Starting /dee2/code/volunteer_pipeline.sh SRR11389828 current disk space = 1544425517056 free memory = 1601877856 SRR11389828 SRAfilesize d13595284efa9c17ddda7189eb16fd8b SRR11389828.sra SRR11389828.sra file validated SRR11389828 is paired end SRR11389828 is conventional basespace SRR11389828 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.862 32.0 32.0 32.0 32.0 32.0 2 30.8765 32.0 32.0 32.0 32.0 32.0 3 30.80725 32.0 32.0 32.0 32.0 32.0 4 30.90675 32.0 32.0 32.0 32.0 32.0 5 31.045 32.0 32.0 32.0 32.0 32.0 6 33.81475 36.0 36.0 36.0 32.0 36.0 7 33.75725 36.0 36.0 36.0 32.0 36.0 8 33.85575 36.0 36.0 36.0 32.0 36.0 9 33.58625 36.0 36.0 36.0 32.0 36.0 10-11 33.8895 36.0 36.0 36.0 32.0 36.0 12-13 34.009375000000006 36.0 36.0 36.0 32.0 36.0 14-15 33.891999999999996 36.0 36.0 36.0 32.0 36.0 16-17 33.850125 36.0 36.0 36.0 32.0 36.0 18-19 33.89075 36.0 36.0 36.0 32.0 36.0 20-21 33.882125 36.0 36.0 36.0 32.0 36.0 22-23 33.662499999999994 36.0 36.0 36.0 27.0 36.0 24-25 33.471999999999994 36.0 36.0 36.0 27.0 36.0 26-27 33.524375 36.0 36.0 36.0 21.0 36.0 28-29 33.470124999999996 36.0 36.0 36.0 21.0 36.0 30-31 33.275375 36.0 36.0 36.0 21.0 36.0 32-33 33.20375 36.0 36.0 36.0 21.0 36.0 34-35 33.229124999999996 36.0 36.0 36.0 21.0 36.0 36-37 33.26044011002751 36.0 36.0 36.0 21.0 36.0 38-39 33.18249614549582 36.0 36.0 36.0 21.0 36.0 40-41 32.996473957069405 36.0 36.0 36.0 17.5 36.0 42-43 32.8460960960961 36.0 36.0 36.0 14.0 36.0 44-45 32.99674593241552 36.0 36.0 36.0 17.5 36.0 46-47 32.875250501002 36.0 34.0 36.0 14.0 36.0 48-49 32.90579499362287 36.0 34.0 36.0 17.5 36.0 50-51 32.872492477432296 36.0 34.0 36.0 14.0 36.0 52-53 32.7441984209476 36.0 34.0 36.0 14.0 36.0 54-55 32.61472766796574 36.0 34.0 36.0 14.0 36.0 56-57 32.57968268445154 36.0 32.0 36.0 14.0 36.0 58-59 32.41192036290323 36.0 32.0 36.0 14.0 36.0 60-61 32.32487306947903 36.0 32.0 36.0 14.0 36.0 62-63 32.24194575739024 36.0 32.0 36.0 14.0 36.0 64-65 32.52070780609978 36.0 32.0 36.0 14.0 36.0 66-67 32.27811237065756 36.0 32.0 36.0 14.0 36.0 68-69 32.180983134735925 36.0 32.0 36.0 14.0 36.0 70-71 32.277883907622765 36.0 32.0 36.0 14.0 36.0 72-73 32.05327078273629 36.0 32.0 36.0 14.0 36.0 74-75 32.10034075587461 36.0 32.0 36.0 14.0 36.0 76 31.75471001108238 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 6.0 24 6.0 25 10.0 26 39.0 27 68.0 28 129.0 29 190.0 30 271.0 31 400.0 32 542.0 33 751.0 34 1062.0 35 525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.03300825206302 10.827706926731683 12.128032008002 45.0112528132033 2 24.10602650662666 14.078519629907477 35.0587646911728 26.756689172293076 3 23.730932733183295 17.92948237059265 23.355838959739934 34.98374593648413 4 28.60715178794699 26.081520380095025 18.629657414353588 26.6816704176044 5 28.68217054263566 28.532133033258315 20.7551887971993 22.030507626906726 6 22.58064516129032 31.532883220805203 24.781195298824706 21.10527631907977 7 20.855213803450862 24.056014003500874 33.633408352088026 21.45536384096024 8 21.380345086271568 21.680420105026258 30.03250812703176 26.906726681670417 9 19.30482620655164 20.705176294073517 32.55813953488372 27.431857964491122 10-11 24.218554638659665 28.319579894973746 22.605651412853213 24.85621405351338 12-13 25.893973493373345 21.780445111277817 23.74343585896474 28.582145536384097 14-15 24.031007751937985 24.06851712928232 25.993998499624904 25.906476619154787 16-17 24.381095273818453 24.031007751937985 23.99349837459365 27.59439859964991 18-19 25.018754688672168 23.643410852713178 24.306076519129782 27.031757939484873 20-21 25.481370342585645 23.69342335583896 24.69367341835459 26.131532883220803 22-23 25.64391097774444 24.706176544136035 23.593398349587396 26.056514128532132 24-25 25.656414103525883 23.243310827706924 24.268567141785446 26.831707926981746 26-27 25.168792198049513 25.28132033008252 22.755688922230558 26.79419854963741 28-29 25.04376094023506 23.93098274568642 23.868467116779193 27.156789197299325 30-31 24.518629657414355 24.118529632408105 24.081020255063766 27.28182045511378 32-33 24.756189047261813 24.76869217304326 23.818454613653415 26.65666416604151 34-35 24.10602650662666 24.831207801950487 24.33108277069267 26.731682920730183 36-37 25.218804701175294 23.143285821455365 24.431107776944234 27.206801700425103 38-39 24.702939337085677 24.11507191994997 24.40275171982489 26.779237023139462 40-41 25.42224446390592 23.99599649693482 23.895908920305267 26.685850118854 42-43 25.225225225225223 23.76126126126126 23.61111111111111 27.402402402402405 44-45 25.619524405506883 24.44305381727159 23.46683354192741 26.47058823529412 46-47 25.025050100200403 24.02304609218437 23.960420841683366 26.991482965931862 48-49 25.13469490038842 23.430647788497684 24.182433279037717 27.25222403207618 50-51 24.235205616850553 24.172517552657975 24.2728184553661 27.31945837512538 52-53 25.981683603061096 23.058587379249783 23.20913310751474 27.75059591017438 54-55 24.789652141152832 23.006404621373854 24.262212733894263 27.941730503579056 56-57 24.990562476406193 23.89580973952435 22.97722410972694 28.13640367434252 58-59 24.848790322580644 23.840725806451612 24.634576612903224 26.67590725806452 60-61 25.576995838062803 23.34468407113129 23.357296002017907 27.721024088787992 62-63 24.788483394367976 24.28336911226165 24.333880540472283 26.594266952898092 64-65 26.017699115044245 22.869785082174463 23.653603034134008 27.45891276864728 66-67 25.829744109450214 22.472764124651633 23.853559665568785 27.843932100329365 68-69 25.99796592931604 22.972285786931096 23.595219933892704 27.43452834986016 70-71 26.33324827762184 22.62056647103853 24.151569277877012 26.894615973462617 72-73 26.193531827515397 23.267453798767967 23.113449691991786 27.425564681724847 74-75 26.035583322015484 21.11910905880755 24.826836887138395 28.01847073203857 76 28.370890284447732 0.0 32.803841891392686 38.82526782415959 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.5 19 5.5 20 7.5 21 9.5 22 9.0 23 7.0 24 5.0 25 5.0 26 11.5 27 16.0 28 14.5 29 19.0 30 23.0 31 24.0 32 30.5 33 35.5 34 45.0 35 64.5 36 70.5 37 73.5 38 100.0 39 123.0 40 136.0 41 146.0 42 151.5 43 162.0 44 168.0 45 173.0 46 184.5 47 168.5 48 167.5 49 180.0 50 156.0 51 144.0 52 140.0 53 137.0 54 140.0 55 125.5 56 122.0 57 120.0 58 112.0 59 144.5 60 158.5 61 134.5 62 124.5 63 115.5 64 109.0 65 113.0 66 107.5 67 93.5 68 81.0 69 77.5 70 61.5 71 47.0 72 57.0 73 55.5 74 45.5 75 42.0 76 35.0 77 25.5 78 19.5 79 18.0 80 17.5 81 12.0 82 7.5 83 7.5 84 5.5 85 2.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 1.0 38 1.0 39 0.0 40 1.0 41 0.0 42 0.0 43 1.0 44 0.0 45 3.0 46 0.0 47 1.0 48 1.0 49 2.0 50 0.0 51 2.0 52 1.0 53 2.0 54 3.0 55 5.0 56 3.0 57 4.0 58 0.0 59 3.0 60 1.0 61 3.0 62 3.0 63 2.0 64 2.0 65 4.0 66 6.0 67 8.0 68 6.0 69 7.0 70 8.0 71 11.0 72 16.0 73 62.0 74 289.0 75 830.0 76 2707.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.46782431052094 96.39999999999999 2 1.0725229826353422 2.1 3 0.40858018386108275 1.2 4 0.02553626149131767 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02553626149131767 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.025 0.0 0.0 32 0.0 0.0 0.025 0.0 0.0 33 0.0 0.0 0.025 0.0 0.0 34 0.0 0.0 0.025 0.0 0.0 35 0.0 0.0 0.025 0.0 0.0 36 0.0 0.0 0.025 0.0 0.0 37 0.0 0.0 0.025 0.0 0.0 38 0.0 0.0 0.025 0.0 0.0 39 0.0 0.0 0.025 0.0 0.0 40 0.0 0.0 0.025 0.0 0.0 41 0.0 0.0 0.025 0.0 0.0 42 0.0 0.0 0.025 0.0 0.0 43 0.0 0.0 0.025 0.0 0.0 44 0.0 0.0 0.025 0.0 0.0 45 0.0 0.0 0.025 0.0 0.0 46 0.0 0.0 0.025 0.0 0.0 47 0.0 0.0 0.025 0.0 0.0 48 0.0 0.0 0.025 0.0 0.0 49 0.0 0.0 0.025 0.0 0.0 50 0.0 0.0 0.025 0.0 0.0 51 0.0 0.0 0.025 0.0 0.0 52 0.0 0.0 0.025 0.0 0.0 53 0.0 0.0 0.025 0.0 0.0 54 0.0 0.0 0.025 0.0 0.0 55 0.0 0.0 0.025 0.0 0.0 56 0.0 0.0 0.025 0.0 0.0 57 0.0 0.0 0.025 0.0 0.0 58 0.0 0.0 0.025 0.0 0.0 59 0.0 0.0 0.025 0.0 0.0 60 0.0 0.0 0.025 0.0 0.0 61 0.0 0.0 0.025 0.0 0.0 62 0.0 0.0 0.025 0.0 0.0 63 0.0 0.0 0.025 0.0 0.0 64 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389828 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.567 32.0 32.0 32.0 32.0 32.0 2 29.998 32.0 32.0 32.0 21.0 32.0 3 30.062 32.0 32.0 32.0 21.0 32.0 4 29.979 32.0 32.0 32.0 21.0 32.0 5 30.05825 32.0 32.0 32.0 21.0 32.0 6 33.04425 36.0 36.0 36.0 21.0 36.0 7 33.083 36.0 36.0 36.0 21.0 36.0 8 33.1095 36.0 36.0 36.0 21.0 36.0 9 33.372 36.0 36.0 36.0 21.0 36.0 10-11 33.03775 36.0 36.0 36.0 21.0 36.0 12-13 33.189 36.0 36.0 36.0 21.0 36.0 14-15 33.058 36.0 36.0 36.0 21.0 36.0 16-17 33.10575 36.0 36.0 36.0 21.0 36.0 18-19 32.976124999999996 36.0 36.0 36.0 17.5 36.0 20-21 32.652249999999995 36.0 36.0 36.0 14.0 36.0 22-23 32.991375 36.0 36.0 36.0 17.5 36.0 24-25 32.90575 36.0 36.0 36.0 21.0 36.0 26-27 32.6725 36.0 36.0 36.0 14.0 36.0 28-29 32.5895 36.0 34.0 36.0 14.0 36.0 30-31 32.687875 36.0 36.0 36.0 14.0 36.0 32-33 32.619875 36.0 34.0 36.0 14.0 36.0 34-35 32.517375 36.0 34.0 36.0 14.0 36.0 36-37 32.5336253523827 36.0 32.0 36.0 14.0 36.0 38-39 32.61150087697319 36.0 36.0 36.0 14.0 36.0 40-41 32.54679231277894 36.0 36.0 36.0 14.0 36.0 42-43 32.52727594870858 36.0 34.0 36.0 14.0 36.0 44-45 32.40082748244734 36.0 32.0 36.0 14.0 36.0 46-47 32.08456712672522 36.0 32.0 36.0 14.0 36.0 48-49 32.47533427080151 36.0 32.0 36.0 14.0 36.0 50-51 32.392866114041695 36.0 32.0 36.0 14.0 36.0 52-53 32.21943878691435 36.0 32.0 36.0 14.0 36.0 54-55 32.24517457754328 36.0 32.0 36.0 14.0 36.0 56-57 32.25972076740024 36.0 32.0 36.0 14.0 36.0 58-59 32.0047967684928 36.0 32.0 36.0 14.0 36.0 60-61 32.13673111400749 36.0 32.0 36.0 14.0 36.0 62-63 31.75902173321336 36.0 32.0 36.0 14.0 36.0 64-65 31.63700325253847 36.0 32.0 36.0 14.0 36.0 66-67 31.539329714399262 36.0 32.0 36.0 14.0 36.0 68-69 31.448112525803978 36.0 32.0 36.0 14.0 36.0 70-71 31.73191333426862 36.0 32.0 36.0 14.0 36.0 72-73 31.358151803745457 36.0 32.0 36.0 14.0 36.0 74-75 31.436663619444467 36.0 32.0 36.0 14.0 36.0 76 30.933893352812273 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 3.0 17 3.0 18 8.0 19 5.0 20 9.0 21 9.0 22 9.0 23 26.0 24 35.0 25 64.0 26 76.0 27 109.0 28 159.0 29 186.0 30 296.0 31 405.0 32 466.0 33 686.0 34 911.0 35 520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.952380952380953 18.99749373433584 10.300751879699249 39.74937343358396 2 28.879418400601654 23.539734269240412 28.22762597142141 19.353221358736526 3 25.444527923866765 25.544703230653642 19.509140996744303 29.501627848735286 4 28.775356874530427 30.77886301026797 16.979714500375657 23.466065614825947 5 30.428249436513898 32.15627347858753 18.632607062359128 18.782870022539445 6 24.9749498997996 32.43987975951904 20.165330661322646 22.419839679358716 7 22.45614035087719 16.090225563909772 34.56140350877193 26.8922305764411 8 23.572144288577153 21.56813627254509 24.32364729458918 30.53607214428858 9 22.826359308444 20.596341768980206 28.46404409922325 28.113254823352545 10-11 27.50752256770311 27.16900702106319 19.320461384152456 26.00300902708124 12-13 28.533768516193824 20.26110971629425 22.809440120512175 28.395681646999748 14-15 25.847351242781823 23.87647501883003 23.550087873462214 26.726085864925935 16-17 28.21477857232468 22.519131852967007 21.82913059841927 27.43695897628905 18-19 27.173503951825367 23.18404215280391 22.995859992472713 26.646593902898 20-21 26.76374592016068 23.96434848104444 22.62113984433844 26.65076575445644 22-23 26.572109953558424 24.56382578134806 22.24174720722982 26.622317057863686 24-25 27.05616850551655 23.783851554663993 22.63039117352056 26.529588766298893 26-27 27.160958474469954 24.3884079789236 22.481495420900764 25.969138125705683 28-29 27.81473578511359 23.045060876113972 23.471821262708673 25.66838207606376 30-31 26.684230334964244 23.472588131978423 23.02095094718354 26.82223058587379 32-33 26.3481314271382 24.47955856533735 22.93704539754201 26.235264609982444 34-35 27.501881113619262 23.940305994482067 22.385252069224983 26.17256082267369 36-37 27.000250815149236 23.890142964635064 22.121896162528216 26.987710057687487 38-39 26.76621909900866 24.64550131760572 22.8761450621157 25.71213452126992 40-41 27.154145240185628 24.19415527404992 22.638906308792173 26.01279317697228 42-43 26.806322127446062 23.808329152032112 23.0431510286001 26.342197691921726 44-45 27.114178168130486 23.651191969887076 23.136762860727732 26.097867001254706 46-47 27.84476262245667 24.101984426023613 22.05476011052499 25.998492840994725 48-49 27.811989443257506 23.212265929370364 22.25713208495664 26.71861254241548 50-51 27.49339705697397 22.76443214689976 23.292667588982518 26.449503207143753 52-53 27.791750503018108 23.46579476861167 22.572937625754527 26.169517102615693 54-55 27.064451158106746 24.08106747230614 22.255790533736153 26.59869083585096 56-57 25.718970736629664 24.104439959636732 23.83955600403633 26.337033299697275 58-59 27.44379893912604 23.51603940388987 22.78353119474615 26.25663046223794 60-61 27.373877860665065 23.2393475787078 22.83474522695663 26.5520293336705 62-63 27.298050139275766 22.8285641934667 23.38566725753355 26.487718409723982 64-65 27.39257193560654 23.386994549372545 22.081379135505134 27.13905437951578 66-67 27.40091463414634 23.84400406504065 23.069105691056908 25.685975609756095 68-69 27.322543647253728 23.486682808716708 23.09162737351854 26.099146170511023 70-71 27.588851956021475 22.922526208130915 22.948095116338532 26.540526719509078 72-73 27.60262514476901 23.510487710719342 22.53249260069489 26.354394543816756 74-75 27.583865272307484 20.793154964009236 24.555208474806463 27.06777128887682 76 30.434782608695656 0.0 32.22506393861892 37.34015345268542 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 6.5 20 5.0 21 3.0 22 3.5 23 4.5 24 6.5 25 8.5 26 8.5 27 8.0 28 11.5 29 14.0 30 16.5 31 21.5 32 23.5 33 28.0 34 39.0 35 56.0 36 63.5 37 59.0 38 73.5 39 106.0 40 137.0 41 149.5 42 156.5 43 163.5 44 150.5 45 149.5 46 166.5 47 166.0 48 167.0 49 174.0 50 164.5 51 148.5 52 135.0 53 140.0 54 145.0 55 132.5 56 120.5 57 122.5 58 129.5 59 153.5 60 172.5 61 146.5 62 126.5 63 123.0 64 109.5 65 100.0 66 104.5 67 111.0 68 102.0 69 90.5 70 78.0 71 70.0 72 71.5 73 68.5 74 61.0 75 55.0 76 48.5 77 34.5 78 25.0 79 21.5 80 16.5 81 13.5 82 8.0 83 2.5 84 3.0 85 2.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.5 91 1.5 92 2.0 93 1.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.27499999999999997 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.2 7 0.25 8 0.2 9 0.22499999999999998 10-11 0.3 12-13 0.42500000000000004 14-15 0.42500000000000004 16-17 0.36250000000000004 18-19 0.36250000000000004 20-21 0.42500000000000004 22-23 0.41250000000000003 24-25 0.3 26-27 0.36250000000000004 28-29 0.41250000000000003 30-31 0.36250000000000004 32-33 0.325 34-35 0.325 36-37 0.1377582968065122 38-39 0.16286644951140067 40-41 0.10023806540533768 42-43 0.08773029201654342 44-45 0.07522567703109327 46-47 0.10037641154328732 48-49 0.12551776076314797 50-51 0.13815624215021352 52-53 0.06283775292195551 54-55 0.0629009938357026 56-57 0.06302785831337451 58-59 0.050492299924261554 60-61 0.0631791761435431 62-63 0.06326711375427053 64-65 0.03801317790167258 66-67 0.025400050800101596 68-69 0.025480952987641737 70-71 0.025562372188139063 72-73 0.025730091341824263 74-75 0.027155465037338764 76 0.03652300949598247 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 1.0 37 1.0 38 0.0 39 0.0 40 1.0 41 0.0 42 1.0 43 1.0 44 0.0 45 3.0 46 0.0 47 1.0 48 1.0 49 2.0 50 0.0 51 2.0 52 1.0 53 2.0 54 3.0 55 5.0 56 3.0 57 4.0 58 0.0 59 3.0 60 2.0 61 3.0 62 3.0 63 3.0 64 2.0 65 5.0 66 6.0 67 7.0 68 5.0 69 5.0 70 10.0 71 11.0 72 19.0 73 76.0 74 237.0 75 826.0 76 2738.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31632653061224 96.35000000000001 2 1.4285714285714286 2.8000000000000003 3 0.2295918367346939 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025510204081632654 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676538 spots for SRR11389828.sra Written 676538 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra Read 676523 spots for SRR11389828.sra Written 676523 spots for SRR11389828.sra SRR ids: ['SRR11389828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6neh2rh SRR11389828.sra spots: 13530475 blocks: [[1, 676523], [676524, 1353046], [1353047, 2029569], [2029570, 2706092], [2706093, 3382615], [3382616, 4059138], [4059139, 4735661], [4735662, 5412184], [5412185, 6088707], [6088708, 6765230], [6765231, 7441753], [7441754, 8118276], [8118277, 8794799], [8794800, 9471322], [9471323, 10147845], [10147846, 10824368], [10824369, 11500891], [11500892, 12177414], [12177415, 12853937], [12853938, 13530475]] SRR11389828 file size 2561097 SRR11389828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389828 SRR11389828_1.fastq SRR11389828_2.fastq Input file: SRR11389828_1.fastq Paired file: SRR11389828_2.fastq trimmed: SRR11389828-trimmed-pair1.fastq, SRR11389828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:37:22 2024 >> started Sat Dec 7 07:37:34 2024 >> done (11.274s) 13530475 read pairs processed; of these: 549 ( 0.00%) short read pairs filtered out after trimming by size control 17249 ( 0.13%) empty read pairs filtered out after trimming by size control 13512677 (99.87%) read pairs available; of these: 28142 ( 0.21%) trimmed read pairs available after processing 13484535 (99.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 4 0.00% 30 1 0.00% 31 3 0.00% 32 7 0.00% 33 6 0.00% 34 5 0.00% 35 779 0.01% 36 924 0.01% 37 1094 0.01% 38 1210 0.01% 39 1521 0.01% 40 1852 0.01% 41 2153 0.02% 42 2436 0.02% 43 2751 0.02% 44 3052 0.02% 45 3145 0.02% 46 3511 0.03% 47 3912 0.03% 48 4181 0.03% 49 4492 0.03% 50 5022 0.04% 51 5657 0.04% 52 6237 0.05% 53 6689 0.05% 54 7213 0.05% 55 7806 0.06% 56 8315 0.06% 57 9011 0.07% 58 9526 0.07% 59 10625 0.08% 60 11026 0.08% 61 11761 0.09% 62 12460 0.09% 63 13591 0.10% 64 14599 0.11% 65 15290 0.11% 66 16708 0.12% 67 17615 0.13% 68 17322 0.13% 69 18409 0.14% 70 19560 0.14% 71 23402 0.17% 72 32264 0.24% 73 124959 0.92% 74 908030 6.72% 75 5718684 42.32% 76 6423840 47.54% 13512677 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.56 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=8.81 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.8 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.44 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.17 sequence-density-rank=22 fanout-score=89.55 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=14.5 sequence=GCCGCCGCCGCC SRR11389828 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:38:13 Started mapping on | Dec 07 07:38:13 Finished on | Dec 07 07:39:22 Mapping speed, Million of reads per hour | 705.01 Number of input reads | 13512677 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11547480 Uniquely mapped reads % | 85.46% Average mapped length | 149.54 Number of splices: Total | 4709920 Number of splices: Annotated (sjdb) | 4493289 Number of splices: GT/AG | 4647762 Number of splices: GC/AG | 54276 Number of splices: AT/AC | 1458 Number of splices: Non-canonical | 6424 Mismatch rate per base, % | 1.08% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1134158 % of reads mapped to multiple loci | 8.39% Number of reads mapped to too many loci | 62391 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 2.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831040 831040 831040 N_multimapping 1134158 1134158 1134158 N_noFeature 400258 11176090 568699 N_ambiguous 280449 1906 82095 UnstrandedReadsAssigned:10866773 PositiveStrandReadsAssigned:369484 NegativeStrandReadsAssigned:10896686 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389828-trimmed-pair1.fastq SRR11389828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,512,677 reads, 11,792,892 reads pseudoaligned [quant] estimated average fragment length: 176.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 SRR11389828.ke.tsv 35125 SRR11389828.se.tsv 88098 total ==> SRR11389828.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.557 0 0 PNS24247 1044 868.477 15.7426 2.11457 PNS24249 1928 1752.48 45.5875 3.03457 PNS24246 1044 868.477 15.7426 2.11457 PNS24248 1044 868.477 15.7426 2.11457 PNS24244 1471 1295.48 13.1846 1.18724 PNS24243 293 129.535 0 0 KQK14069 1603 1427.48 34.6968 2.83546 KQK14071 474 300.026 1.30322 0.506714 ==> SRR11389828.se.tsv <== BRADI_1g14170v3 37 BRADI_1g53295v3 9 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 100 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR11389828 completed mapping pipeline successfully