Starting /dee2/code/volunteer_pipeline.sh SRR11389829 current disk space = 1544427167744 free memory = 1598856068 SRR11389829 SRAfilesize 55ee7ec62d1040f96c20c0d9f8f237d6 SRR11389829.sra SRR11389829.sra file validated SRR11389829 is paired end SRR11389829 is conventional basespace SRR11389829 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.03425 32.0 32.0 32.0 32.0 32.0 2 30.0405 32.0 32.0 32.0 32.0 32.0 3 30.0425 32.0 32.0 32.0 32.0 32.0 4 30.11425 32.0 32.0 32.0 32.0 32.0 5 30.13125 32.0 32.0 32.0 32.0 32.0 6 32.79225 36.0 36.0 36.0 21.0 36.0 7 32.8015 36.0 36.0 36.0 21.0 36.0 8 32.98425 36.0 36.0 36.0 21.0 36.0 9 32.9715 36.0 36.0 36.0 21.0 36.0 10-11 32.913625 36.0 36.0 36.0 21.0 36.0 12-13 33.0215 36.0 36.0 36.0 26.5 36.0 14-15 32.98925 36.0 36.0 36.0 21.0 36.0 16-17 32.86225 36.0 36.0 36.0 21.0 36.0 18-19 32.846125 36.0 36.0 36.0 21.0 36.0 20-21 32.719375 36.0 36.0 36.0 21.0 36.0 22-23 32.689625 36.0 36.0 36.0 17.5 36.0 24-25 32.610375000000005 36.0 36.0 36.0 14.0 36.0 26-27 32.56075 36.0 36.0 36.0 21.0 36.0 28-29 32.622125 36.0 36.0 36.0 17.5 36.0 30-31 32.448750000000004 36.0 36.0 36.0 17.5 36.0 32-33 32.347 36.0 36.0 36.0 14.0 36.0 34-35 32.375875 36.0 36.0 36.0 17.5 36.0 36-37 33.45613807422788 36.0 36.0 36.0 27.0 36.0 38-39 33.3053464832598 36.0 36.0 36.0 21.0 36.0 40-41 33.238836967808936 36.0 36.0 36.0 20.5 36.0 42-43 33.203805643564024 36.0 36.0 36.0 17.5 36.0 44-45 33.1240000848462 36.0 36.0 36.0 17.5 36.0 46-47 33.122693007538345 36.0 36.0 36.0 17.5 36.0 48-49 33.1296488946684 36.0 36.0 36.0 21.0 36.0 50-51 32.98126463700234 36.0 36.0 36.0 17.5 36.0 52-53 33.124348958333336 36.0 36.0 36.0 17.5 36.0 54-55 33.06541110573754 36.0 36.0 36.0 14.0 36.0 56-57 32.886007082334174 36.0 36.0 36.0 14.0 36.0 58-59 32.75069124832257 36.0 34.0 36.0 14.0 36.0 60-61 32.72358812470721 36.0 36.0 36.0 14.0 36.0 62-63 32.58172658543152 36.0 36.0 36.0 14.0 36.0 64-65 32.7587893567288 36.0 34.0 36.0 14.0 36.0 66-67 32.790013958369556 36.0 34.0 36.0 14.0 36.0 68-69 32.56115335957776 36.0 32.0 36.0 14.0 36.0 70-71 32.5306067964533 36.0 32.0 36.0 14.0 36.0 72-73 32.430238796851725 36.0 32.0 36.0 14.0 36.0 74-75 32.40074213365493 36.0 34.0 36.0 14.0 36.0 76 32.19633307868602 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 147.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 6.0 24 8.0 25 20.0 26 36.0 27 52.0 28 89.0 29 164.0 30 229.0 31 291.0 32 459.0 33 712.0 34 1056.0 35 730.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.14767713470023 12.639501686997146 10.044121463794447 50.16869971450818 2 22.086685699454968 14.222683623150791 39.553594601609134 24.137036075785105 3 20.659226576693484 19.724889696340515 23.410329613288347 36.20555411367765 4 26.0576174409551 26.39501686997145 18.53101479366727 29.01635089540618 5 26.60264728782767 29.924733973527122 22.294316117311187 21.178302621334026 6 23.56605242668051 31.014793667272254 23.38437581105632 22.034778094990916 7 19.33558266286011 23.228652997664156 36.77653776278225 20.659226576693484 8 20.218011938749026 23.176745393200104 29.66519595120685 26.94004671684402 9 19.30962886062808 20.088242927588894 33.50635868154684 27.09576953023618 10-11 25.110303659486117 28.315598235141447 22.359200622891255 24.214897482481184 12-13 25.08434985725409 22.372177524007267 24.708019724889695 27.83545289384895 14-15 24.57825071372956 24.357643394757332 25.629379704126652 25.434726187386453 16-17 25.032442252790034 23.462237217752403 24.708019724889695 26.79730080456787 18-19 23.604983130028547 24.772904230469763 24.967557747209966 26.65455489229172 20-21 24.552296911497535 24.27978198806125 25.90189462756294 25.266026472878277 22-23 24.370620295873348 25.83701012198287 24.09810537243706 25.694264209706724 24-25 24.00726706462497 25.33091097845834 24.331689592525304 26.330132364391385 26-27 25.12328056060213 24.474435504801452 24.370620295873348 26.031663638723074 28-29 24.95458084609395 25.36984168180638 24.448481702569428 25.227095769530237 30-31 23.9423825590449 24.357643394757332 24.708019724889695 26.99195432130807 32-33 24.370620295873348 24.266805086945237 25.045419153906046 26.31715546327537 34-35 24.214897482481184 24.66908902154166 24.30573579029328 26.810277705683884 36-37 24.82481183493382 23.254606799896184 25.240072670646253 26.68050869452375 38-39 24.643135219309627 24.396574098105372 24.396574098105372 26.563716584479625 40-41 25.064901349948077 24.221183800623052 23.779854620976117 26.93406022845275 42-43 24.431744382387325 23.39264839589557 25.19807767242499 26.977529549292118 44-45 24.301494476933073 24.782326185834957 24.74333983105913 26.172839506172842 46-47 25.032492851572652 24.213672991941774 24.382635820119575 26.371198336365996 48-49 24.915474642392716 24.22626788036411 24.746423927178153 26.111833550065022 50-51 24.48607858443924 24.6031746031746 24.395003903200625 26.51574290918553 52-53 24.778645833333332 23.606770833333332 24.544270833333336 27.0703125 54-55 25.14657980456026 23.856677524429966 24.3257328990228 26.67100977198697 56-57 24.49458719186122 25.19890439546107 24.338072257727923 25.968436154949785 58-59 24.61819605795588 23.756689727189663 24.944524213549148 26.68059000130531 60-61 24.729076902989945 24.206815511163338 25.133829481655567 25.930278104191146 62-63 24.617796942375538 24.95753299359728 24.93139945119561 25.49327061283157 64-65 25.408870862226873 24.401413057699855 23.864974486458195 26.324741593615077 66-67 24.82632061869183 23.764582514090968 24.4199764058199 26.9891204613973 68-69 25.35451680672269 24.514180672268907 23.660714285714285 26.47058823529412 70-71 25.194257869089952 23.90359541683129 24.008955617015673 26.893191097063085 72-73 25.344097406034937 22.869242985706723 23.888300688194814 27.898358920063526 74-75 25.420639371845205 21.45260796410544 25.042063937184523 28.084688726864837 76 28.07486631016043 0.0 33.84262796027502 38.08250572956455 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 147.0 1 73.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.5 20 6.5 21 9.5 22 8.5 23 6.0 24 8.0 25 12.0 26 7.5 27 9.5 28 17.5 29 15.5 30 18.5 31 31.5 32 37.5 33 36.0 34 45.0 35 65.0 36 75.5 37 80.5 38 96.0 39 120.5 40 140.0 41 148.5 42 164.5 43 199.5 44 213.0 45 201.5 46 198.0 47 199.0 48 190.0 49 179.5 50 179.0 51 166.0 52 149.0 53 119.5 54 99.5 55 112.5 56 109.0 57 99.5 58 101.0 59 108.5 60 116.0 61 109.5 62 95.0 63 85.5 64 94.5 65 100.0 66 87.0 67 79.0 68 79.0 69 67.5 70 58.5 71 59.5 72 55.0 73 49.0 74 38.0 75 32.5 76 25.5 77 16.0 78 15.5 79 15.0 80 13.5 81 9.5 82 5.0 83 2.5 84 2.0 85 1.0 86 0.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 3.675 3 3.675 4 3.675 5 3.675 6 3.675 7 3.675 8 3.675 9 3.675 10-11 3.675 12-13 3.675 14-15 3.675 16-17 3.675 18-19 3.675 20-21 3.675 22-23 3.675 24-25 3.675 26-27 3.675 28-29 3.675 30-31 3.675 32-33 3.675 34-35 3.675 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 147.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 2.0 42 1.0 43 1.0 44 1.0 45 0.0 46 0.0 47 2.0 48 0.0 49 2.0 50 0.0 51 3.0 52 0.0 53 2.0 54 1.0 55 2.0 56 3.0 57 1.0 58 1.0 59 0.0 60 1.0 61 2.0 62 1.0 63 2.0 64 5.0 65 4.0 66 1.0 67 3.0 68 6.0 69 5.0 70 7.0 71 7.0 72 16.0 73 73.0 74 262.0 75 817.0 76 2618.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8702049395691 94.075 2 0.9721492380451918 1.8499999999999999 3 0.10509721492380451 0.3 4 0.02627430373095113 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02627430373095113 3.675 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 147 3.675 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389829 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.54275 32.0 32.0 32.0 21.0 32.0 2 29.296 32.0 32.0 32.0 14.0 32.0 3 29.26275 32.0 32.0 32.0 14.0 32.0 4 29.23025 32.0 32.0 32.0 14.0 32.0 5 29.24375 32.0 32.0 32.0 14.0 32.0 6 32.23975 36.0 36.0 36.0 14.0 36.0 7 32.553 36.0 36.0 36.0 14.0 36.0 8 32.62025 36.0 36.0 36.0 21.0 36.0 9 32.47725 36.0 36.0 36.0 14.0 36.0 10-11 32.092124999999996 36.0 36.0 36.0 14.0 36.0 12-13 32.3825 36.0 36.0 36.0 14.0 36.0 14-15 32.21925 36.0 36.0 36.0 14.0 36.0 16-17 32.326875 36.0 36.0 36.0 14.0 36.0 18-19 32.157250000000005 36.0 36.0 36.0 14.0 36.0 20-21 32.066500000000005 36.0 36.0 36.0 14.0 36.0 22-23 32.19475 36.0 36.0 36.0 14.0 36.0 24-25 32.068375 36.0 34.0 36.0 14.0 36.0 26-27 31.9325 36.0 36.0 36.0 14.0 36.0 28-29 31.898125 36.0 36.0 36.0 14.0 36.0 30-31 31.861625 36.0 36.0 36.0 14.0 36.0 32-33 31.980249999999998 36.0 34.0 36.0 14.0 36.0 34-35 31.785875 36.0 32.0 36.0 14.0 36.0 36-37 32.936767613067275 36.0 36.0 36.0 14.0 36.0 38-39 32.72389610389611 36.0 36.0 36.0 14.0 36.0 40-41 32.96037931930371 36.0 36.0 36.0 14.0 36.0 42-43 32.70662124899345 36.0 36.0 36.0 14.0 36.0 44-45 32.75131639127534 36.0 36.0 36.0 14.0 36.0 46-47 32.60210718002081 36.0 34.0 36.0 14.0 36.0 48-49 32.845352772715444 36.0 36.0 36.0 14.0 36.0 50-51 32.74772076061474 36.0 36.0 36.0 14.0 36.0 52-53 32.619655891553705 36.0 36.0 36.0 14.0 36.0 54-55 32.59280677056901 36.0 34.0 36.0 14.0 36.0 56-57 32.598685324882226 36.0 34.0 36.0 14.0 36.0 58-59 32.424774735212196 36.0 32.0 36.0 14.0 36.0 60-61 32.408282160144395 36.0 32.0 36.0 14.0 36.0 62-63 32.10857073286505 36.0 32.0 36.0 14.0 36.0 64-65 32.089734310810094 36.0 32.0 36.0 14.0 36.0 66-67 31.94107776969055 36.0 32.0 36.0 14.0 36.0 68-69 31.962258716981548 36.0 32.0 36.0 14.0 36.0 70-71 32.16924082463027 36.0 32.0 36.0 14.0 36.0 72-73 31.863051500365586 36.0 32.0 36.0 14.0 36.0 74-75 31.84273586528849 36.0 32.0 36.0 14.0 36.0 76 31.643048640367674 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 149.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 1.0 18 2.0 19 3.0 20 8.0 21 12.0 22 13.0 23 21.0 24 35.0 25 51.0 26 58.0 27 79.0 28 115.0 29 167.0 30 264.0 31 297.0 32 489.0 33 609.0 34 921.0 35 698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.693845754349518 19.839002856400935 9.452090366138666 42.015061023110874 2 29.15042868277475 22.785138997142116 30.319563522992986 17.744868797090152 3 23.370553103090106 27.707089067774604 21.526876136068555 27.395481693066735 4 26.12308491300961 33.238119968839264 17.969358608153726 22.669436509997404 5 28.148532848610753 32.900545312905734 19.839002856400935 19.111918982082578 6 22.51363282264347 34.74422227992729 21.267203323811998 21.474941573617244 7 24.136139256949857 16.10808002078462 33.67108339828527 26.084697323980254 8 23.422487665541418 21.630745260971178 24.331342508439366 30.615424565048038 9 23.68831168831169 20.51948051948052 28.545454545454547 27.246753246753247 10-11 26.931079323797142 26.34590377113134 20.494148244473344 26.22886866059818 12-13 26.15825091098386 21.043727225403437 24.271212909942737 28.526808953669963 14-15 25.992450865547312 24.00104125992451 24.00104125992451 26.005466614603673 16-17 26.99362560166515 22.921816053076626 23.23403148172239 26.85052686353584 18-19 26.294561540463178 24.082747853239656 23.52328909705959 26.099401509237573 20-21 26.61374284226965 24.062988027069235 23.412285268089537 25.91098386257158 22-23 27.017178552837063 24.80478917230609 23.4903695991671 24.687662675689744 24-25 25.812743823146945 24.512353706111835 23.511053315994797 26.163849154746423 26-27 26.41779396462019 25.65036420395421 22.918834547346513 25.013007284079087 28-29 26.623292127521147 23.643461288223815 23.799609629147692 25.933636955107353 30-31 26.086390840489198 24.473067915690866 23.393182409575854 26.04735883424408 32-33 27.25380512553662 23.41615714843242 23.780408481852476 25.549629244178483 34-35 26.74645505398725 24.32678548198257 22.960842981657343 25.965916482372837 36-37 27.14620187304891 24.076482830385014 22.827783558792923 25.949531737773153 38-39 26.883539362394277 24.28106701366298 22.992843201040987 25.842550422901756 40-41 26.922576447625246 24.02081977878985 22.589459986987638 26.46714378659727 42-43 26.901041666666664 24.192708333333332 23.736979166666668 25.169270833333336 44-45 26.55985410967826 24.527810342581738 22.50879249706917 26.403543050670837 46-47 26.52768729641694 24.482084690553744 23.504885993485342 25.48534201954397 48-49 27.053455019556715 23.46805736636245 23.91134289439374 25.56714471968709 50-51 26.383089770354907 23.77348643006263 23.512526096033405 26.330897703549063 52-53 27.195615294271175 23.828787681064856 23.176301709513243 25.799295315150722 54-55 26.31578947368421 24.17395846937443 23.58626093770406 25.9239911192373 56-57 26.702391844203373 23.47405567899621 23.70931904326232 26.114233433538097 58-59 27.661522364635104 23.17551660999215 22.770075856657076 26.39288516871567 60-61 26.443251734520224 24.204738840162324 23.288388532530433 26.063620892787014 62-63 27.587110296044017 23.054755043227665 23.421535237097196 25.936599423631122 64-65 26.37031209021768 23.734592184631524 24.154209284028326 25.740886441122473 66-67 26.95137976346912 24.69119579500657 22.720105124835744 25.63731931668857 68-69 27.47006972766741 23.2074727009604 23.23378502828575 26.08867254308644 70-71 27.84893701307276 23.253664333817508 23.6762181434042 25.221180509705533 72-73 26.35566188197767 23.139287612971824 24.65443912812334 25.85061137692717 74-75 27.500000000000004 21.081460674157306 24.901685393258425 26.516853932584272 76 28.801225584067407 0.0 34.737648410570664 36.46112600536193 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 150.0 1 75.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.5 18 2.0 19 4.0 20 4.5 21 2.0 22 1.0 23 5.0 24 6.5 25 4.5 26 6.5 27 10.5 28 11.0 29 12.0 30 15.0 31 21.0 32 30.5 33 36.5 34 43.5 35 56.0 36 80.5 37 100.0 38 102.0 39 110.5 40 122.0 41 139.5 42 150.0 43 150.5 44 167.0 45 165.0 46 153.5 47 169.0 48 183.0 49 177.0 50 166.5 51 150.0 52 125.0 53 125.0 54 141.5 55 128.5 56 119.0 57 130.5 58 133.0 59 135.5 60 139.0 61 125.0 62 111.5 63 102.5 64 92.0 65 94.0 66 94.5 67 99.0 68 102.5 69 85.0 70 67.5 71 68.0 72 72.0 73 61.5 74 46.5 75 42.0 76 36.0 77 25.5 78 16.5 79 13.5 80 11.5 81 8.0 82 7.0 83 5.0 84 3.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 3.775 3 3.7249999999999996 4 3.7249999999999996 5 3.7249999999999996 6 3.7249999999999996 7 3.775 8 3.7249999999999996 9 3.75 10-11 3.875 12-13 3.95 14-15 3.9625 16-17 3.9125 18-19 3.925 20-21 3.95 22-23 3.95 24-25 3.875 26-27 3.9 28-29 3.9375 30-31 3.925 32-33 3.9125 34-35 3.9125 36-37 0.16880924555252563 38-39 0.19480519480519481 40-41 0.16887503247596777 42-43 0.1689847913687768 44-45 0.15606710885680844 46-47 0.16909469302809574 48-49 0.15620932048945588 50-51 0.18233915082052618 52-53 0.11730969760166841 54-55 0.1304291117777488 56-57 0.10445227836532185 58-59 0.09146739840585391 60-61 0.13073604392731075 62-63 0.11775480832133978 64-65 0.09170706144373117 66-67 0.10501443948542925 68-69 0.026305405760883863 70-71 0.0264026402640264 72-73 0.053134962805526036 74-75 0.02808199943836001 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 149.0 36 1.0 37 0.0 38 0.0 39 1.0 40 0.0 41 2.0 42 1.0 43 1.0 44 1.0 45 0.0 46 0.0 47 3.0 48 0.0 49 2.0 50 0.0 51 3.0 52 0.0 53 2.0 54 1.0 55 2.0 56 3.0 57 1.0 58 1.0 59 1.0 60 1.0 61 2.0 62 1.0 63 2.0 64 5.0 65 4.0 66 2.0 67 3.0 68 7.0 69 7.0 70 7.0 71 13.0 72 14.0 73 68.0 74 256.0 75 822.0 76 2611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5986250661026 93.22500000000001 2 1.110523532522475 2.1 3 0.13220518244315177 0.375 4 0.07932310946589106 0.3 5 0.026441036488630353 0.125 6 0.026441036488630353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026441036488630353 3.7249999999999996 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 149 3.7249999999999996 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596378 spots for SRR11389829.sra Written 596378 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra Read 596362 spots for SRR11389829.sra Written 596362 spots for SRR11389829.sra SRR ids: ['SRR11389829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjubb8fw SRR11389829.sra spots: 11927256 blocks: [[1, 596362], [596363, 1192724], [1192725, 1789086], [1789087, 2385448], [2385449, 2981810], [2981811, 3578172], [3578173, 4174534], [4174535, 4770896], [4770897, 5367258], [5367259, 5963620], [5963621, 6559982], [6559983, 7156344], [7156345, 7752706], [7752707, 8349068], [8349069, 8945430], [8945431, 9541792], [9541793, 10138154], [10138155, 10734516], [10734517, 11330878], [11330879, 11927256]] SRR11389829 file size 2215288 SRR11389829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389829 SRR11389829_1.fastq SRR11389829_2.fastq Input file: SRR11389829_1.fastq Paired file: SRR11389829_2.fastq trimmed: SRR11389829-trimmed-pair1.fastq, SRR11389829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:37:07 2024 >> started Sat Dec 7 07:37:16 2024 >> done (9.839s) 11927256 read pairs processed; of these: 712 ( 0.01%) short read pairs filtered out after trimming by size control 529868 ( 4.44%) empty read pairs filtered out after trimming by size control 11396676 (95.55%) read pairs available; of these: 14404 ( 0.13%) trimmed read pairs available after processing 11382272 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 589 0.01% 19 5 0.00% 20 689 0.01% 21 4 0.00% 22 868 0.01% 23 9 0.00% 24 1070 0.01% 25 11 0.00% 26 1205 0.01% 27 3 0.00% 28 1004 0.01% 29 7 0.00% 30 659 0.01% 31 6 0.00% 32 411 0.00% 33 9 0.00% 34 266 0.00% 35 766 0.01% 36 2121 0.02% 37 997 0.01% 38 1837 0.02% 39 1516 0.01% 40 2104 0.02% 41 2147 0.02% 42 2613 0.02% 43 2608 0.02% 44 3047 0.03% 45 3113 0.03% 46 3271 0.03% 47 3747 0.03% 48 4156 0.04% 49 4464 0.04% 50 4857 0.04% 51 5418 0.05% 52 5880 0.05% 53 6655 0.06% 54 7005 0.06% 55 7551 0.07% 56 8317 0.07% 57 8589 0.08% 58 9056 0.08% 59 9667 0.08% 60 10239 0.09% 61 10928 0.10% 62 11563 0.10% 63 12012 0.11% 64 12615 0.11% 65 13371 0.12% 66 14239 0.12% 67 15154 0.13% 68 15013 0.13% 69 15400 0.14% 70 16579 0.15% 71 19361 0.17% 72 27603 0.24% 73 110404 0.97% 74 775349 6.80% 75 4911198 43.09% 76 5287331 46.39% 11396676 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.50 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=52.83 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=10.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=18 prefix-density=0.39 prefix-fanout=2.7 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=90.42 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=14.4 sequence=GCCGCCGCCACCCT SRR11389829 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:37:49 Started mapping on | Dec 07 07:37:49 Finished on | Dec 07 07:38:47 Mapping speed, Million of reads per hour | 707.38 Number of input reads | 11396676 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9853926 Uniquely mapped reads % | 86.46% Average mapped length | 149.52 Number of splices: Total | 4196115 Number of splices: Annotated (sjdb) | 3993948 Number of splices: GT/AG | 4139749 Number of splices: GC/AG | 49218 Number of splices: AT/AC | 1382 Number of splices: Non-canonical | 5766 Mismatch rate per base, % | 0.98% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1002050 % of reads mapped to multiple loci | 8.79% Number of reads mapped to too many loci | 50333 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 540700 540700 540700 N_multimapping 1002050 1002050 1002050 N_noFeature 371458 9526722 515221 N_ambiguous 246847 1657 68387 UnstrandedReadsAssigned:9235621 PositiveStrandReadsAssigned:325547 NegativeStrandReadsAssigned:9270318 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389829-trimmed-pair1.fastq SRR11389829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,396,676 reads, 10,041,605 reads pseudoaligned [quant] estimated average fragment length: 179.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR11389829.ke.tsv 35125 SRR11389829.se.tsv 88098 total ==> SRR11389829.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.11 0 0 PNS24247 1044 865.967 2.65357 0.431917 PNS24249 1928 1749.97 89.222 7.18644 PNS24246 1044 865.967 2.65357 0.431917 PNS24248 1044 865.967 2.65357 0.431917 PNS24244 1471 1292.97 17.8173 1.94234 PNS24243 293 128.522 0 0 KQK14069 1603 1424.97 292.674 28.9501 KQK14071 474 297.889 14.805 7.00527 ==> SRR11389829.se.tsv <== BRADI_1g14170v3 331 BRADI_1g53295v3 19 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 93 BRADI_1g74790v3 95 BRADI_1g09890v3 0 BRADI_1g77505v3 130 BRADI_1g48960v3 0 SRR11389829 completed mapping pipeline successfully