Starting /dee2/code/volunteer_pipeline.sh SRR11389827 current disk space = 1544435380224 free memory = 1597274696 SRR11389827 SRAfilesize b175e0523ab26a9bde2b876f3970a1c8 SRR11389827.sra SRR11389827.sra file validated SRR11389827 is paired end SRR11389827 is conventional basespace SRR11389827 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7775 32.0 32.0 32.0 32.0 32.0 2 30.81575 32.0 32.0 32.0 32.0 32.0 3 31.007 32.0 32.0 32.0 32.0 32.0 4 30.939 32.0 32.0 32.0 32.0 32.0 5 31.00175 32.0 32.0 32.0 32.0 32.0 6 33.83475 36.0 36.0 36.0 32.0 36.0 7 33.85 36.0 36.0 36.0 32.0 36.0 8 33.891 36.0 36.0 36.0 32.0 36.0 9 33.76325 36.0 36.0 36.0 32.0 36.0 10-11 33.941874999999996 36.0 36.0 36.0 32.0 36.0 12-13 33.947 36.0 36.0 36.0 32.0 36.0 14-15 34.016875 36.0 36.0 36.0 32.0 36.0 16-17 33.8365 36.0 36.0 36.0 32.0 36.0 18-19 33.85275 36.0 36.0 36.0 32.0 36.0 20-21 33.859125 36.0 36.0 36.0 32.0 36.0 22-23 33.679125 36.0 36.0 36.0 29.5 36.0 24-25 33.512375 36.0 36.0 36.0 24.0 36.0 26-27 33.6605 36.0 36.0 36.0 32.0 36.0 28-29 33.507000000000005 36.0 36.0 36.0 26.5 36.0 30-31 33.529875000000004 36.0 36.0 36.0 29.5 36.0 32-33 33.3845 36.0 36.0 36.0 24.0 36.0 34-35 33.40625 36.0 36.0 36.0 21.0 36.0 36-37 33.408839779005525 36.0 36.0 36.0 27.0 36.0 38-39 33.469110999497744 36.0 36.0 36.0 24.0 36.0 40-41 33.35836263184329 36.0 36.0 36.0 20.5 36.0 42-43 33.26500879176086 36.0 36.0 36.0 21.0 36.0 44-45 33.072613065326635 36.0 36.0 36.0 21.0 36.0 46-47 33.00766331658292 36.0 36.0 36.0 17.5 36.0 48-49 32.948340874811464 36.0 34.0 36.0 17.5 36.0 50-51 32.967072645832246 36.0 36.0 36.0 17.5 36.0 52-53 32.89660053196096 36.0 36.0 36.0 14.0 36.0 54-55 32.90242345797967 36.0 36.0 36.0 17.5 36.0 56-57 32.943058959012 36.0 36.0 36.0 14.0 36.0 58-59 32.62837866512174 36.0 32.0 36.0 14.0 36.0 60-61 32.64417734003368 36.0 36.0 36.0 14.0 36.0 62-63 32.58003770678742 36.0 34.0 36.0 14.0 36.0 64-65 32.76642054580435 36.0 34.0 36.0 14.0 36.0 66-67 32.67238947305515 36.0 32.0 36.0 14.0 36.0 68-69 32.45483633638748 36.0 32.0 36.0 14.0 36.0 70-71 32.53161619696323 36.0 32.0 36.0 14.0 36.0 72-73 32.3584547793953 36.0 32.0 36.0 14.0 36.0 74-75 32.45154379797726 36.0 32.0 36.0 14.0 36.0 76 31.875598086124402 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 5.0 25 10.0 26 37.0 27 48.0 28 102.0 29 177.0 30 237.0 31 356.0 32 512.0 33 711.0 34 1066.0 35 716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.00301356102461 10.145655449522852 12.380713209442492 43.470617780010045 2 24.30939226519337 13.058764439979909 33.19939728779508 29.432446007031643 3 23.154193872425914 17.955801104972377 22.978402812656956 35.91160220994475 4 28.704168759417374 25.816172777498746 19.261677548970365 26.217980914113507 5 28.201908588648923 29.50778503264691 21.747865394274235 20.542440984429934 6 22.275238573581117 31.29080863887494 23.480662983425415 22.953289804118533 7 18.35760924158714 25.23857358111502 34.07835258663988 22.325464590657962 8 21.62230035158212 22.802611752887998 30.612757408337522 24.962330487192368 9 20.994475138121548 20.66800602712205 32.898041185334 25.439477649422397 10-11 25.08789552988448 28.02611752887996 22.463586137619288 24.422400803616274 12-13 25.251130085384226 22.049221496735306 24.47262682069312 28.227021597187342 14-15 24.434957307885487 25.313912606730288 25.175791059768958 25.075339025615268 16-17 24.91210447011552 23.229532898041185 25.288799598191865 26.569563033651434 18-19 24.623304871923658 23.982923154193873 25.075339025615268 26.3184329482672 20-21 25.251130085384226 25.012556504269213 24.485183324962332 25.251130085384226 22-23 25.42692114515319 24.447513812154696 24.949773982923155 25.175791059768958 24-25 24.460070316423906 24.510296333500754 23.669010547463586 27.36062280261175 26-27 23.76946258161728 25.0 25.3264691109995 25.904068307383227 28-29 25.85384229030638 24.460070316423906 24.422400803616274 25.26368658965344 30-31 25.18834756403817 25.113008538422903 23.681567051732795 26.017076845806127 32-33 24.29683576092416 24.47262682069312 25.075339025615268 26.155198392767453 34-35 24.573078854846813 24.083375188347564 25.23857358111502 26.10497237569061 36-37 24.824208940231042 24.711200401808135 24.698643897538926 25.765946760421897 38-39 24.874434957307887 24.384731290808638 23.756906077348066 26.98392767453541 40-41 24.761426418884984 23.819688598694125 24.04570567553993 27.373179306880964 42-43 25.04395880432052 24.340617935192164 24.453654860587793 26.161768399899522 44-45 23.768844221105528 24.798994974874372 25.22613065326633 26.20603015075377 46-47 24.736180904522616 25.075376884422113 23.9321608040201 26.256281407035175 48-49 24.62292609351433 23.51684263448969 24.170437405731523 27.689793866264456 50-51 25.650697849867974 23.915503583553377 24.19212875644411 26.24166981013454 52-53 25.77682727387093 23.65077368222418 23.084664737702855 27.48773430620204 54-55 24.518322629391765 23.611635814129205 24.253872308273515 27.616169248205512 56-57 25.415826612903224 24.21875 24.609375 25.756048387096776 58-59 24.700239808153476 24.67499684462956 23.665278303672853 26.959485043544113 60-61 25.32861476238625 24.014155712841255 24.16582406471183 26.49140546006067 62-63 25.18987341772152 24.936708860759495 23.265822784810126 26.60759493670886 64-65 25.46978161503301 23.933468765870998 23.628745556119856 26.96800406297613 66-67 25.85241730279898 23.9058524173028 24.592875318066156 25.64885496183206 68-69 25.050942435048395 23.24248599083036 24.414161996943452 27.29240957717779 70-71 26.35807192042846 23.986228003060443 23.718439173680185 25.93726090283091 72-73 25.12188863228124 23.556581986143186 23.646394662560944 27.675134719014626 74-75 25.498710815578775 20.89835798615823 25.21373320667662 28.389197991586375 76 27.788001472212 0.0 32.71991166728009 39.49208686050791 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 11.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 3.5 19 7.5 20 10.5 21 11.5 22 11.0 23 9.0 24 7.5 25 7.5 26 7.5 27 12.5 28 19.0 29 25.0 30 26.0 31 28.0 32 35.0 33 37.0 34 45.0 35 70.5 36 98.5 37 100.5 38 110.5 39 127.5 40 131.0 41 152.5 42 169.5 43 177.5 44 193.5 45 195.5 46 185.5 47 176.5 48 174.0 49 163.5 50 150.0 51 151.0 52 143.0 53 131.0 54 119.0 55 115.0 56 113.5 57 107.0 58 109.0 59 119.0 60 126.0 61 127.0 62 126.0 63 104.0 64 97.0 65 99.5 66 82.5 67 75.0 68 75.0 69 78.0 70 64.0 71 49.0 72 53.0 73 55.5 74 44.5 75 33.0 76 35.0 77 33.5 78 27.5 79 23.0 80 17.0 81 9.5 82 7.5 83 9.0 84 6.0 85 2.5 86 2.5 87 2.5 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.44999999999999996 3 0.44999999999999996 4 0.44999999999999996 5 0.44999999999999996 6 0.44999999999999996 7 0.44999999999999996 8 0.44999999999999996 9 0.44999999999999996 10-11 0.44999999999999996 12-13 0.44999999999999996 14-15 0.44999999999999996 16-17 0.44999999999999996 18-19 0.44999999999999996 20-21 0.44999999999999996 22-23 0.44999999999999996 24-25 0.44999999999999996 26-27 0.44999999999999996 28-29 0.44999999999999996 30-31 0.44999999999999996 32-33 0.44999999999999996 34-35 0.44999999999999996 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 18.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 2.0 48 0.0 49 1.0 50 1.0 51 0.0 52 3.0 53 2.0 54 1.0 55 1.0 56 2.0 57 3.0 58 5.0 59 2.0 60 2.0 61 3.0 62 4.0 63 6.0 64 8.0 65 3.0 66 2.0 67 2.0 68 2.0 69 3.0 70 2.0 71 10.0 72 26.0 73 71.0 74 257.0 75 839.0 76 2717.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.61963190184049 96.45 2 1.1247443762781186 2.1999999999999997 3 0.1278118609406953 0.375 4 0.025562372188139063 0.1 5 0.025562372188139063 0.125 6 0.051124744376278126 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025562372188139063 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 18 0.44999999999999996 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 6 0.15 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389827 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.47425 32.0 32.0 32.0 32.0 32.0 2 30.10525 32.0 32.0 32.0 21.0 32.0 3 30.09275 32.0 32.0 32.0 21.0 32.0 4 29.98825 32.0 32.0 32.0 21.0 32.0 5 30.098 32.0 32.0 32.0 21.0 32.0 6 33.05525 36.0 36.0 36.0 21.0 36.0 7 33.17475 36.0 36.0 36.0 21.0 36.0 8 33.04275 36.0 36.0 36.0 21.0 36.0 9 33.13325 36.0 36.0 36.0 21.0 36.0 10-11 33.022875 36.0 36.0 36.0 21.0 36.0 12-13 33.131125 36.0 36.0 36.0 21.0 36.0 14-15 33.055625 36.0 36.0 36.0 21.0 36.0 16-17 32.878249999999994 36.0 36.0 36.0 17.5 36.0 18-19 32.88175 36.0 36.0 36.0 17.5 36.0 20-21 32.73775 36.0 36.0 36.0 14.0 36.0 22-23 32.71925 36.0 36.0 36.0 17.5 36.0 24-25 32.864999999999995 36.0 36.0 36.0 17.5 36.0 26-27 32.623000000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.672125 36.0 36.0 36.0 14.0 36.0 30-31 32.6025 36.0 36.0 36.0 14.0 36.0 32-33 32.608625 36.0 36.0 36.0 14.0 36.0 34-35 32.602999999999994 36.0 36.0 36.0 14.0 36.0 36-37 32.60329642677403 36.0 34.0 36.0 14.0 36.0 38-39 32.54089079013588 36.0 36.0 36.0 14.0 36.0 40-41 32.61704002013592 36.0 34.0 36.0 14.0 36.0 42-43 32.54078549848943 36.0 34.0 36.0 14.0 36.0 44-45 32.58964996222614 36.0 36.0 36.0 14.0 36.0 46-47 32.56144547972803 36.0 36.0 36.0 14.0 36.0 48-49 32.42995716805241 36.0 32.0 36.0 14.0 36.0 50-51 32.40503864543776 36.0 32.0 36.0 14.0 36.0 52-53 32.53989284579619 36.0 32.0 36.0 14.0 36.0 54-55 32.34987353348352 36.0 32.0 36.0 14.0 36.0 56-57 32.34733310875302 36.0 32.0 36.0 14.0 36.0 58-59 32.148621197330726 36.0 32.0 36.0 14.0 36.0 60-61 32.217295251344005 36.0 32.0 36.0 14.0 36.0 62-63 31.921551504728107 36.0 32.0 36.0 14.0 36.0 64-65 31.778634589900445 36.0 32.0 36.0 14.0 36.0 66-67 31.827991757641353 36.0 32.0 36.0 14.0 36.0 68-69 31.70903723667807 36.0 32.0 36.0 14.0 36.0 70-71 31.96307701713876 36.0 32.0 36.0 14.0 36.0 72-73 31.68059504192214 36.0 32.0 36.0 14.0 36.0 74-75 31.723147809432035 36.0 32.0 36.0 14.0 36.0 76 31.022064323111444 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 1.0 4 3.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 5.0 17 7.0 18 6.0 19 4.0 20 5.0 21 10.0 22 16.0 23 20.0 24 33.0 25 44.0 26 87.0 27 97.0 28 141.0 29 173.0 30 280.0 31 351.0 32 457.0 33 702.0 34 930.0 35 595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.643918408461346 18.912112817929994 10.95441954167716 36.4895492319315 2 28.60383064516129 23.96673387096774 27.04133064516129 20.38810483870968 3 25.490689481630596 27.327629592350277 20.45797684952189 26.723704076497235 4 28.91293407146452 31.9073980875692 17.53900352289884 21.640664318067437 5 29.1897332662305 29.919476597886263 19.92954202315048 20.961248112732765 6 22.577397432670526 34.231059652655425 20.865844450037756 22.325698464636297 7 22.90249433106576 17.10758377425044 33.38372385991434 26.606198034769463 8 23.778337531486144 21.8639798488665 24.710327455919394 29.647355163727962 9 23.35012594458438 21.234256926952142 26.851385390428213 28.56423173803526 10-11 27.99899193548387 26.411290322580644 20.224294354838708 25.365423387096776 12-13 27.42525545603633 20.5374038097641 23.224422858584585 28.812917875614986 14-15 25.807672892478546 24.103987884906612 24.293286219081274 25.795053003533567 16-17 27.118003025718608 23.22239031770045 23.81492687846697 25.84467977811397 18-19 26.071608673726676 22.629853756933937 24.180534543620777 27.118003025718608 20-21 26.677598385469224 24.520686175580224 23.662966700302725 25.13874873864783 22-23 27.082281675921248 23.97778899545684 23.27107521453811 25.668854114083793 24-25 26.184475806451612 24.029737903225808 23.739919354838708 26.04586693548387 26-27 25.438043615277955 24.68170931551746 23.14382957267112 26.736417496533466 28-29 27.616645649432535 23.631778058007566 23.165195460277427 25.586380832282472 30-31 26.28261691667717 24.404386738938612 23.39594100592462 25.917055338459598 32-33 25.980083196772974 23.900163872431616 23.66065801084079 26.459094919954616 34-35 26.79944535484684 25.07248203706038 22.77826799445355 25.349804613639225 36-37 26.74902306819614 23.358124290936594 23.610235724190094 26.28261691667717 38-39 26.43388377662927 24.467414597251985 22.92953485440565 26.169166771713098 40-41 27.04133064516129 23.51310483870968 22.73185483870968 26.713709677419356 42-43 26.380136123014875 24.61557852281321 23.342576254096294 25.661709100075626 44-45 27.07676793142569 22.954745997730996 23.950586159082317 26.017899911761 46-47 26.838188926724683 24.240131164081223 22.85281876655316 26.068861142640937 48-49 26.028261418117587 23.959121877365632 23.492303810244763 26.520312894272013 50-51 26.647311285029033 23.97121938904317 23.3779348649331 26.003534460994697 52-53 26.890544123216763 23.279888902916298 23.292513571518747 26.53705340234819 54-55 27.72652596992291 24.22595728547959 22.76001516491849 25.287501579679013 56-57 27.061203844208396 24.114820435002528 24.07688416793121 24.747091552857867 58-59 27.659574468085108 24.05015197568389 23.10030395136778 25.189969604863222 60-61 26.357179096905124 23.554033485540334 23.376458650431253 26.71232876712329 62-63 26.63871951219512 23.691565040650406 23.628048780487802 26.041666666666668 64-65 27.29936305732484 23.439490445859875 23.528662420382165 25.73248407643312 66-67 26.79688497382867 24.307417336907953 23.490361291969872 25.405336397293503 68-69 26.868532004599466 24.019419956560622 23.30394787274818 25.808100166091734 70-71 27.557945959789986 23.63939044692022 23.280829811755666 25.521833781534127 72-73 26.098157928635835 23.08385933273219 23.54759757825583 27.270385160376144 74-75 27.431455463101894 20.215523120993044 25.43991269949529 26.913108716409766 76 28.764044943820227 0.0 32.659176029962545 38.57677902621723 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 31.0 1 16.0 2 0.5 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 3.0 18 5.5 19 5.5 20 5.0 21 7.0 22 8.0 23 6.5 24 9.0 25 11.0 26 7.5 27 7.0 28 9.5 29 14.5 30 24.5 31 27.5 32 28.5 33 34.5 34 37.5 35 57.5 36 83.5 37 90.5 38 92.5 39 107.0 40 121.0 41 155.5 42 185.0 43 169.0 44 161.5 45 166.0 46 169.5 47 173.5 48 161.5 49 158.0 50 157.0 51 143.0 52 139.0 53 139.5 54 136.0 55 121.5 56 112.5 57 125.0 58 135.5 59 143.0 60 137.5 61 120.0 62 119.5 63 120.0 64 104.5 65 100.0 66 95.0 67 81.5 68 84.0 69 88.5 70 85.0 71 79.5 72 73.0 73 65.5 74 53.0 75 45.5 76 43.5 77 31.5 78 20.0 79 15.0 80 12.5 81 13.5 82 11.5 83 8.0 84 7.5 85 4.0 86 2.0 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.8 3 0.65 4 0.65 5 0.65 6 0.675 7 0.775 8 0.75 9 0.75 10-11 0.8 12-13 0.9125 14-15 0.95 16-17 0.8500000000000001 18-19 0.8500000000000001 20-21 0.8999999999999999 22-23 0.95 24-25 0.8 26-27 0.8375 28-29 0.8750000000000001 30-31 0.8375 32-33 0.8375 34-35 0.8375 36-37 0.1887267237040765 38-39 0.1887267237040765 40-41 0.12584948401711551 42-43 0.12588116817724068 44-45 0.11332158146562579 46-47 0.16368672878368168 48-49 0.15117157974300832 50-51 0.1638311279143037 52-53 0.12608750472828142 54-55 0.12621481761958853 56-57 0.1262945188178833 58-59 0.11385199240986717 60-61 0.12667848999239928 62-63 0.12687135244861708 64-65 0.11451838656317598 66-67 0.11476664116296864 68-69 0.1021059349074665 70-71 0.10234105155430473 72-73 0.11580030880082347 74-75 0.10900667665894535 76 0.14958863126402394 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 26.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 1.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 2.0 48 0.0 49 1.0 50 1.0 51 0.0 52 3.0 53 2.0 54 1.0 55 1.0 56 2.0 57 3.0 58 5.0 59 2.0 60 2.0 61 3.0 62 4.0 63 6.0 64 7.0 65 4.0 66 2.0 67 1.0 68 3.0 69 5.0 70 5.0 71 8.0 72 24.0 73 79.0 74 251.0 75 870.0 76 2674.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.51434426229508 96.15 2 1.2295081967213115 2.4 3 0.15368852459016394 0.44999999999999996 4 0.05122950819672131 0.2 5 0.0 0.0 6 0.025614754098360656 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025614754098360656 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745649 spots for SRR11389827.sra Written 745649 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra Read 745633 spots for SRR11389827.sra Written 745633 spots for SRR11389827.sra SRR ids: ['SRR11389827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dr3hjma4 SRR11389827.sra spots: 14912676 blocks: [[1, 745633], [745634, 1491266], [1491267, 2236899], [2236900, 2982532], [2982533, 3728165], [3728166, 4473798], [4473799, 5219431], [5219432, 5965064], [5965065, 6710697], [6710698, 7456330], [7456331, 8201963], [8201964, 8947596], [8947597, 9693229], [9693230, 10438862], [10438863, 11184495], [11184496, 11930128], [11930129, 12675761], [12675762, 13421394], [13421395, 14167027], [14167028, 14912676]] SRR11389827 file size 2819506 SRR11389827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389827 SRR11389827_1.fastq SRR11389827_2.fastq Input file: SRR11389827_1.fastq Paired file: SRR11389827_2.fastq trimmed: SRR11389827-trimmed-pair1.fastq, SRR11389827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:37:05 2024 >> started Sat Dec 7 07:37:19 2024 >> done (13.508s) 14912676 read pairs processed; of these: 620 ( 0.00%) short read pairs filtered out after trimming by size control 78492 ( 0.53%) empty read pairs filtered out after trimming by size control 14833564 (99.47%) read pairs available; of these: 23657 ( 0.16%) trimmed read pairs available after processing 14809907 (99.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 63 0.00% 19 0 0.00% 20 115 0.00% 21 4 0.00% 22 131 0.00% 23 2 0.00% 24 192 0.00% 25 4 0.00% 26 214 0.00% 27 7 0.00% 28 197 0.00% 29 4 0.00% 30 157 0.00% 31 7 0.00% 32 110 0.00% 33 4 0.00% 34 94 0.00% 35 831 0.01% 36 1352 0.01% 37 997 0.01% 38 1496 0.01% 39 1550 0.01% 40 2017 0.01% 41 2235 0.02% 42 2629 0.02% 43 2802 0.02% 44 3274 0.02% 45 3377 0.02% 46 3740 0.03% 47 4190 0.03% 48 4751 0.03% 49 5154 0.03% 50 5694 0.04% 51 6181 0.04% 52 7003 0.05% 53 7697 0.05% 54 8461 0.06% 55 9257 0.06% 56 10357 0.07% 57 10683 0.07% 58 11829 0.08% 59 12483 0.08% 60 13387 0.09% 61 14216 0.10% 62 15308 0.10% 63 16715 0.11% 64 18051 0.12% 65 19055 0.13% 66 20707 0.14% 67 22413 0.15% 68 22195 0.15% 69 23473 0.16% 70 25426 0.17% 71 29722 0.20% 72 40169 0.27% 73 144911 0.98% 74 1019089 6.87% 75 6355234 42.84% 76 6902148 46.53% 14833564 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.55 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=59.14 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=11.4 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=29 prefix-density=0.44 prefix-fanout=2.1 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=23 fanout-score=90.10 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=14.8 sequence=GCCGCCGCCACCCT SRR11389827 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:37:58 Started mapping on | Dec 07 07:38:00 Finished on | Dec 07 07:39:13 Mapping speed, Million of reads per hour | 731.52 Number of input reads | 14833564 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 12918634 Uniquely mapped reads % | 87.09% Average mapped length | 149.51 Number of splices: Total | 5248927 Number of splices: Annotated (sjdb) | 4995595 Number of splices: GT/AG | 5178723 Number of splices: GC/AG | 61171 Number of splices: AT/AC | 1721 Number of splices: Non-canonical | 7312 Mismatch rate per base, % | 0.97% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1180082 % of reads mapped to multiple loci | 7.96% Number of reads mapped to too many loci | 36282 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 734848 734848 734848 N_multimapping 1180082 1180082 1180082 N_noFeature 436559 12470725 650643 N_ambiguous 317420 2303 89258 UnstrandedReadsAssigned:12164655 PositiveStrandReadsAssigned:445606 NegativeStrandReadsAssigned:12178733 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389827-trimmed-pair1.fastq SRR11389827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,833,564 reads, 13,235,073 reads pseudoaligned [quant] estimated average fragment length: 162.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR11389827.ke.tsv 35125 SRR11389827.se.tsv 88098 total ==> SRR11389827.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.316 0 0 PNS24247 1044 882.227 10.8976 1.31433 PNS24249 1928 1766.23 53.8439 3.2437 PNS24246 1044 882.227 10.8976 1.31433 PNS24248 1044 882.227 10.8976 1.31433 PNS24244 1471 1309.23 39.4632 3.20722 PNS24243 293 140.978 0 0 KQK14069 1603 1441.23 39.6263 2.92552 KQK14071 474 313.743 5.59942 1.89898 ==> SRR11389827.se.tsv <== BRADI_1g14170v3 45 BRADI_1g53295v3 23 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 123 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 168 BRADI_1g48960v3 0 SRR11389827 completed mapping pipeline successfully