Starting /dee2/code/volunteer_pipeline.sh SRR11389824 current disk space = 1544355516416 free memory = 1604615160 SRR11389824 SRAfilesize 81043ce6b3885807f11657e39b8f4c0f SRR11389824.sra SRR11389824.sra file validated SRR11389824 is paired end SRR11389824 is conventional basespace SRR11389824 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 10.89525 2.0 2.0 32.0 2.0 32.0 2 11.02775 2.0 2.0 32.0 2.0 32.0 3 10.9565 2.0 2.0 32.0 2.0 32.0 4 11.08225 2.0 2.0 32.0 2.0 32.0 5 11.00225 2.0 2.0 32.0 2.0 32.0 6 11.7915 2.0 2.0 32.0 2.0 36.0 7 11.86175 2.0 2.0 32.0 2.0 36.0 8 11.77525 2.0 2.0 32.0 2.0 36.0 9 11.777 2.0 2.0 32.0 2.0 36.0 10-11 11.75675 2.0 2.0 32.0 2.0 36.0 12-13 11.75325 2.0 2.0 32.0 2.0 36.0 14-15 11.814625 2.0 2.0 32.0 2.0 36.0 16-17 11.811875 2.0 2.0 32.0 2.0 36.0 18-19 11.751249999999999 2.0 2.0 32.0 2.0 36.0 20-21 11.6745 2.0 2.0 32.0 2.0 36.0 22-23 11.457125000000001 2.0 2.0 32.0 2.0 36.0 24-25 11.430625 2.0 2.0 32.0 2.0 36.0 26-27 11.281375 2.0 2.0 32.0 2.0 36.0 28-29 11.100875 2.0 2.0 21.0 2.0 36.0 30-31 10.9115 2.0 2.0 17.5 2.0 36.0 32-33 10.868875 2.0 2.0 14.0 2.0 36.0 34-35 10.800375 2.0 2.0 14.0 2.0 36.0 36-37 30.272547449724485 36.0 27.0 36.0 14.0 36.0 38-39 30.4632122247927 36.0 26.5 36.0 14.0 36.0 40-41 30.558467741935484 36.0 32.0 36.0 14.0 36.0 42-43 30.071918040042696 36.0 20.5 36.0 14.0 36.0 44-45 29.72011308562197 36.0 20.5 36.0 14.0 36.0 46-47 30.049096930152118 36.0 20.5 36.0 14.0 36.0 48-49 29.573684210526316 36.0 17.5 36.0 14.0 36.0 50-51 29.856680161943316 36.0 23.0 36.0 14.0 36.0 52-53 29.590688259109314 36.0 17.5 36.0 14.0 36.0 54-55 29.570415018645804 36.0 14.0 36.0 14.0 36.0 56-57 29.44547182103031 36.0 14.0 36.0 14.0 36.0 58-59 29.2231989709822 36.0 14.0 36.0 14.0 36.0 60-61 29.22338544883025 36.0 14.0 36.0 14.0 36.0 62-63 29.178427420027703 36.0 14.0 36.0 14.0 36.0 64-65 29.432262801797236 36.0 14.0 36.0 14.0 36.0 66-67 29.15440249431563 36.0 14.0 36.0 14.0 36.0 68-69 28.53334264539135 36.0 14.0 36.0 14.0 36.0 70-71 28.84271523178808 36.0 14.0 36.0 14.0 36.0 72-73 28.396422410560263 36.0 14.0 36.0 14.0 36.0 74-75 28.371762249624844 36.0 14.0 36.0 14.0 36.0 76 27.84447004608295 36.0 14.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 2751.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 4.0 21 16.0 22 38.0 23 88.0 24 83.0 25 58.0 26 53.0 27 28.0 28 26.0 29 36.0 30 64.0 31 86.0 32 111.0 33 142.0 34 237.0 35 177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.33787029623699 28.182546036829464 18.414731785428344 31.064851881505206 2 15.612489991993595 23.058446757405925 42.91433146517214 18.414731785428344 3 14.091273018414732 32.506004803843076 27.942353883106485 25.46036829463571 4 19.21537229783827 29.063250600480384 30.824659727782226 20.89671737389912 5 18.65492393915132 38.35068054443555 28.903122497998403 14.091273018414732 6 14.811849479583666 35.38831064851882 36.188951160928745 13.610888710968775 7 14.331465172137712 34.747798238590875 35.22818254603683 15.692554043234589 8 13.210568454763811 29.46357085668535 38.9111289031225 18.414731785428344 9 14.491593274619696 31.46517213771017 35.22818254603683 18.815052041633308 10-11 16.373098478783028 34.70776621297038 30.824659727782226 18.094475580464373 12-13 18.174539631705365 31.90552441953563 30.904723779023218 19.015212169735786 14-15 16.933546837469976 30.824659727782226 32.826261008807045 19.41553242594075 16-17 17.734187349879903 31.785428342674138 32.02562049639712 18.45476381104884 18-19 17.21377101681345 31.22497998398719 33.46677341873499 18.094475580464373 20-21 19.615692554043235 31.545236188951158 29.943955164131303 18.8951160928743 22-23 19.135308246597276 32.38590872698158 29.063250600480384 19.41553242594075 24-25 20.816653322658127 31.585268214571656 27.90232185748599 19.695756605284227 26-27 22.09767814251401 31.46517213771017 25.740592473979184 20.696557245796637 28-29 24.499599679743795 30.10408326661329 24.419535628502803 20.97678142514011 30-31 25.14011208967174 27.822257806244995 23.77902321857486 23.258606885508406 32-33 25.86068855084067 27.982385908726982 21.977582065652523 24.179343474779824 34-35 27.542033626901517 26.140912730184144 20.576461168935147 25.740592473979184 36-37 28.99598393574297 24.899598393574294 20.96385542168675 25.140562248995984 38-39 24.707779121322048 25.634824667472795 22.087867795243852 27.569528415961308 40-41 25.282258064516128 25.0 19.798387096774196 29.919354838709676 42-43 25.131101250504233 26.3412666397741 19.44332392093586 29.0843081887858 44-45 23.949919224555735 25.88852988691438 22.253634894991922 27.907915993537962 46-47 24.645892351274785 24.281667341157426 22.905706191825175 28.166734115742614 48-49 25.991902834008094 25.020242914979757 22.955465587044536 26.03238866396761 50-51 23.562753036437247 26.072874493927124 22.995951417004047 27.368421052631582 52-53 24.37246963562753 25.425101214574898 21.25506072874494 28.947368421052634 54-55 23.186055938386705 26.266720713417108 20.591811917308473 29.955411430887718 56-57 22.37109216402761 25.416159155501422 22.98010556232237 29.232643118148598 58-59 22.5609756097561 27.235772357723576 23.008130081300813 27.195121951219512 60-61 23.565323565323563 24.501424501424502 22.3036223036223 29.629629629629626 62-63 24.101307189542485 25.939542483660134 22.09967320261438 27.85947712418301 64-65 24.313243132431325 25.953259532595325 24.231242312423124 25.502255022550223 66-67 25.53630363036304 25.165016501650168 22.97854785478548 26.32013201320132 68-69 25.15515101365329 24.53454695904013 25.362019031857674 24.948282995448903 70-71 25.0 23.013245033112582 24.17218543046358 27.81456953642384 72-73 25.291666666666668 21.916666666666668 25.333333333333336 27.458333333333336 74-75 27.917217084984586 19.110523998238662 26.37604579480405 26.5962131219727 76 31.451612903225808 0.0 35.02304147465438 33.525345622119815 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2757.0 1 1380.5 2 4.0 3 3.5 4 2.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 1.5 21 0.0 22 2.5 23 4.5 24 6.5 25 11.0 26 12.5 27 11.5 28 19.5 29 27.5 30 26.0 31 28.0 32 36.5 33 42.0 34 46.5 35 47.0 36 49.5 37 53.0 38 51.5 39 56.0 40 57.5 41 57.0 42 57.0 43 55.5 44 56.0 45 50.5 46 49.5 47 46.5 48 36.5 49 35.0 50 36.5 51 36.0 52 30.0 53 22.0 54 18.5 55 25.5 56 26.5 57 21.0 58 23.0 59 26.5 60 26.0 61 27.0 62 29.5 63 29.0 64 24.5 65 24.0 66 21.0 67 15.0 68 17.5 69 15.5 70 11.0 71 11.0 72 13.5 73 10.0 74 7.5 75 9.5 76 7.0 77 5.0 78 4.0 79 2.5 80 3.5 81 3.0 82 2.0 83 2.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 68.77499999999999 2 68.77499999999999 3 68.77499999999999 4 68.77499999999999 5 68.77499999999999 6 68.77499999999999 7 68.77499999999999 8 68.77499999999999 9 68.77499999999999 10-11 68.77499999999999 12-13 68.77499999999999 14-15 68.77499999999999 16-17 68.77499999999999 18-19 68.77499999999999 20-21 68.77499999999999 22-23 68.77499999999999 24-25 68.77499999999999 26-27 68.77499999999999 28-29 68.77499999999999 30-31 68.77499999999999 32-33 68.77499999999999 34-35 68.77499999999999 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2751.0 36 8.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 1.0 43 1.0 44 0.0 45 2.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 1.0 56 1.0 57 0.0 58 2.0 59 0.0 60 1.0 61 3.0 62 2.0 63 1.0 64 5.0 65 3.0 66 4.0 67 1.0 68 1.0 69 0.0 70 0.0 71 2.0 72 12.0 73 15.0 74 87.0 75 224.0 76 868.0 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 31.125000000000004 #Duplication Level Percentage of deduplicated Percentage of total 1 99.75903614457832 31.05 2 0.08032128514056225 0.05 3 0.0 0.0 4 0.0 0.0 5 0.08032128514056225 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.08032128514056225 68.77499999999999 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 2751 68.77499999999999 No Hit TATATATATATATATATATATATATATATATATATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.225 0.0 0.0 0.0 0.0 18 0.225 0.0 0.0 0.0 0.0 19 0.375 0.0 0.0 0.0 0.0 20 0.375 0.0 0.0 0.0 0.0 21 0.525 0.0 0.0 0.0 0.0 22 0.525 0.0 0.0 0.0 0.0 23 0.575 0.0 0.0 0.0 0.0 24 0.575 0.0 0.0 0.0 0.0 25 0.675 0.0 0.0 0.0 0.0 26 0.675 0.0 0.0 0.0 0.0 27 0.8 0.0 0.0 0.0 0.0 28 0.8 0.0 0.0 0.0 0.0 29 0.875 0.0 0.0 0.0 0.0 30 0.875 0.0 0.0 0.0 0.0 31 0.925 0.0 0.0 0.0 0.0 32 0.925 0.0 0.0 0.0 0.0 33 0.95 0.0 0.0 0.0 0.0 34 0.95 0.0 0.0 0.0 0.0 35 1.0 0.0 0.0 0.0 0.0 36 1.0 0.0 0.0 0.0 0.0 37 1.0 0.0 0.0 0.0 0.0 38 1.0 0.0 0.0 0.0 0.0 39 1.0 0.0 0.0 0.0 0.0 40 1.0 0.0 0.0 0.0 0.0 41 1.0 0.0 0.0 0.0 0.0 42 1.0 0.0 0.0 0.0 0.0 43 1.0 0.0 0.0 0.0 0.0 44 1.0 0.0 0.0 0.0 0.0 45 1.0 0.0 0.0 0.0 0.0 46 1.0 0.0 0.0 0.0 0.0 47 1.0 0.0 0.0 0.0 0.0 48 1.0 0.0 0.0 0.0 0.0 49 1.0 0.0 0.0 0.0 0.0 50 1.0 0.0 0.0 0.0 0.0 51 1.0 0.0 0.0 0.0 0.0 52 1.0 0.0 0.0 0.0 0.0 53 1.0 0.0 0.0 0.0 0.0 54 1.0 0.0 0.0 0.0 0.0 55 1.0 0.0 0.0 0.0 0.0 56 1.0 0.0 0.0 0.0 0.0 57 1.0 0.0 0.0 0.0 0.0 58 1.0 0.0 0.0 0.0 0.0 59 1.0 0.0 0.0 0.0 0.0 60 1.0 0.0 0.0 0.0 0.0 61 1.0 0.0 0.0 0.0 0.0 62 1.0 0.0 0.0 0.0 0.0 63 1.0 0.0 0.0 0.0 0.0 64 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389824 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 10.47675 2.0 2.0 32.0 2.0 32.0 2 10.30375 2.0 2.0 32.0 2.0 32.0 3 10.3065 2.0 2.0 32.0 2.0 32.0 4 10.277 2.0 2.0 32.0 2.0 32.0 5 10.29625 2.0 2.0 32.0 2.0 32.0 6 11.25075 2.0 2.0 32.0 2.0 36.0 7 11.2865 2.0 2.0 32.0 2.0 36.0 8 11.34425 2.0 2.0 32.0 2.0 36.0 9 11.209 2.0 2.0 32.0 2.0 36.0 10-11 11.146125000000001 2.0 2.0 32.0 2.0 36.0 12-13 11.249625 2.0 2.0 32.0 2.0 36.0 14-15 11.115625000000001 2.0 2.0 32.0 2.0 36.0 16-17 11.152375 2.0 2.0 32.0 2.0 36.0 18-19 11.132249999999999 2.0 2.0 32.0 2.0 36.0 20-21 11.064625 2.0 2.0 29.5 2.0 36.0 22-23 11.010625000000001 2.0 2.0 29.5 2.0 36.0 24-25 10.894124999999999 2.0 2.0 21.0 2.0 36.0 26-27 10.724625 2.0 2.0 14.0 2.0 36.0 28-29 10.632125 2.0 2.0 14.0 2.0 36.0 30-31 10.4835 2.0 2.0 14.0 2.0 36.0 32-33 10.450375000000001 2.0 2.0 14.0 2.0 36.0 34-35 10.405750000000001 2.0 2.0 14.0 2.0 36.0 36-37 30.07939328366932 36.0 24.0 36.0 14.0 36.0 38-39 29.657216306204166 36.0 17.5 36.0 14.0 36.0 40-41 30.016101694915253 36.0 23.0 36.0 14.0 36.0 42-43 30.389913468724757 36.0 29.5 36.0 14.0 36.0 44-45 30.03695836873407 36.0 20.5 36.0 14.0 36.0 46-47 29.587819510783035 36.0 14.0 36.0 14.0 36.0 48-49 29.85276595744681 36.0 17.5 36.0 14.0 36.0 50-51 29.94085106382979 36.0 24.0 36.0 14.0 36.0 52-53 29.956595744680854 36.0 20.5 36.0 14.0 36.0 54-55 30.044658275131397 36.0 24.0 36.0 14.0 36.0 56-57 30.346093957208186 36.0 29.5 36.0 14.0 36.0 58-59 29.641809585659715 36.0 20.5 36.0 14.0 36.0 60-61 29.53186410935468 36.0 14.0 36.0 14.0 36.0 62-63 29.24874744331076 36.0 14.0 36.0 14.0 36.0 64-65 29.11054320239628 36.0 17.5 36.0 14.0 36.0 66-67 28.754585322004957 36.0 14.0 36.0 14.0 36.0 68-69 29.10687554395126 36.0 17.5 36.0 14.0 36.0 70-71 29.001305483028723 36.0 14.0 36.0 14.0 36.0 72-73 29.1431990783586 36.0 14.0 36.0 14.0 36.0 74-75 29.280336066214673 36.0 14.0 36.0 14.0 36.0 76 29.218034993270525 36.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 2812.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 0.0 19 4.0 20 4.0 21 14.0 22 29.0 23 61.0 24 55.0 25 66.0 26 70.0 27 58.0 28 43.0 29 31.0 30 59.0 31 63.0 32 102.0 33 140.0 34 218.0 35 165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.612794612794612 32.659932659932664 15.488215488215488 32.23905723905724 2 22.13804713804714 27.441077441077443 37.37373737373738 13.047138047138047 3 18.434343434343432 38.97306397306397 24.074074074074073 18.51851851851852 4 20.37037037037037 32.996632996633 29.629629629629626 17.003367003367003 5 22.727272727272727 39.225589225589225 22.306397306397308 15.74074074074074 6 15.656565656565657 35.18518518518518 31.64983164983165 17.50841750841751 7 18.28138163437237 31.002527379949452 31.42375737152485 19.29233361415333 8 18.602693602693606 26.17845117845118 34.00673400673401 21.21212121212121 9 16.427969671440607 33.52990732940185 30.834035383319293 19.20808761583825 10-11 20.893007582139848 33.824768323504635 26.74810446503791 18.53411962931761 12-13 19.41870261162595 28.77000842459983 29.90732940185341 21.903959561920807 14-15 19.460825610783488 31.55012636899747 30.749789385004213 18.239258635214828 16-17 21.314237573715246 31.04465037910699 28.727885425442288 18.91322662173547 18-19 20.72451558550969 29.780960404380792 29.44397641112047 20.05054759898905 20-21 20.64026958719461 30.41280539174389 29.02274641954507 19.92417860151643 22-23 21.061499578770007 30.28643639427127 28.60151642796967 20.05054759898905 24-25 21.988205560235887 30.07582139848357 26.41112047177759 21.524852569502947 26-27 21.693344566133106 31.25526537489469 26.242628475147427 20.80876158382477 28-29 25.14743049705139 29.865206402695872 23.54675652906487 21.440606571187868 30-31 24.05223251895535 28.68576242628475 23.37826453243471 23.88374052232519 32-33 29.44397641112047 25.90564448188711 22.70429654591407 21.94608256107835 34-35 28.26453243470935 28.348778433024428 20.64026958719461 22.746419545071607 36-37 30.460498521335023 25.09505703422053 22.09547950992818 22.348964934516268 38-39 31.581178465451465 27.130139889783806 20.55955913522679 20.72912250953794 40-41 32.612383375742155 22.731128074639525 22.561492790500424 22.094995759117896 42-43 31.777683495969455 23.46202800169707 22.189223589308444 22.571064913025033 44-45 31.563296516567547 25.148683092608326 22.13254035683942 21.15548003398471 46-47 30.752871118672903 25.223309230114843 23.52190557209698 20.50191407911527 48-49 31.106382978723406 25.574468085106382 22.04255319148936 21.27659574468085 50-51 29.021276595744684 27.574468085106385 23.48936170212766 19.914893617021274 52-53 28.76595744680851 26.638297872340427 22.851063829787236 21.74468085106383 54-55 31.44439710268428 26.8001704303366 21.90029825308905 19.85513421389007 56-57 31.028595817328213 24.62654716175843 22.962014511310286 21.382842509603073 58-59 29.35897435897436 24.358974358974358 24.358974358974358 21.923076923076923 60-61 28.712023962344883 25.37441163885323 23.02096705177578 22.892597347026104 62-63 30.21459227467811 25.493562231759658 22.23175965665236 22.06008583690987 64-65 28.99612236105127 24.687634640241278 22.748815165876778 23.567427832830674 66-67 27.059843885516045 24.978317432784042 22.810060711188203 25.151777970511706 68-69 27.185732927359723 23.401478903871247 24.532405393649412 24.880382775119617 70-71 27.50217580504787 24.978241949521323 23.890339425587467 23.62924281984334 72-73 28.845296477931342 22.781988408381633 25.18947837717343 23.1832367365136 74-75 30.01939864209505 18.622696411251212 25.460717749757517 25.897187196896216 76 33.10901749663526 0.0 32.16689098250337 34.72409152086137 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2818.0 1 1411.0 2 4.0 3 4.0 4 3.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 2.0 14 1.5 15 0.0 16 1.5 17 2.5 18 2.0 19 3.0 20 6.5 21 8.0 22 7.0 23 9.0 24 15.5 25 20.0 26 16.0 27 15.5 28 23.0 29 32.5 30 37.0 31 34.5 32 34.5 33 36.5 34 40.5 35 35.0 36 26.5 37 28.0 38 33.0 39 32.5 40 30.0 41 37.5 42 47.0 43 43.0 44 41.5 45 48.0 46 45.0 47 38.5 48 34.5 49 33.0 50 33.5 51 29.5 52 28.5 53 32.0 54 32.0 55 28.5 56 22.0 57 20.5 58 20.0 59 25.5 60 30.5 61 34.5 62 36.5 63 32.5 64 33.5 65 31.0 66 25.0 67 20.5 68 18.5 69 15.5 70 19.0 71 24.0 72 17.0 73 12.0 74 10.0 75 8.0 76 9.0 77 6.0 78 3.0 79 3.5 80 4.5 81 3.0 82 0.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 70.3 2 70.3 3 70.3 4 70.3 5 70.3 6 70.3 7 70.325 8 70.3 9 70.325 10-11 70.325 12-13 70.325 14-15 70.325 16-17 70.325 18-19 70.325 20-21 70.325 22-23 70.325 24-25 70.325 26-27 70.325 28-29 70.325 30-31 70.325 32-33 70.325 34-35 70.325 36-37 0.08442380751371886 38-39 0.08470986869970351 40-41 0.0847457627118644 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2812.0 36 7.0 37 0.0 38 1.0 39 0.0 40 0.0 41 1.0 42 1.0 43 1.0 44 0.0 45 1.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 1.0 56 1.0 57 0.0 58 2.0 59 0.0 60 1.0 61 2.0 62 2.0 63 1.0 64 5.0 65 3.0 66 4.0 67 1.0 68 1.0 69 0.0 70 0.0 71 25.0 72 5.0 73 50.0 74 76.0 75 250.0 76 743.0 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 29.549999999999997 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49238578680203 29.4 2 0.338409475465313 0.2 3 0.0 0.0 4 0.08460236886632826 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.08460236886632826 70.3 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 2812 70.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.15 0.0 0.0 0.0 0.0 21 0.2 0.0 0.0 0.0 0.0 22 0.2 0.0 0.0 0.0 0.0 23 0.3 0.0 0.0 0.0 0.0 24 0.3 0.0 0.0 0.0 0.0 25 0.35 0.0 0.0 0.0 0.0 26 0.35 0.0 0.0 0.0 0.0 27 0.55 0.0 0.0 0.0 0.0 28 0.55 0.0 0.0 0.0 0.0 29 0.7 0.0 0.0 0.0 0.0 30 0.7 0.0 0.0 0.0 0.0 31 0.7 0.0 0.0 0.0 0.0 32 0.7 0.0 0.0 0.0 0.0 33 0.775 0.0 0.0 0.0 0.0 34 0.775 0.0 0.0 0.0 0.0 35 0.8 0.0 0.0 0.0 0.0 36 0.8 0.0 0.0 0.0 0.0 37 0.85 0.0 0.0 0.0 0.0 38 0.85 0.0 0.0 0.0 0.0 39 0.85 0.0 0.0 0.0 0.0 40 0.85 0.0 0.0 0.0 0.0 41 0.9 0.0 0.0 0.0 0.0 42 0.9 0.0 0.0 0.0 0.0 43 0.9 0.0 0.0 0.0 0.0 44 0.9 0.0 0.0 0.0 0.0 45 0.9 0.0 0.0 0.0 0.0 46 0.9 0.0 0.0 0.0 0.0 47 0.9 0.0 0.0 0.0 0.0 48 0.9 0.0 0.0 0.0 0.0 49 0.9 0.0 0.0 0.0 0.0 50 0.9 0.0 0.0 0.0 0.0 51 0.9 0.0 0.0 0.0 0.0 52 0.9 0.0 0.0 0.0 0.0 53 0.9 0.0 0.0 0.0 0.0 54 0.9 0.0 0.0 0.0 0.0 55 0.9 0.0 0.0 0.0 0.0 56 0.9 0.0 0.0 0.0 0.0 57 0.9 0.0 0.0 0.0 0.0 58 0.9 0.0 0.0 0.0 0.0 59 0.9 0.0 0.0 0.0 0.0 60 0.9 0.0 0.0 0.0 0.0 61 0.9 0.0 0.0 0.0 0.0 62 0.9 0.0 0.0 0.0 0.0 63 0.9 0.0 0.0 0.0 0.0 64 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATAG 20 0.005842002 52.034485 22 GAGCCGT 20 0.005842002 52.034485 63 AGAGCCG 20 0.005842002 52.034485 62 >>END_MODULE Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329831 spots for SRR11389824.sra Written 329831 spots for SRR11389824.sra Read 329850 spots for SRR11389824.sra Written 329850 spots for SRR11389824.sra SRR ids: ['SRR11389824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bgq1gm_ SRR11389824.sra spots: 6596639 blocks: [[1, 329831], [329832, 659662], [659663, 989493], [989494, 1319324], [1319325, 1649155], [1649156, 1978986], [1978987, 2308817], [2308818, 2638648], [2638649, 2968479], [2968480, 3298310], [3298311, 3628141], [3628142, 3957972], [3957973, 4287803], [4287804, 4617634], [4617635, 4947465], [4947466, 5277296], [5277297, 5607127], [5607128, 5936958], [5936959, 6266789], [6266790, 6596639]] SRR11389824 file size 897934 SRR11389824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389824 SRR11389824_1.fastq SRR11389824_2.fastq Input file: SRR11389824_1.fastq Paired file: SRR11389824_2.fastq trimmed: SRR11389824-trimmed-pair1.fastq, SRR11389824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:28:59 2024 >> started Sat Dec 7 07:29:03 2024 >> done (3.770s) 6596639 read pairs processed; of these: 2902 ( 0.04%) short read pairs filtered out after trimming by size control 4742538 (71.89%) empty read pairs filtered out after trimming by size control 1851199 (28.06%) read pairs available; of these: 90647 ( 4.90%) trimmed read pairs available after processing 1760552 (95.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6136 0.33% 19 38 0.00% 20 6637 0.36% 21 51 0.00% 22 9519 0.51% 23 56 0.00% 24 12657 0.68% 25 64 0.00% 26 17263 0.93% 27 72 0.00% 28 14069 0.76% 29 52 0.00% 30 9706 0.52% 31 29 0.00% 32 5739 0.31% 33 21 0.00% 34 3356 0.18% 35 234 0.01% 36 7544 0.41% 37 196 0.01% 38 3446 0.19% 39 242 0.01% 40 1808 0.10% 41 312 0.02% 42 1000 0.05% 43 383 0.02% 44 821 0.04% 45 456 0.02% 46 668 0.04% 47 505 0.03% 48 677 0.04% 49 677 0.04% 50 772 0.04% 51 742 0.04% 52 868 0.05% 53 892 0.05% 54 1114 0.06% 55 2131 0.12% 56 4996 0.27% 57 2110 0.11% 58 1402 0.08% 59 1615 0.09% 60 1705 0.09% 61 1589 0.09% 62 1607 0.09% 63 1622 0.09% 64 1746 0.09% 65 1842 0.10% 66 2049 0.11% 67 2075 0.11% 68 1963 0.11% 69 2117 0.11% 70 2315 0.13% 71 3307 0.18% 72 6306 0.34% 73 51680 2.79% 74 148291 8.01% 75 713996 38.57% 76 785913 42.45% 1851199 reads passed initial QC criterion=sequence-density sequence-density=3.33 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=38 prefix-density=0.78 prefix-fanout=2.3 sequence=ATATATATATAGATCGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=39 fanout-score=24.99 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=4.2 sequence=CAGTCACGAGAGTC criterion=sequence-density sequence-density=1.36 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.46 prefix-fanout=2.3 sequence=ATATATATATAGATCGGAAGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=21.67 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=3.2 sequence=GGGAAAGAGTGATCAGAGCCGTG Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x ATATATATATAGATCGG -y ATATATATATAGATCGGAAGAG -o SRR11389824 SRR11389824_1.fastq SRR11389824_2.fastq Input file: SRR11389824_1.fastq Paired file: SRR11389824_2.fastq trimmed: SRR11389824-trimmed-pair1.fastq, SRR11389824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): ATATATATATAGATCGG -- paired 3' end adapter sequence (-y): ATATATATATAGATCGGAAGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:29:15 2024 >> started Sat Dec 7 07:29:16 2024 >> done (0.705s) 617066 read pairs processed; of these: 67937 (11.01%) short read pairs filtered out after trimming by size control 88 ( 0.01%) empty read pairs filtered out after trimming by size control 549041 (88.98%) read pairs available; of these: 57926 (10.55%) trimmed read pairs available after processing 491115 (89.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20073 3.66% 19 65 0.01% 20 16071 2.93% 21 56 0.01% 22 10100 1.84% 23 34 0.01% 24 6894 1.26% 25 38 0.01% 26 5329 0.97% 27 14 0.00% 28 3591 0.65% 29 7 0.00% 30 2037 0.37% 31 3 0.00% 32 1384 0.25% 33 43 0.01% 34 918 0.17% 35 50 0.01% 36 1215 0.22% 37 61 0.01% 38 505 0.09% 39 73 0.01% 40 302 0.06% 41 105 0.02% 42 236 0.04% 43 129 0.02% 44 206 0.04% 45 177 0.03% 46 191 0.03% 47 171 0.03% 48 243 0.04% 49 219 0.04% 50 256 0.05% 51 250 0.05% 52 267 0.05% 53 311 0.06% 54 345 0.06% 55 486 0.09% 56 1052 0.19% 57 502 0.09% 58 469 0.09% 59 471 0.09% 60 544 0.10% 61 523 0.10% 62 551 0.10% 63 527 0.10% 64 569 0.10% 65 617 0.11% 66 700 0.13% 67 804 0.15% 68 645 0.12% 69 758 0.14% 70 759 0.14% 71 967 0.18% 72 1604 0.29% 73 9839 1.79% 74 38388 6.99% 75 200433 36.51% 76 215864 39.32% criterion=sequence-density sequence-density=2.56 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=37 prefix-density=0.75 prefix-fanout=2.3 sequence=ATATATATATAGATCGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=42 fanout-score=23.09 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=3.4 sequence=GGAAGAGCACAAGTCTGAACT criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=28 prefix-density=0.45 prefix-fanout=2.3 sequence=ATATATATATAGATCGGAAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=34 fanout-score=21.28 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=3.1 sequence=GGGAAAGAGTGATCAGAGCCGTG SRR11389824 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:30:05 Started mapping on | Dec 07 07:30:06 Finished on | Dec 07 07:33:54 Mapping speed, Million of reads per hour | 28.16 Number of input reads | 1783174 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 1036001 Uniquely mapped reads % | 58.10% Average mapped length | 148.99 Number of splices: Total | 465104 Number of splices: Annotated (sjdb) | 443897 Number of splices: GT/AG | 458274 Number of splices: GC/AG | 6050 Number of splices: AT/AC | 188 Number of splices: Non-canonical | 592 Mismatch rate per base, % | 1.07% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61401 % of reads mapped to multiple loci | 3.44% Number of reads mapped to too many loci | 10209 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 30.70% % of reads unmapped: other | 7.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685772 685772 685772 N_multimapping 61401 61401 61401 N_noFeature 38149 998633 54603 N_ambiguous 26397 159 5723 UnstrandedReadsAssigned:971455 PositiveStrandReadsAssigned:37209 NegativeStrandReadsAssigned:975675 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=74 echo kmer=69 SRR11389824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389824-trimmed-pair1.fastq SRR11389824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,783,174 reads, 1,080,829 reads pseudoaligned [quant] estimated average fragment length: 189.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52973 SRR11389824.ke.tsv 35125 SRR11389824.se.tsv 88098 total ==> SRR11389824.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.796 0 0 PNS24247 1044 855.554 0 0 PNS24249 1928 1739.55 15.2259 11.172 PNS24246 1044 855.554 0 0 PNS24248 1044 855.554 0 0 PNS24244 1471 1282.55 2.77414 2.76083 PNS24243 293 125.905 0 0 KQK14069 1603 1414.55 8 7.21865 KQK14071 474 288.442 0 0 ==> SRR11389824.se.tsv <== BRADI_1g14170v3 9 BRADI_1g53295v3 0 BRADI_1g59795v3 9 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 25 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 18 BRADI_1g48960v3 0 SRR11389824 completed mapping pipeline successfully