Starting /dee2/code/volunteer_pipeline.sh SRR11389825 current disk space = 1544349741056 free memory = 1599524448 SRR11389825 SRAfilesize 58677442ec7713db3715d3c4a6dc5089 SRR11389825.sra SRR11389825.sra file validated SRR11389825 is paired end SRR11389825 is conventional basespace SRR11389825 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.76375 32.0 32.0 32.0 32.0 32.0 2 30.95175 32.0 32.0 32.0 32.0 32.0 3 30.94575 32.0 32.0 32.0 32.0 32.0 4 31.13675 32.0 32.0 32.0 32.0 32.0 5 31.17725 32.0 32.0 32.0 32.0 32.0 6 33.9035 36.0 36.0 36.0 32.0 36.0 7 33.82475 36.0 36.0 36.0 32.0 36.0 8 33.9855 36.0 36.0 36.0 32.0 36.0 9 33.92425 36.0 36.0 36.0 32.0 36.0 10-11 33.834625 36.0 36.0 36.0 32.0 36.0 12-13 34.03 36.0 36.0 36.0 32.0 36.0 14-15 33.9075 36.0 36.0 36.0 32.0 36.0 16-17 33.798 36.0 36.0 36.0 32.0 36.0 18-19 33.976749999999996 36.0 36.0 36.0 32.0 36.0 20-21 33.951125 36.0 36.0 36.0 32.0 36.0 22-23 33.75675 36.0 36.0 36.0 29.5 36.0 24-25 33.597 36.0 36.0 36.0 27.0 36.0 26-27 33.613749999999996 36.0 36.0 36.0 26.5 36.0 28-29 33.48625 36.0 36.0 36.0 21.0 36.0 30-31 33.414 36.0 36.0 36.0 21.0 36.0 32-33 33.39725 36.0 36.0 36.0 24.0 36.0 34-35 33.3425 36.0 36.0 36.0 21.0 36.0 36-37 33.403677758318736 36.0 36.0 36.0 24.0 36.0 38-39 33.269702276707534 36.0 36.0 36.0 21.0 36.0 40-41 33.151238428821614 36.0 36.0 36.0 17.5 36.0 42-43 33.15863815404096 36.0 36.0 36.0 21.0 36.0 44-45 33.0464183686522 36.0 36.0 36.0 17.5 36.0 46-47 33.04135817990278 36.0 36.0 36.0 17.5 36.0 48-49 32.84121164028145 36.0 34.0 36.0 14.0 36.0 50-51 32.804338504153556 36.0 36.0 36.0 14.0 36.0 52-53 33.02978263997032 36.0 36.0 36.0 14.0 36.0 54-55 32.80798341885395 36.0 34.0 36.0 14.0 36.0 56-57 32.82222166289118 36.0 34.0 36.0 14.0 36.0 58-59 32.49105495114234 36.0 32.0 36.0 14.0 36.0 60-61 32.49887970978274 36.0 34.0 36.0 14.0 36.0 62-63 32.38241604692466 36.0 32.0 36.0 14.0 36.0 64-65 32.53797704978216 36.0 32.0 36.0 14.0 36.0 66-67 32.58223829975026 36.0 32.0 36.0 14.0 36.0 68-69 32.362613899755075 36.0 32.0 36.0 14.0 36.0 70-71 32.42191294265821 36.0 32.0 36.0 14.0 36.0 72-73 32.17349908290109 36.0 32.0 36.0 14.0 36.0 74-75 32.19605423716739 36.0 32.0 36.0 14.0 36.0 76 31.984392843547774 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 3.0 24 11.0 25 17.0 26 31.0 27 54.0 28 111.0 29 172.0 30 239.0 31 388.0 32 554.0 33 727.0 34 1034.0 35 652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.57668251188391 10.332749562171628 14.085564173129846 40.00500375281461 2 23.942957217913435 15.486614961220916 30.172629472104077 30.397798348761572 3 24.568426319739807 19.289467100325243 22.366775081310983 33.77533149862397 4 29.997498123592692 26.79509632224168 17.96347260445334 25.243932949712285 5 28.271203402551915 30.047535651738805 20.79059294470853 20.89066800100075 6 22.291718789091817 33.22491868901676 23.892919689767325 20.590442832124094 7 18.638979234425822 24.59344508381286 34.801100825619216 21.966474856142106 8 20.640480360270203 23.067300475356518 30.572929697272954 25.719289467100324 9 20.640480360270203 21.31598699024268 31.07330497873405 26.970227670753065 10-11 25.369026770077557 29.321991493620214 21.178383787840882 24.130597948461347 12-13 25.619214410808105 23.092319239429575 24.580935701776333 26.70753064798599 14-15 24.143107330497873 24.36827620715537 25.41906429822367 26.069552164123095 16-17 24.355766825118838 25.193895421566175 25.081310983237426 25.369026770077557 18-19 23.430072554415812 24.31823867900926 25.806855141356017 26.444833625218916 20-21 23.855391543657746 25.331498623967974 25.481611208406306 25.331498623967974 22-23 25.037537537537535 25.75075075075075 24.086586586586588 25.125125125125123 24-25 24.030522892169127 24.931198398799097 24.34325744308231 26.695021265949464 26-27 23.71121121121121 25.462962962962965 24.324324324324326 26.5015015015015 28-29 24.405804353264948 25.66925193895422 24.11808856642482 25.806855141356017 30-31 25.056292219164373 25.106329747310486 24.518388791593697 25.31898924193145 32-33 24.00550412809607 24.405804353264948 25.356517388041034 26.232174130597947 34-35 24.981235926945207 24.818613960470355 24.10557918438829 26.09457092819615 36-37 24.26820115086315 24.430823117338004 24.91868901676257 26.38228671503628 38-39 24.818613960470355 25.181386039529645 23.692769577182887 26.307230422817113 40-41 25.66925193895422 25.23142356767576 23.229922441831373 25.869402051538653 42-43 25.059426998623795 24.796697109971223 24.796697109971223 25.347178781433755 44-45 24.777763866282708 25.065731814198074 23.888819331413547 26.26768498810567 46-47 24.74007265439058 24.80270574971815 23.788049605411498 26.669171990479768 48-49 23.950369720516356 25.241258303045495 24.326356686301544 26.48201529013661 50-51 24.698946312092325 24.209734069242348 24.573507275464124 26.517812343201204 52-53 25.91057523235368 24.428535543833206 22.795779954785232 26.865109269027883 54-55 25.43352601156069 24.327720532797183 24.327720532797183 25.911032922844935 56-57 24.86160040261701 24.5093105183694 23.968293910417714 26.660795168595875 58-59 24.634576612903224 24.596774193548388 24.332157258064516 26.43649193548387 60-61 25.432504104053542 23.828766258365956 23.95504482889254 26.783684808687962 62-63 24.38345769571266 24.38345769571266 24.29492854432781 26.938156064246872 64-65 25.808087210039293 24.109519584231208 23.85600202814045 26.226391177589047 66-67 24.00763358778626 24.770992366412216 24.287531806615775 26.93384223918575 68-69 24.422905241678357 25.264634612932024 24.014794031373548 26.29766611401607 70-71 25.891829689298046 24.945659122874314 23.130034522439587 26.03247666538806 72-73 25.238340633857252 24.568410203555786 24.465343983509406 25.72790517907756 74-75 25.283586169195026 21.74388410550772 24.559245592455923 28.413284132841326 76 27.3315569090217 0.0 34.145413018652455 38.523030072325845 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 6.0 21 10.0 22 10.5 23 8.0 24 5.5 25 5.0 26 9.0 27 13.5 28 16.0 29 16.0 30 17.5 31 26.5 32 36.0 33 46.0 34 50.0 35 59.5 36 77.5 37 95.5 38 114.0 39 135.5 40 161.0 41 183.5 42 195.5 43 197.5 44 198.5 45 207.5 46 215.5 47 199.0 48 176.0 49 166.0 50 157.0 51 140.5 52 131.5 53 135.0 54 128.0 55 129.5 56 132.0 57 119.5 58 116.0 59 118.5 60 111.5 61 110.5 62 115.5 63 105.5 64 94.5 65 98.0 66 92.5 67 76.5 68 75.5 69 72.5 70 59.5 71 47.5 72 48.0 73 45.5 74 37.0 75 33.5 76 30.0 77 28.0 78 20.5 79 15.0 80 13.5 81 6.0 82 2.5 83 3.0 84 3.0 85 4.5 86 3.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.1 24-25 0.075 26-27 0.1 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025759917568263783 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 1.0 44 3.0 45 0.0 46 1.0 47 1.0 48 1.0 49 2.0 50 2.0 51 3.0 52 2.0 53 0.0 54 2.0 55 3.0 56 2.0 57 4.0 58 2.0 59 5.0 60 5.0 61 2.0 62 3.0 63 4.0 64 7.0 65 7.0 66 8.0 67 3.0 68 5.0 69 3.0 70 9.0 71 13.0 72 22.0 73 65.0 74 295.0 75 884.0 76 2627.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16392196605017 97.85000000000001 2 0.6840638459589561 1.35 3 0.07600709399543958 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.02533569799847986 0.2 9 0.02533569799847986 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 8 0.2 TruSeq Adapter, Index 13 (97% over 38bp) GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389825 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5005 32.0 32.0 32.0 27.0 32.0 2 30.028 32.0 32.0 32.0 21.0 32.0 3 30.106 32.0 32.0 32.0 21.0 32.0 4 30.07525 32.0 32.0 32.0 21.0 32.0 5 30.068 32.0 32.0 32.0 21.0 32.0 6 32.8595 36.0 36.0 36.0 14.0 36.0 7 33.29375 36.0 36.0 36.0 21.0 36.0 8 33.301 36.0 36.0 36.0 21.0 36.0 9 33.23825 36.0 36.0 36.0 21.0 36.0 10-11 32.963875 36.0 36.0 36.0 21.0 36.0 12-13 33.167249999999996 36.0 36.0 36.0 21.0 36.0 14-15 32.900625000000005 36.0 36.0 36.0 21.0 36.0 16-17 32.864999999999995 36.0 36.0 36.0 17.5 36.0 18-19 33.07775 36.0 36.0 36.0 21.0 36.0 20-21 32.603875 36.0 36.0 36.0 14.0 36.0 22-23 32.788 36.0 36.0 36.0 17.5 36.0 24-25 32.847625 36.0 36.0 36.0 21.0 36.0 26-27 32.581 36.0 36.0 36.0 14.0 36.0 28-29 32.689750000000004 36.0 36.0 36.0 14.0 36.0 30-31 32.711124999999996 36.0 36.0 36.0 14.0 36.0 32-33 32.561875 36.0 36.0 36.0 14.0 36.0 34-35 32.6425 36.0 36.0 36.0 14.0 36.0 36-37 32.55897821187077 36.0 34.0 36.0 14.0 36.0 38-39 32.42587027297771 36.0 34.0 36.0 14.0 36.0 40-41 32.43563736538943 36.0 34.0 36.0 14.0 36.0 42-43 32.50339840081165 36.0 34.0 36.0 14.0 36.0 44-45 32.39663386279152 36.0 32.0 36.0 14.0 36.0 46-47 32.399570737228984 36.0 32.0 36.0 14.0 36.0 48-49 32.285438263221096 36.0 32.0 36.0 14.0 36.0 50-51 32.56707087996963 36.0 36.0 36.0 14.0 36.0 52-53 32.10123954598249 36.0 32.0 36.0 14.0 36.0 54-55 32.214988373572226 36.0 32.0 36.0 14.0 36.0 56-57 32.14857072612723 36.0 32.0 36.0 14.0 36.0 58-59 32.15001153372559 36.0 32.0 36.0 14.0 36.0 60-61 32.07994214188248 36.0 32.0 36.0 14.0 36.0 62-63 31.590139969015596 36.0 32.0 36.0 14.0 36.0 64-65 31.640781426885617 36.0 32.0 36.0 14.0 36.0 66-67 31.667076978480235 36.0 32.0 36.0 14.0 36.0 68-69 31.648480436808256 36.0 32.0 36.0 14.0 36.0 70-71 31.72275535957876 36.0 32.0 36.0 14.0 36.0 72-73 31.583187802113187 36.0 32.0 36.0 14.0 36.0 74-75 31.35915654827648 36.0 32.0 36.0 14.0 36.0 76 30.927244582043343 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 10.0 16 17.0 17 11.0 18 8.0 19 7.0 20 7.0 21 12.0 22 19.0 23 28.0 24 35.0 25 44.0 26 69.0 27 100.0 28 129.0 29 213.0 30 263.0 31 362.0 32 514.0 33 629.0 34 917.0 35 595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.25995492111195 16.453794139744556 12.747307788630103 36.5389431505134 2 30.428249436513898 23.240671174555473 26.646631605309288 19.684447783621337 3 26.189283925888834 27.84176264396595 19.854782173259892 26.114171256885328 4 30.54581872809214 31.096644967451176 17.351026539809713 21.00650976464697 5 30.59589384076114 30.64596895343015 19.103655483224838 19.654481722583874 6 23.89181066867017 33.98447282744804 20.886551465063864 21.23716503881793 7 23.809523809523807 16.265664160401002 33.40852130325814 26.516290726817044 8 24.593037816178313 21.96343601302279 24.9686952166291 28.4748309541698 9 24.31077694235589 20.977443609022554 27.39348370927318 27.31829573934837 10-11 27.025332330072736 28.179082016553803 19.67644845748683 25.11913719588663 12-13 27.338942609569255 21.36129599397212 23.23245008162753 28.067311314831095 14-15 26.81578286001508 24.579039959788894 24.151796933902993 24.453380246293037 16-17 27.1267252195734 22.86072772898369 23.588456712672524 26.42409033877039 18-19 27.00125470514429 25.232120451693852 22.910915934755334 24.855708908406523 20-21 27.232759703554834 23.96683833689235 23.514633839969854 25.28576811958297 22-23 27.096936212958312 23.80713209442491 23.95781014565545 25.13812154696133 24-25 25.5641925777332 24.72417251755266 23.67101303911735 26.04062186559679 26-27 26.859867017940033 23.97440722619496 23.372224313135114 25.793501442729895 28-29 27.136939876992592 23.898581649303377 23.01995732396134 25.944521149742688 30-31 26.828962228635966 23.942778265779896 23.817292006525285 25.410967499058852 32-33 26.813959327140346 23.663068039166458 24.027115239769017 25.495857393924176 34-35 27.499686363066118 23.7360431564421 23.12131476602685 25.64295571446494 36-37 26.93176116407426 24.686402408429505 23.532363271450073 24.849473156046162 38-39 27.544233906387248 24.01807002133266 23.41573597691053 25.021960095369554 40-41 27.097178683385582 24.9153605015674 22.545454545454547 25.442006269592476 42-43 27.417534177850243 23.353819139596137 23.604665746895773 25.623980935657848 44-45 25.67771084337349 24.359939759036145 24.29718875502008 25.665160642570285 46-47 27.138013311565995 23.60919251538365 24.111515760391814 25.141278412658547 48-49 25.622015581804476 23.686855993968333 23.77481779341543 26.91631063081176 50-51 26.538316345790864 23.858059645149112 23.077891028060904 26.525732980999116 52-53 27.404330312185298 23.96777442094663 23.72860020140987 24.899295065458208 54-55 27.304785894206553 24.534005037783373 23.01007556675063 25.151133501259448 56-57 26.64228974908587 25.091413440928008 23.21270962047661 25.053587189509518 58-59 27.601010101010097 24.015151515151516 22.803030303030305 25.580808080808083 60-61 27.056441407238673 24.651986838774995 23.095418881295874 25.19615287269046 62-63 27.26926977687627 23.92241379310345 23.71957403651116 25.08874239350913 64-65 26.140551531325457 24.36141822340831 23.81497013597662 25.683060109289617 66-67 26.380915933154743 23.98265084832249 23.98265084832249 25.65378237020028 68-69 26.227621483375955 24.232736572890026 24.130434782608695 25.40920716112532 70-71 27.013853258081067 23.794253463314522 23.88404309902514 25.307850179579273 72-73 26.513191929643042 23.836006207966893 23.370408691153646 26.280393171236422 74-75 28.149471081192473 21.7749690891606 24.02802582772359 26.04753400192334 76 29.085979860573197 0.0 34.3144848954299 36.5995352439969 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 7.0 2 0.0 3 0.5 4 1.0 5 1.5 6 1.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 2.0 13 1.5 14 1.5 15 1.5 16 0.5 17 0.5 18 3.0 19 5.5 20 5.5 21 4.0 22 4.5 23 3.5 24 4.5 25 9.5 26 10.5 27 8.0 28 9.0 29 12.5 30 14.0 31 21.0 32 34.0 33 46.0 34 49.0 35 56.0 36 72.0 37 84.0 38 96.5 39 111.0 40 123.0 41 155.0 42 181.5 43 180.0 44 177.5 45 176.0 46 183.5 47 190.0 48 175.5 49 173.5 50 184.5 51 170.5 52 149.0 53 136.0 54 134.5 55 123.0 56 117.5 57 125.0 58 129.0 59 123.5 60 109.0 61 110.5 62 115.5 63 117.0 64 113.5 65 103.5 66 104.0 67 110.5 68 103.0 69 78.5 70 61.5 71 61.0 72 65.5 73 68.0 74 56.5 75 46.5 76 35.0 77 23.0 78 18.5 79 13.0 80 10.5 81 8.5 82 6.0 83 5.5 84 6.0 85 4.0 86 2.0 87 1.5 88 0.5 89 1.5 90 1.5 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.0 97 1.0 98 0.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.15 4 0.15 5 0.15 6 0.17500000000000002 7 0.25 8 0.17500000000000002 9 0.25 10-11 0.325 12-13 0.46249999999999997 14-15 0.525 16-17 0.375 18-19 0.375 20-21 0.4875 22-23 0.44999999999999996 24-25 0.3 26-27 0.36250000000000004 28-29 0.41250000000000003 30-31 0.3875 32-33 0.42500000000000004 34-35 0.36250000000000004 36-37 0.1753067868770348 38-39 0.2128725269221137 40-41 0.13774104683195593 42-43 0.11275369581558506 44-45 0.0877742946708464 46-47 0.100363818843307 48-49 0.11296598468683318 50-51 0.16331658291457288 52-53 0.07547169811320754 54-55 0.07550969041026932 56-57 0.06300403225806452 58-59 0.05047955577990913 60-61 0.07587253414264036 62-63 0.07600709399543958 64-65 0.06350012700025401 66-67 0.05100089251561902 68-69 0.051124744376278126 70-71 0.05128205128205128 72-73 0.0517063081695967 74-75 0.054922422078813676 76 0.07739938080495357 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 2.0 43 1.0 44 3.0 45 0.0 46 1.0 47 1.0 48 1.0 49 2.0 50 2.0 51 3.0 52 2.0 53 0.0 54 2.0 55 3.0 56 2.0 57 4.0 58 2.0 59 4.0 60 6.0 61 2.0 62 4.0 63 4.0 64 8.0 65 7.0 66 9.0 67 3.0 68 4.0 69 4.0 70 12.0 71 14.0 72 24.0 73 67.0 74 295.0 75 910.0 76 2584.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16455696202532 97.925 2 0.6075949367088608 1.2 3 0.1518987341772152 0.44999999999999996 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724777 spots for SRR11389825.sra Written 724777 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra Read 724765 spots for SRR11389825.sra Written 724765 spots for SRR11389825.sra SRR ids: ['SRR11389825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_muxxxyg_ SRR11389825.sra spots: 14495312 blocks: [[1, 724765], [724766, 1449530], [1449531, 2174295], [2174296, 2899060], [2899061, 3623825], [3623826, 4348590], [4348591, 5073355], [5073356, 5798120], [5798121, 6522885], [6522886, 7247650], [7247651, 7972415], [7972416, 8697180], [8697181, 9421945], [9421946, 10146710], [10146711, 10871475], [10871476, 11596240], [11596241, 12321005], [12321006, 13045770], [13045771, 13770535], [13770536, 14495312]] SRR11389825 file size 2742117 SRR11389825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389825 SRR11389825_1.fastq SRR11389825_2.fastq Input file: SRR11389825_1.fastq Paired file: SRR11389825_2.fastq trimmed: SRR11389825-trimmed-pair1.fastq, SRR11389825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:33:18 2024 >> started Sat Dec 7 07:33:30 2024 >> done (12.193s) 14495312 read pairs processed; of these: 556 ( 0.00%) short read pairs filtered out after trimming by size control 58856 ( 0.41%) empty read pairs filtered out after trimming by size control 14435900 (99.59%) read pairs available; of these: 40454 ( 0.28%) trimmed read pairs available after processing 14395446 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 12 0.00% 21 2 0.00% 22 21 0.00% 23 4 0.00% 24 24 0.00% 25 2 0.00% 26 21 0.00% 27 6 0.00% 28 21 0.00% 29 5 0.00% 30 11 0.00% 31 4 0.00% 32 14 0.00% 33 3 0.00% 34 9 0.00% 35 894 0.01% 36 1098 0.01% 37 1208 0.01% 38 1465 0.01% 39 1735 0.01% 40 2098 0.01% 41 2591 0.02% 42 2903 0.02% 43 3323 0.02% 44 3514 0.02% 45 3838 0.03% 46 4195 0.03% 47 4739 0.03% 48 5122 0.04% 49 5717 0.04% 50 6343 0.04% 51 7071 0.05% 52 7631 0.05% 53 8652 0.06% 54 9216 0.06% 55 10326 0.07% 56 11282 0.08% 57 12141 0.08% 58 12828 0.09% 59 13909 0.10% 60 14582 0.10% 61 15654 0.11% 62 17030 0.12% 63 18369 0.13% 64 19908 0.14% 65 21511 0.15% 66 22928 0.16% 67 24765 0.17% 68 24036 0.17% 69 25891 0.18% 70 28284 0.20% 71 32821 0.23% 72 42119 0.29% 73 145639 1.01% 74 1031747 7.15% 75 6232392 43.17% 76 6574218 45.54% 14435900 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.42 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=62.52 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=12.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.0 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=127.47 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=17.1 sequence=GCCGCCGCCACCCT SRR11389825 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:34:08 Started mapping on | Dec 07 07:34:08 Finished on | Dec 07 07:35:32 Mapping speed, Million of reads per hour | 618.68 Number of input reads | 14435900 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 12460003 Uniquely mapped reads % | 86.31% Average mapped length | 149.33 Number of splices: Total | 5003844 Number of splices: Annotated (sjdb) | 4751253 Number of splices: GT/AG | 4934080 Number of splices: GC/AG | 60183 Number of splices: AT/AC | 1971 Number of splices: Non-canonical | 7610 Mismatch rate per base, % | 1.01% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1051241 % of reads mapped to multiple loci | 7.28% Number of reads mapped to too many loci | 48653 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 1.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 924656 924656 924656 N_multimapping 1051241 1051241 1051241 N_noFeature 461674 11841221 841263 N_ambiguous 315451 3340 81609 UnstrandedReadsAssigned:11682878 PositiveStrandReadsAssigned:615442 NegativeStrandReadsAssigned:11537131 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389825-trimmed-pair1.fastq SRR11389825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,435,900 reads, 12,501,128 reads pseudoaligned [quant] estimated average fragment length: 166.68 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR11389825.ke.tsv 35125 SRR11389825.se.tsv 88098 total ==> SRR11389825.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.4 4.30831e-06 6.3912e-07 PNS24247 1044 878.32 11.0196 1.43385 PNS24249 1928 1762.32 67.1434 4.35422 PNS24246 1044 878.32 11.0196 1.43385 PNS24248 1044 878.32 11.0196 1.43385 PNS24244 1471 1305.32 17.7978 1.55827 PNS24243 293 141.948 0 0 KQK14069 1603 1437.32 128.784 10.24 KQK14071 474 310.305 0 0 ==> SRR11389825.se.tsv <== BRADI_1g14170v3 135 BRADI_1g53295v3 33 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 161 BRADI_1g74790v3 149 BRADI_1g09890v3 0 BRADI_1g77505v3 175 BRADI_1g48960v3 0 SRR11389825 completed mapping pipeline successfully