Starting /dee2/code/volunteer_pipeline.sh SRR11389826 current disk space = 1544430419968 free memory = 1601777336 SRR11389826 SRAfilesize 6d2ff1c52736a04348f3b69bf32e2ec2 SRR11389826.sra SRR11389826.sra file validated SRR11389826 is paired end SRR11389826 is conventional basespace SRR11389826 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.289 32.0 14.0 32.0 2.0 32.0 2 24.3325 32.0 14.0 32.0 2.0 32.0 3 24.3645 32.0 14.0 32.0 2.0 32.0 4 24.38725 32.0 14.0 32.0 2.0 32.0 5 24.428 32.0 14.0 32.0 2.0 32.0 6 26.64625 36.0 14.0 36.0 2.0 36.0 7 26.626 36.0 14.0 36.0 2.0 36.0 8 26.644 36.0 14.0 36.0 2.0 36.0 9 26.72075 36.0 14.0 36.0 2.0 36.0 10-11 26.4995 36.0 14.0 36.0 2.0 36.0 12-13 26.637999999999998 36.0 14.0 36.0 2.0 36.0 14-15 26.575875000000003 36.0 14.0 36.0 2.0 36.0 16-17 26.550874999999998 36.0 14.0 36.0 2.0 36.0 18-19 26.6605 36.0 14.0 36.0 2.0 36.0 20-21 26.481375 36.0 14.0 36.0 2.0 36.0 22-23 26.357125 36.0 14.0 36.0 2.0 36.0 24-25 26.317 36.0 14.0 36.0 2.0 36.0 26-27 26.144125000000003 36.0 14.0 36.0 2.0 36.0 28-29 26.136249999999997 36.0 14.0 36.0 2.0 36.0 30-31 25.96525 36.0 14.0 36.0 2.0 36.0 32-33 25.893124999999998 36.0 14.0 36.0 2.0 36.0 34-35 25.89025 36.0 14.0 36.0 2.0 36.0 36-37 33.00894973915659 36.0 36.0 36.0 17.5 36.0 38-39 33.06535817377718 36.0 36.0 36.0 17.5 36.0 40-41 32.93127035830619 36.0 36.0 36.0 14.0 36.0 42-43 32.82274673099219 36.0 34.0 36.0 14.0 36.0 44-45 32.70159713168188 36.0 32.0 36.0 14.0 36.0 46-47 32.771186440677965 36.0 36.0 36.0 14.0 36.0 48-49 32.57498909263478 36.0 32.0 36.0 14.0 36.0 50-51 32.51689615913182 36.0 32.0 36.0 14.0 36.0 52-53 32.4194120272935 36.0 32.0 36.0 14.0 36.0 54-55 32.36488887287745 36.0 32.0 36.0 14.0 36.0 56-57 32.323667642093895 36.0 32.0 36.0 14.0 36.0 58-59 32.07679344674985 36.0 32.0 36.0 14.0 36.0 60-61 32.10944265979921 36.0 32.0 36.0 14.0 36.0 62-63 32.074639107611546 36.0 32.0 36.0 14.0 36.0 64-65 32.065487239010416 36.0 32.0 36.0 14.0 36.0 66-67 32.174562536677 36.0 32.0 36.0 14.0 36.0 68-69 31.70379177591819 36.0 32.0 36.0 14.0 36.0 70-71 31.95104682761962 36.0 32.0 36.0 14.0 36.0 72-73 31.89747364257193 36.0 32.0 36.0 14.0 36.0 74-75 31.883287271775515 36.0 32.0 36.0 14.0 36.0 76 31.34818401937046 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 919.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 9.0 22 11.0 23 29.0 24 35.0 25 37.0 26 40.0 27 40.0 28 74.0 29 128.0 30 174.0 31 265.0 32 385.0 33 532.0 34 806.0 35 513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.568321973385263 13.761765660499838 12.49594287568971 44.173969490425186 2 21.421616358325217 15.87147030185005 35.83252190847128 26.874391431353455 3 21.161960402466732 21.0645894190198 23.596234988640052 34.177215189873415 4 24.56994482310938 27.45861733203505 21.12950340798442 26.841934436871146 5 24.9269717624148 32.39208049334631 22.687439143135347 19.99350860110354 6 21.259331385913665 32.81402142161636 25.478740668614087 20.44790652385589 7 17.68906199285946 26.09542356377799 36.5141187925998 19.70139565076274 8 18.30574488802337 24.407659850697826 33.787731256085685 23.498864005193116 9 19.24699772801039 19.344368711457317 34.98864005193119 26.419993508601102 10-11 22.46024018175917 29.860434923726064 24.131775397598183 23.547549496916588 12-13 23.937033430704314 24.115546900357028 26.030509574813372 25.916910094125285 14-15 22.476468679000323 26.355079519636483 27.18273287893541 23.985718922427786 16-17 23.953261927945473 25.121713729308663 26.046738072054527 24.878286270691333 18-19 22.67121064589419 26.517364492048035 25.72216812723142 25.089256734826353 20-21 23.17429406037001 26.046738072054527 26.923076923076923 23.85589094449854 22-23 24.180460889321647 26.22525154170724 25.267770204479067 24.326517364492048 24-25 23.661148977604675 26.176566049983773 24.699772801038623 25.462512171372932 26-27 23.839662447257385 25.511197663096397 25.868224602401817 24.7809152872444 28-29 23.563777994157743 25.576111652061016 24.74845829276209 26.111652061019146 30-31 22.96332359623499 25.884453099642972 25.283998701720222 25.868224602401817 32-33 24.618630314832846 25.446283674131777 24.42388834793898 25.511197663096397 34-35 24.74845829276209 25.705939629990265 23.839662447257385 25.705939629990265 36-37 24.496426250812213 25.373619233268357 23.944119558154643 26.18583495776478 38-39 25.33767290480065 24.914564686737183 23.498779495524815 26.248982912937347 40-41 25.423452768729643 25.06514657980456 23.550488599348533 25.960912052117262 42-43 25.382860866731832 23.704789833822094 24.144672531769306 26.767676767676768 44-45 23.614732724902215 24.11994784876141 24.72294654498044 27.54237288135593 46-47 23.891786179921773 25.146675358539767 24.2503259452412 26.711212516297262 48-49 23.55722204108249 24.975546136289534 24.845125529833716 26.62210629279426 50-51 23.60907162669277 24.310654266601404 24.408549518681678 27.671724588024148 52-53 24.105830475257225 24.154826065654092 24.25281724644782 27.48652621264086 54-55 23.7534739251267 24.783390550923656 23.965996403465752 27.497139120483897 56-57 23.956799214531173 24.77499590901653 24.856815578465064 26.411389297987238 58-59 24.234485017193386 24.48010479777305 24.430980841657117 26.854429343376452 60-61 23.718263718263717 24.16052416052416 24.848484848484848 27.27272727272727 62-63 24.753937007874015 24.950787401574804 24.06496062992126 26.23031496062992 64-65 24.852168199737186 23.981603153745073 25.131406044678055 26.034822601839686 66-67 24.52239789196311 22.875494071146246 25.87285902503294 26.729249011857707 68-69 24.562272877436406 24.810042946812025 24.909150974562273 25.7185332011893 70-71 24.764267990074444 24.41687344913151 24.946236559139784 25.87262200165426 72-73 24.76269775187344 23.413821815154037 25.262281432139883 26.56119900083264 74-75 25.6885593220339 20.55084745762712 26.23587570621469 27.52471751412429 76 28.958837772397096 0.0 35.30266343825666 35.738498789346245 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 923.0 1 465.5 2 8.0 3 8.0 4 4.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.5 18 3.0 19 5.5 20 9.5 21 13.0 22 10.5 23 7.0 24 7.5 25 9.5 26 9.0 27 14.5 28 22.5 29 25.0 30 28.5 31 34.0 32 35.5 33 36.5 34 49.0 35 58.0 36 57.0 37 67.0 38 93.0 39 117.0 40 131.0 41 140.0 42 143.5 43 162.5 44 177.0 45 156.5 46 139.5 47 147.0 48 139.5 49 123.5 50 121.5 51 102.0 52 79.5 53 85.0 54 94.5 55 94.0 56 87.5 57 83.0 58 84.0 59 85.0 60 87.0 61 78.5 62 71.0 63 68.0 64 67.5 65 64.5 66 56.0 67 52.5 68 53.0 69 54.5 70 48.0 71 40.0 72 39.0 73 36.5 74 29.0 75 27.0 76 23.5 77 17.0 78 12.5 79 10.5 80 9.5 81 5.5 82 4.0 83 3.5 84 3.0 85 2.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.975 2 22.975 3 22.975 4 22.975 5 22.975 6 22.975 7 22.975 8 22.975 9 22.975 10-11 22.975 12-13 22.975 14-15 22.975 16-17 22.975 18-19 22.975 20-21 22.975 22-23 22.975 24-25 22.975 26-27 22.975 28-29 22.975 30-31 22.975 32-33 22.975 34-35 22.975 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 919.0 36 6.0 37 0.0 38 5.0 39 0.0 40 0.0 41 0.0 42 2.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 2.0 49 0.0 50 3.0 51 1.0 52 1.0 53 2.0 54 1.0 55 2.0 56 1.0 57 1.0 58 1.0 59 0.0 60 1.0 61 4.0 62 0.0 63 3.0 64 2.0 65 4.0 66 6.0 67 4.0 68 4.0 69 2.0 70 1.0 71 10.0 72 19.0 73 51.0 74 220.0 75 657.0 76 2065.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 75.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91411648568608 75.14999999999999 2 0.8555445870352089 1.3 3 0.09871668311944717 0.22499999999999998 4 0.03290556103981573 0.1 5 0.06581112207963145 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.03290556103981573 22.975 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 919 22.975 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.15 0.0 0.0 0.0 0.0 24 0.15 0.0 0.0 0.0 0.0 25 0.2 0.0 0.0 0.0 0.0 26 0.2 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.275 0.0 0.0 0.0 0.0 29 0.325 0.0 0.0 0.0 0.0 30 0.325 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.325 0.0 0.0 0.0 0.0 33 0.35 0.0 0.0 0.0 0.0 34 0.35 0.0 0.0 0.0 0.0 35 0.375 0.0 0.0 0.0 0.0 36 0.375 0.0 0.0 0.0 0.0 37 0.375 0.0 0.0 0.0 0.0 38 0.375 0.0 0.0 0.0 0.0 39 0.375 0.0 0.0 0.0 0.0 40 0.375 0.0 0.0 0.0 0.0 41 0.4 0.0 0.0 0.0 0.0 42 0.4 0.0 0.0 0.0 0.0 43 0.4 0.0 0.0 0.0 0.0 44 0.4 0.0 0.0 0.0 0.0 45 0.4 0.0 0.0 0.0 0.0 46 0.4 0.0 0.0 0.0 0.0 47 0.4 0.0 0.0 0.0 0.0 48 0.4 0.0 0.0 0.0 0.0 49 0.4 0.0 0.0 0.0 0.0 50 0.4 0.0 0.0 0.0 0.0 51 0.4 0.0 0.0 0.0 0.0 52 0.4 0.0 0.0 0.0 0.0 53 0.4 0.0 0.0 0.0 0.0 54 0.4 0.0 0.0 0.0 0.0 55 0.4 0.0 0.0 0.0 0.0 56 0.4 0.0 0.0 0.0 0.0 57 0.4 0.0 0.0 0.0 0.0 58 0.4 0.0 0.0 0.0 0.0 59 0.4 0.0 0.0 0.0 0.0 60 0.4 0.0 0.0 0.0 0.0 61 0.4 0.0 0.0 0.0 0.0 62 0.4 0.0 0.0 0.0 0.0 63 0.4 0.0 0.0 0.0 0.0 64 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389826 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.80925 32.0 14.0 32.0 2.0 32.0 2 23.5595 32.0 14.0 32.0 2.0 32.0 3 23.51375 32.0 14.0 32.0 2.0 32.0 4 23.5015 32.0 14.0 32.0 2.0 32.0 5 23.4565 32.0 14.0 32.0 2.0 32.0 6 25.6785 36.0 14.0 36.0 2.0 36.0 7 25.99075 36.0 14.0 36.0 2.0 36.0 8 25.913 36.0 14.0 36.0 2.0 36.0 9 25.943 36.0 14.0 36.0 2.0 36.0 10-11 25.75325 36.0 14.0 36.0 2.0 36.0 12-13 25.9615 36.0 14.0 36.0 2.0 36.0 14-15 25.781875 36.0 14.0 36.0 2.0 36.0 16-17 25.75925 36.0 14.0 36.0 2.0 36.0 18-19 25.864375 36.0 14.0 36.0 2.0 36.0 20-21 25.580750000000002 36.0 14.0 36.0 2.0 36.0 22-23 25.68975 36.0 14.0 36.0 2.0 36.0 24-25 25.509999999999998 36.0 14.0 36.0 2.0 36.0 26-27 25.51575 36.0 14.0 36.0 2.0 36.0 28-29 25.391125000000002 36.0 14.0 36.0 2.0 36.0 30-31 25.395875 36.0 14.0 36.0 2.0 36.0 32-33 25.38825 36.0 14.0 36.0 2.0 36.0 34-35 25.32375 36.0 14.0 36.0 2.0 36.0 36-37 32.46338927421499 36.0 32.0 36.0 14.0 36.0 38-39 32.34817488969114 36.0 34.0 36.0 14.0 36.0 40-41 32.24657767253194 36.0 32.0 36.0 14.0 36.0 42-43 32.40671671921094 36.0 32.0 36.0 14.0 36.0 44-45 32.15832784726794 36.0 32.0 36.0 14.0 36.0 46-47 32.115371955233705 36.0 32.0 36.0 14.0 36.0 48-49 32.137986362465426 36.0 32.0 36.0 14.0 36.0 50-51 32.202261454696625 36.0 32.0 36.0 14.0 36.0 52-53 32.063977748838084 36.0 32.0 36.0 14.0 36.0 54-55 31.848093321145264 36.0 32.0 36.0 14.0 36.0 56-57 32.03803368055366 36.0 32.0 36.0 14.0 36.0 58-59 31.84207486116577 36.0 32.0 36.0 14.0 36.0 60-61 31.775774069873474 36.0 32.0 36.0 14.0 36.0 62-63 31.51229231654349 36.0 32.0 36.0 14.0 36.0 64-65 31.437182876413374 36.0 32.0 36.0 14.0 36.0 66-67 31.248806361468375 36.0 32.0 36.0 14.0 36.0 68-69 31.420655466123655 36.0 32.0 36.0 14.0 36.0 70-71 31.47872661475146 36.0 32.0 36.0 14.0 36.0 72-73 31.211122689943522 36.0 32.0 36.0 14.0 36.0 74-75 31.154534776391426 36.0 32.0 36.0 14.0 36.0 76 30.508797653958943 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 946.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 4.0 16 6.0 17 3.0 18 0.0 19 3.0 20 5.0 21 15.0 22 17.0 23 30.0 24 43.0 25 54.0 26 72.0 27 99.0 28 103.0 29 155.0 30 185.0 31 235.0 32 374.0 33 514.0 34 675.0 35 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.226736566186105 20.642201834862387 11.009174311926607 39.121887287024904 2 27.75229357798165 24.18086500655308 31.716906946264743 16.349934469200527 3 21.77472167648985 29.53503601833661 23.248199083169613 25.442043222003928 4 28.421741977734122 31.335952848722986 18.434839554682384 21.807465618860512 5 27.37393582187295 34.9705304518664 19.48264571054355 18.172888015717092 6 22.608125819134994 35.05897771952818 20.478374836173003 21.854521625163827 7 23.06684141546527 18.807339449541285 33.02752293577982 25.09829619921363 8 22.771952817824378 23.591087811271297 26.24508519003932 27.391874180865006 9 21.231979030144167 21.985583224115334 31.323722149410223 25.458715596330272 10-11 27.0327868852459 26.91803278688524 22.114754098360656 23.934426229508198 12-13 25.410104986876643 23.01509186351706 24.409448818897637 27.165354330708663 14-15 25.381460213289582 25.85726004922067 25.34864643150123 23.412633305988514 16-17 26.849270132852222 23.962604559619486 23.99540757749713 25.192717730031163 18-19 25.4387403641135 24.83188453337707 24.47105133672298 25.25832376578645 20-21 25.803805774278217 25.4757217847769 24.573490813648295 24.146981627296586 22-23 26.464315012305168 25.13535684987695 23.379819524200162 25.02050861361772 24-25 25.848221603015897 24.750040976889036 25.110637600393375 24.29109981970169 26-27 25.286979337487704 26.35290259101345 24.15546080682191 24.204657264676943 28-29 26.60761154855643 24.458661417322837 23.097112860892388 25.836614173228345 30-31 26.041325024598226 25.073794686782552 23.319121023286325 25.565759265332893 32-33 26.63168251885864 25.139389963922596 23.84388324040669 24.38504427681207 34-35 27.189242374549032 24.204657264676943 23.122335191866185 25.48376516890784 36-37 25.98489822718319 25.344714379514116 22.48850952068286 26.18187787261983 38-39 28.09672643526896 24.971212370455667 22.04309919394637 24.888962000329002 40-41 28.423304805793286 23.69980250164582 22.366688610928243 25.510204081632654 42-43 28.10080711579641 24.559380662164386 23.19222533355296 24.14758688848625 44-45 27.900461437046804 24.37376400791035 23.352010547132497 24.37376400791035 46-47 27.097412230097245 24.147024888742376 23.125103016317787 25.630459864842592 48-49 27.485572959604287 23.478977741137676 24.03957131079967 24.995877988458368 50-51 26.923076923076923 24.843182568504456 23.555628920435787 24.678111587982833 52-53 27.113606340819025 24.50462351387054 23.414795244385733 24.9669749009247 54-55 28.165289256198346 23.735537190082646 23.1900826446281 24.90909090909091 56-57 27.26220016542597 24.036393713813066 23.68899917287014 25.01240694789082 58-59 27.663798808735933 23.544010589013897 23.72600926538716 25.066181336863004 60-61 26.44039735099338 24.271523178807946 23.67549668874172 25.612582781456954 62-63 26.119402985074625 24.29519071310116 24.17910447761194 25.406301824212274 64-65 26.46521666943384 23.31064253694172 24.290220820189273 25.933919973435167 66-67 26.00732600732601 24.29237429237429 23.50982350982351 26.190476190476193 68-69 27.729549248747915 23.57262103505843 23.03839732888147 25.659432387312187 70-71 28.21285140562249 23.49397590361446 22.188755020080322 26.104417670682732 72-73 27.153210854542394 23.242878813416485 22.855216585201415 26.74869374683971 74-75 27.254901960784313 20.267379679144383 25.18716577540107 27.29055258467023 76 30.136986301369863 0.0 32.33855185909981 37.52446183953033 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 953.0 1 481.0 2 8.5 3 8.5 4 5.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 2.0 16 1.5 17 1.0 18 3.0 19 6.0 20 5.0 21 7.0 22 9.0 23 8.0 24 9.5 25 10.0 26 14.5 27 18.0 28 19.5 29 20.0 30 20.5 31 25.5 32 30.0 33 34.0 34 39.0 35 45.0 36 58.5 37 72.0 38 72.0 39 83.5 40 102.0 41 120.5 42 132.0 43 129.5 44 128.5 45 129.5 46 131.0 47 126.0 48 118.5 49 125.5 50 128.0 51 114.0 52 102.5 53 110.0 54 115.5 55 93.5 56 81.0 57 89.0 58 95.0 59 91.5 60 89.5 61 95.0 62 99.0 63 88.5 64 75.0 65 74.0 66 76.5 67 75.0 68 69.0 69 66.5 70 61.0 71 48.5 72 40.0 73 36.0 74 35.5 75 35.5 76 30.5 77 25.0 78 16.0 79 10.0 80 13.5 81 10.5 82 4.0 83 2.0 84 2.5 85 2.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.7 2 23.7 3 23.65 4 23.65 5 23.65 6 23.7 7 23.7 8 23.7 9 23.7 10-11 23.75 12-13 23.799999999999997 14-15 23.8125 16-17 23.7875 18-19 23.7875 20-21 23.799999999999997 22-23 23.8125 24-25 23.7375 26-27 23.775 28-29 23.799999999999997 30-31 23.775 32-33 23.775 34-35 23.775 36-37 0.1475168005245042 38-39 0.16423057973394645 40-41 0.11507479861910241 42-43 0.1316005922026649 44-45 0.13166556945358787 46-47 0.14812376563528637 48-49 0.14817253868949623 50-51 0.1812489701763058 52-53 0.11545439551377205 54-55 0.11556876341423147 56-57 0.09915716410510658 58-59 0.08265829062654984 60-61 0.11575988093269389 62-63 0.11595163160510187 64-65 0.08294625082946251 66-67 0.09980039920159679 68-69 0.06673340006673341 70-71 0.06688963210702341 72-73 0.0842034355001684 74-75 0.07125044531528321 76 0.09775171065493646 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 946.0 36 7.0 37 0.0 38 5.0 39 0.0 40 1.0 41 0.0 42 3.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 2.0 49 0.0 50 3.0 51 1.0 52 1.0 53 2.0 54 1.0 55 2.0 56 1.0 57 0.0 58 1.0 59 0.0 60 1.0 61 4.0 62 1.0 63 3.0 64 2.0 65 4.0 66 6.0 67 4.0 68 4.0 69 2.0 70 6.0 71 13.0 72 10.0 73 65.0 74 184.0 75 669.0 76 2046.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 75.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77076411960132 74.325 2 0.9966777408637874 1.5 3 0.09966777408637872 0.22499999999999998 4 0.09966777408637872 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.03322259136212625 23.65 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 946 23.65 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.15 0.0 0.0 0.0 0.0 28 0.15 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.225 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.275 0.0 0.0 0.0 0.0 34 0.275 0.0 0.0 0.0 0.0 35 0.325 0.0 0.0 0.0 0.0 36 0.325 0.0 0.0 0.0 0.0 37 0.325 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.0 39 0.35 0.0 0.0 0.0 0.0 40 0.35 0.0 0.0 0.0 0.0 41 0.35 0.0 0.0 0.0 0.0 42 0.35 0.0 0.0 0.0 0.0 43 0.35 0.0 0.0 0.0 0.0 44 0.35 0.0 0.0 0.0 0.0 45 0.35 0.0 0.0 0.0 0.0 46 0.35 0.0 0.0 0.0 0.0 47 0.35 0.0 0.0 0.0 0.0 48 0.35 0.0 0.0 0.0 0.0 49 0.35 0.0 0.0 0.0 0.0 50 0.35 0.0 0.0 0.0 0.0 51 0.35 0.0 0.0 0.0 0.0 52 0.35 0.0 0.0 0.0 0.0 53 0.35 0.0 0.0 0.0 0.0 54 0.35 0.0 0.0 0.0 0.0 55 0.35 0.0 0.0 0.0 0.0 56 0.35 0.0 0.0 0.0 0.0 57 0.35 0.0 0.0 0.0 0.0 58 0.35 0.0 0.0 0.0 0.0 59 0.35 0.0 0.0 0.0 0.0 60 0.35 0.0 0.0 0.0 0.0 61 0.35 0.0 0.0 0.0 0.0 62 0.35 0.0 0.0 0.0 0.0 63 0.35 0.0 0.0 0.0 0.0 64 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458746 spots for SRR11389826.sra Written 458746 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra Read 458743 spots for SRR11389826.sra Written 458743 spots for SRR11389826.sra SRR ids: ['SRR11389826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fem2hl16 SRR11389826.sra spots: 9174863 blocks: [[1, 458743], [458744, 917486], [917487, 1376229], [1376230, 1834972], [1834973, 2293715], [2293716, 2752458], [2752459, 3211201], [3211202, 3669944], [3669945, 4128687], [4128688, 4587430], [4587431, 5046173], [5046174, 5504916], [5504917, 5963659], [5963660, 6422402], [6422403, 6881145], [6881146, 7339888], [7339889, 7798631], [7798632, 8257374], [8257375, 8716117], [8716118, 9174863]] SRR11389826 file size 1552937 SRR11389826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389826 SRR11389826_1.fastq SRR11389826_2.fastq Input file: SRR11389826_1.fastq Paired file: SRR11389826_2.fastq trimmed: SRR11389826-trimmed-pair1.fastq, SRR11389826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:36:40 2024 >> started Sat Dec 7 07:36:47 2024 >> done (7.054s) 9174863 read pairs processed; of these: 1420 ( 0.02%) short read pairs filtered out after trimming by size control 2479096 (27.02%) empty read pairs filtered out after trimming by size control 6694347 (72.96%) read pairs available; of these: 59820 ( 0.89%) trimmed read pairs available after processing 6634527 (99.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2338 0.03% 19 19 0.00% 20 4004 0.06% 21 29 0.00% 22 5728 0.09% 23 27 0.00% 24 7289 0.11% 25 49 0.00% 26 8183 0.12% 27 29 0.00% 28 7468 0.11% 29 38 0.00% 30 5580 0.08% 31 33 0.00% 32 4233 0.06% 33 18 0.00% 34 2851 0.04% 35 477 0.01% 36 11549 0.17% 37 509 0.01% 38 6563 0.10% 39 731 0.01% 40 4184 0.06% 41 998 0.01% 42 2849 0.04% 43 1308 0.02% 44 2438 0.04% 45 1614 0.02% 46 2190 0.03% 47 1927 0.03% 48 2513 0.04% 49 2336 0.03% 50 2638 0.04% 51 2717 0.04% 52 3234 0.05% 53 3493 0.05% 54 3829 0.06% 55 5342 0.08% 56 8962 0.13% 57 6967 0.10% 58 5103 0.08% 59 5808 0.09% 60 6147 0.09% 61 5767 0.09% 62 6447 0.10% 63 6764 0.10% 64 7320 0.11% 65 7764 0.12% 66 8165 0.12% 67 8871 0.13% 68 8591 0.13% 69 9120 0.14% 70 9741 0.15% 71 11770 0.18% 72 16856 0.25% 73 79203 1.18% 74 469085 7.01% 75 2840914 42.44% 76 3053627 45.62% 6694347 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.52 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=55.51 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=10.9 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=101.60 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=15.7 sequence=GCCGCCGCCGCC SRR11389826 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:37:34 Started mapping on | Dec 07 07:37:34 Finished on | Dec 07 07:39:46 Mapping speed, Million of reads per hour | 182.57 Number of input reads | 6694347 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 5308592 Uniquely mapped reads % | 79.30% Average mapped length | 149.42 Number of splices: Total | 2103830 Number of splices: Annotated (sjdb) | 1998361 Number of splices: GT/AG | 2075292 Number of splices: GC/AG | 24669 Number of splices: AT/AC | 786 Number of splices: Non-canonical | 3083 Mismatch rate per base, % | 1.05% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 637595 % of reads mapped to multiple loci | 9.52% Number of reads mapped to too many loci | 34746 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.23% % of reads unmapped: other | 2.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748160 748160 748160 N_multimapping 637595 637595 637595 N_noFeature 210187 5113755 304745 N_ambiguous 141679 1165 45233 UnstrandedReadsAssigned:4956726 PositiveStrandReadsAssigned:193672 NegativeStrandReadsAssigned:4958614 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389826-trimmed-pair1.fastq SRR11389826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,694,347 reads, 5,522,171 reads pseudoaligned [quant] estimated average fragment length: 181.876 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52973 SRR11389826.ke.tsv 35125 SRR11389826.se.tsv 88098 total ==> SRR11389826.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.282 0.156159 0.0525127 PNS24247 1044 863.124 5.30936 1.56234 PNS24249 1928 1747.12 38.234 5.55818 PNS24246 1044 863.124 5.30936 1.56234 PNS24248 1044 863.124 5.30936 1.56234 PNS24244 1471 1290.12 0.681739 0.134212 PNS24243 293 130.279 0 0 KQK14069 1603 1422.12 23.5402 4.20416 KQK14071 474 295.438 1.45976 1.25493 ==> SRR11389826.se.tsv <== BRADI_1g14170v3 25 BRADI_1g53295v3 9 BRADI_1g59795v3 62 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 62 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 71 BRADI_1g48960v3 0 SRR11389826 completed mapping pipeline successfully