21.0 36.0 9 33.2 36.0 36.0 36.0 21.0 36.0 10-11 32.96525 36.0 36.0 36.0 17.5 36.0 12-13 32.973375000000004 36.0 36.0 36.0 21.0 36.0 14-15 32.84625 36.0 36.0 36.0 17.5 36.0 16-17 32.870125 36.0 36.0 36.0 17.5 36.0 18-19 32.782125 36.0 36.0 36.0 17.5 36.0 20-21 32.565625 36.0 34.0 36.0 14.0 36.0 22-23 32.730999999999995 36.0 36.0 36.0 17.5 36.0 24-25 32.676500000000004 36.0 34.0 36.0 14.0 36.0 26-27 32.68825 36.0 36.0 36.0 14.0 36.0 28-29 32.725 36.0 36.0 36.0 14.0 36.0 30-31 32.384625 36.0 34.0 36.0 14.0 36.0 32-33 32.49925 36.0 32.0 36.0 14.0 36.0 34-35 32.248875 36.0 32.0 36.0 14.0 36.0 36-37 32.48490968358373 36.0 32.0 36.0 14.0 36.0 38-39 32.38171810688745 36.0 34.0 36.0 14.0 36.0 40-41 32.28947301144295 36.0 32.0 36.0 14.0 36.0 42-43 32.35087752603511 36.0 34.0 36.0 14.0 36.0 44-45 32.18986706797091 36.0 32.0 36.0 14.0 36.0 46-47 32.07527377817342 36.0 32.0 36.0 14.0 36.0 48-49 32.07103413654619 36.0 32.0 36.0 14.0 36.0 50-51 32.132333769941496 36.0 32.0 36.0 14.0 36.0 52-53 32.09120603015075 36.0 32.0 36.0 14.0 36.0 54-55 32.012316927450605 36.0 32.0 36.0 14.0 36.0 56-57 32.14487186602138 36.0 32.0 36.0 14.0 36.0 58-59 31.791415241314617 36.0 32.0 36.0 14.0 36.0 60-61 31.9453807540502 36.0 32.0 36.0 14.0 36.0 62-63 31.336793384398476 36.0 32.0 36.0 14.0 36.0 64-65 31.45346571150923 36.0 32.0 36.0 14.0 36.0 66-67 31.396217926943706 36.0 32.0 36.0 14.0 36.0 68-69 31.528720412183233 36.0 32.0 36.0 14.0 36.0 70-71 31.506393430411645 36.0 32.0 36.0 14.0 36.0 72-73 31.29088037543611 36.0 32.0 36.0 14.0 36.0 74-75 31.25234882286658 36.0 32.0 36.0 14.0 36.0 76 31.118092354277064 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 9.0 16 19.0 17 10.0 18 9.0 19 8.0 20 14.0 21 12.0 22 25.0 23 21.0 24 36.0 25 46.0 26 72.0 27 105.0 28 143.0 29 212.0 30 302.0 31 364.0 32 527.0 33 645.0 34 869.0 35 541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.286751815677434 15.627347858752819 12.89757074881042 36.18832957675933 2 30.561122244488974 23.471943887775552 25.125250501002007 20.841683366733466 3 28.768152228342515 27.641462193289932 20.205307961942914 23.38507761642464 4 31.121682523785676 30.045067601402103 18.102153229844767 20.73109664496745 5 30.095142714071105 30.520781171757637 19.55433149724587 19.82974461692539 6 24.111166750125186 31.84777165748623 21.507260891337005 22.533800701051575 7 23.716503881793138 16.60405709992487 32.53193087903832 27.147508139243676 8 24.843476083145504 20.63611319809667 24.768344603055347 29.75206611570248 9 24.242424242424242 21.93839218632607 26.521412471825695 27.29777109942399 10-11 28.68421052631579 25.36340852130326 20.175438596491226 25.776942355889727 12-13 26.89655172413793 20.852664576802507 24.363636363636363 27.887147335423197 14-15 26.02860010035123 25.062719518314097 23.808329152032112 25.100351229302557 16-17 27.83905740787165 23.70268237653547 22.97568312860366 25.482577086989224 18-19 27.488092253697673 22.963148658811733 24.016044121333668 25.532714966156934 20-21 27.435736677115983 23.774294670846395 23.184952978056426 25.605015673981192 22-23 27.834922227797293 24.13447064726543 23.0431510286001 24.98745609633718 24-25 27.09612733425241 24.213560596565987 23.398922170698082 25.29138989848352 26-27 26.58561042867887 25.269491100526448 23.539734269240412 24.605164201554274 28-29 27.24993732765104 23.95337177237403 23.690147906743544 25.106542993231386 30-31 26.72348959639007 24.266733517172224 23.815492604662822 25.19428428177488 32-33 26.97417899222863 24.642767610930058 24.116319879669092 24.266733517172224 34-35 27.588368012033094 24.51742291301078 23.101027826522937 24.79318124843319 36-37 27.71371270995237 24.32940586613186 23.013286537979443 24.943594885936324 38-39 27.974921630094045 24.300940438871475 23.197492163009404 24.52664576802508 40-41 26.60895747083177 24.300589637435703 22.544222807677833 26.5462300840547 42-43 27.325216518137317 24.63913643780595 23.19568218902975 24.839964855026984 44-45 26.772938370779464 25.74369273252165 23.634994351700765 23.848374544998116 46-47 26.237126350163276 24.415975885455914 24.139663401155488 25.20723436322532 48-49 26.629820374324837 24.067328225097352 23.47695013189298 25.825901268684838 50-51 27.168720140809654 25.408599446819206 23.04500880060347 24.377671611767664 52-53 27.452213279678066 23.80533199195171 22.698692152917506 26.043762575452718 54-55 27.032469166876417 24.45255474452555 22.62773722627737 25.887238862320665 56-57 27.005920141075702 24.360750724272577 23.516815719863963 25.116513414787754 58-59 27.904629746436232 23.552415794121355 22.82073924561625 25.722215213826168 60-61 26.0897030953885 24.712571067593178 23.360707517372077 25.837018319646244 62-63 26.54094418428047 24.401974433615997 23.73117326920643 25.3259081128971 64-65 27.400735760497273 22.745147786375743 23.531650386908538 26.322466066218446 66-67 27.058973055414338 24.91103202846975 23.02999491611591 25.0 68-69 27.513699502994776 24.378743468841595 23.97094430992736 24.136612718236268 70-71 26.887214203601996 24.89462255715928 23.361859752203344 24.85630348703538 72-73 27.223650385604113 23.830334190231362 23.997429305912597 24.948586118251928 74-75 26.763626478184044 21.32662770150877 25.214081826831592 26.6956639934756 76 28.51192730026505 0.0 33.434305187429004 38.053767512305946 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 8.5 2 1.0 3 1.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 1.5 19 2.5 20 2.5 21 3.0 22 3.0 23 6.0 24 7.5 25 7.0 26 9.0 27 14.5 28 18.5 29 15.5 30 19.0 31 24.5 32 29.5 33 37.0 34 41.0 35 56.5 36 74.5 37 83.0 38 102.5 39 129.0 40 149.5 41 163.0 42 165.5 43 167.5 44 161.5 45 168.0 46 187.5 47 184.5 48 170.5 49 163.0 50 155.5 51 150.5 52 136.0 53 127.5 54 141.0 55 132.5 56 118.5 57 108.0 58 103.0 59 108.5 60 111.0 61 124.0 62 131.0 63 124.0 64 120.0 65 108.0 66 107.0 67 107.5 68 87.5 69 86.5 70 82.0 71 64.5 72 60.5 73 58.0 74 55.5 75 53.5 76 44.5 77 31.0 78 18.0 79 12.0 80 13.5 81 13.5 82 9.0 83 5.0 84 4.0 85 4.0 86 3.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 1.0 98 1.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.15 4 0.15 5 0.15 6 0.15 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.25 12-13 0.3125 14-15 0.35000000000000003 16-17 0.27499999999999997 18-19 0.27499999999999997 20-21 0.3125 22-23 0.35000000000000003 24-25 0.2625 26-27 0.27499999999999997 28-29 0.27499999999999997 30-31 0.27499999999999997 32-33 0.27499999999999997 34-35 0.27499999999999997 36-37 0.11268311005383749 38-39 0.12523481527864747 40-41 0.11278195488721805 42-43 0.12536041118214866 44-45 0.08778530223225482 46-47 0.11290929619872037 48-49 0.08785140562248996 50-51 0.12556504269211452 52-53 0.10050251256281408 54-55 0.11313639220615963 56-57 0.08809463881198087 58-59 0.06303580433686333 60-61 0.11357900050479555 62-63 0.10115058793779237 64-65 0.06338742393509128 66-67 0.0762001524003048 68-69 0.025480952987641737 70-71 0.025539522410930913 72-73 0.03854554798920724 74-75 0.027177605652941975 76 0.03785011355034065 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 1.0 37 0.0 38 1.0 39 1.0 40 2.0 41 0.0 42 1.0 43 1.0 44 0.0 45 1.0 46 1.0 47 1.0 48 0.0 49 1.0 50 2.0 51 1.0 52 0.0 53 1.0 54 3.0 55 2.0 56 2.0 57 5.0 58 2.0 59 2.0 60 2.0 61 4.0 62 5.0 63 6.0 64 4.0 65 3.0 66 4.0 67 8.0 68 5.0 69 3.0 70 7.0 71 6.0 72 29.0 73 59.0 74 277.0 75 899.0 76 2642.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39470365699874 98.52499999999999 2 0.5044136191677175 1.0 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.025220680958385876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583203 spots for SRR11389823.sra Written 583203 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra Read 583195 spots for SRR11389823.sra Written 583195 spots for SRR11389823.sra SRR ids: ['SRR11389823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gmq6xbmh SRR11389823.sra spots: 11663908 blocks: [[1, 583195], [583196, 1166390], [1166391, 1749585], [1749586, 2332780], [2332781, 2915975], [2915976, 3499170], [3499171, 4082365], [4082366, 4665560], [4665561, 5248755], [5248756, 5831950], [5831951, 6415145], [6415146, 6998340], [6998341, 7581535], [7581536, 8164730], [8164731, 8747925], [8747926, 9331120], [9331121, 9914315], [9914316, 10497510], [10497511, 11080705], [11080706, 11663908]] SRR11389823 file size 2203075 SRR11389823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389823 SRR11389823_1.fastq SRR11389823_2.fastq Input file: SRR11389823_1.fastq Paired file: SRR11389823_2.fastq trimmed: SRR11389823-trimmed-pair1.fastq, SRR11389823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:23:07 2024 >> started Sat Dec 7 07:23:17 2024 >> done (9.555s) 11663908 read pairs processed; of these: 445 ( 0.00%) short read pairs filtered out after trimming by size control 83061 ( 0.71%) empty read pairs filtered out after trimming by size control 11580402 (99.28%) read pairs available; of these: 40433 ( 0.35%) trimmed read pairs available after processing 11539969 (99.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 3 0.00% 27 4 0.00% 28 6 0.00% 29 3 0.00% 30 2 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 3 0.00% 35 803 0.01% 36 886 0.01% 37 1023 0.01% 38 1156 0.01% 39 1400 0.01% 40 1741 0.02% 41 2123 0.02% 42 2372 0.02% 43 2565 0.02% 44 2803 0.02% 45 3089 0.03% 46 3385 0.03% 47 3737 0.03% 48 4073 0.04% 49 4406 0.04% 50 4831 0.04% 51 5439 0.05% 52 5992 0.05% 53 6385 0.06% 54 6928 0.06% 55 7809 0.07% 56 8320 0.07% 57 8845 0.08% 58 9611 0.08% 59 10325 0.09% 60 10954 0.09% 61 11589 0.10% 62 12279 0.11% 63 13423 0.12% 64 14690 0.13% 65 15375 0.13% 66 16294 0.14% 67 17728 0.15% 68 17221 0.15% 69 18404 0.16% 70 20105 0.17% 71 23527 0.20% 72 30448 0.26% 73 114100 0.99% 74 840339 7.26% 75 5015816 43.31% 76 5278017 45.58% 11580402 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=69.02 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=12.8 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=141.46 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=19.1 sequence=GCCGCCGCCGCC SRR11389823 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:23:57 Started mapping on | Dec 07 07:23:58 Finished on | Dec 07 07:25:01 Mapping speed, Million of reads per hour | 661.74 Number of input reads | 11580402 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 10163589 Uniquely mapped reads % | 87.77% Average mapped length | 149.30 Number of splices: Total | 4140843 Number of splices: Annotated (sjdb) | 3932540 Number of splices: GT/AG | 4083069 Number of splices: GC/AG | 49883 Number of splices: AT/AC | 1779 Number of splices: Non-canonical | 6112 Mismatch rate per base, % | 1.10% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 680226 % of reads mapped to multiple loci | 5.87% Number of reads mapped to too many loci | 32868 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.78% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 736587 736587 736587 N_multimapping 680226 680226 680226 N_noFeature 404404 9746457 611024 N_ambiguous 267935 1847 60723 UnstrandedReadsAssigned:9491250 PositiveStrandReadsAssigned:415285 NegativeStrandReadsAssigned:9491842 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389823-trimmed-pair1.fastq SRR11389823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,580,402 reads, 10,141,077 reads pseudoaligned [quant] estimated average fragment length: 179.467 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52973 SRR11389823.ke.tsv 35125 SRR11389823.se.tsv 88098 total ==> SRR11389823.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.635 0 0 PNS24247 1044 865.533 6.81819 1.09632 PNS24249 1928 1749.53 94.1403 7.48869 PNS24246 1044 865.533 6.81819 1.09632 PNS24248 1044 865.533 6.81819 1.09632 PNS24244 1471 1292.53 43.4051 4.67359 PNS24243 293 130.134 0 0 KQK14069 1603 1424.53 445.611 43.5347 KQK14071 474 297.361 21.6356 10.126 ==> SRR11389823.se.tsv <== BRADI_1g14170v3 492 BRADI_1g53295v3 24 BRADI_1g59795v3 200 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 148 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR11389823 completed mapping pipeline successfully