Starting /dee2/code/volunteer_pipeline.sh SRR11389830 current disk space = 1544411209728 free memory = 1604434340 SRR11389830 SRAfilesize 231954cefc0b811a461701f2191a0356 SRR11389830.sra SRR11389830.sra file validated SRR11389830 is paired end SRR11389830 is conventional basespace SRR11389830 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.743 32.0 32.0 32.0 2.0 32.0 2 25.797 32.0 32.0 32.0 2.0 32.0 3 25.8545 32.0 32.0 32.0 2.0 32.0 4 25.852 32.0 32.0 32.0 2.0 32.0 5 25.8335 32.0 32.0 32.0 2.0 32.0 6 28.28975 36.0 32.0 36.0 2.0 36.0 7 28.1835 36.0 32.0 36.0 2.0 36.0 8 28.124 36.0 32.0 36.0 2.0 36.0 9 28.23425 36.0 32.0 36.0 2.0 36.0 10-11 28.174875 36.0 26.5 36.0 2.0 36.0 12-13 28.27975 36.0 32.0 36.0 2.0 36.0 14-15 28.159625 36.0 26.5 36.0 2.0 36.0 16-17 28.215625000000003 36.0 29.5 36.0 2.0 36.0 18-19 28.200375 36.0 26.5 36.0 2.0 36.0 20-21 28.158375 36.0 26.5 36.0 2.0 36.0 22-23 27.975749999999998 36.0 21.0 36.0 2.0 36.0 24-25 27.916375000000002 36.0 21.0 36.0 2.0 36.0 26-27 27.801875000000003 36.0 21.0 36.0 2.0 36.0 28-29 27.818624999999997 36.0 21.0 36.0 2.0 36.0 30-31 27.61425 36.0 17.5 36.0 2.0 36.0 32-33 27.486 36.0 14.0 36.0 2.0 36.0 34-35 27.569625000000002 36.0 17.5 36.0 2.0 36.0 36-37 33.16550337964016 36.0 36.0 36.0 21.0 36.0 38-39 33.10682583409856 36.0 36.0 36.0 21.0 36.0 40-41 33.03213957759412 36.0 36.0 36.0 14.0 36.0 42-43 33.17508417508418 36.0 36.0 36.0 17.5 36.0 44-45 32.839608203244566 36.0 36.0 36.0 14.0 36.0 46-47 32.832856998795314 36.0 36.0 36.0 14.0 36.0 48-49 32.716079632465544 36.0 36.0 36.0 14.0 36.0 50-51 32.70532511147644 36.0 36.0 36.0 14.0 36.0 52-53 32.721200980392155 36.0 36.0 36.0 14.0 36.0 54-55 32.66441924609255 36.0 34.0 36.0 14.0 36.0 56-57 32.590560833588725 36.0 32.0 36.0 14.0 36.0 58-59 32.410358565737056 36.0 32.0 36.0 14.0 36.0 60-61 32.30784554091327 36.0 32.0 36.0 14.0 36.0 62-63 32.449892736745326 36.0 34.0 36.0 14.0 36.0 64-65 32.42379248133783 36.0 32.0 36.0 14.0 36.0 66-67 32.1617790564451 36.0 32.0 36.0 14.0 36.0 68-69 32.263351749539595 36.0 32.0 36.0 14.0 36.0 70-71 32.12164006801103 36.0 32.0 36.0 14.0 36.0 72-73 32.085939476045944 36.0 32.0 36.0 14.0 36.0 74-75 32.07918381691785 36.0 32.0 36.0 14.0 36.0 76 31.79268292682927 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 730.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 11.0 22 19.0 23 30.0 24 27.0 25 30.0 26 29.0 27 53.0 28 92.0 29 116.0 30 156.0 31 227.0 32 357.0 33 580.0 34 883.0 35 657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.678899082568808 13.241590214067278 8.623853211009175 53.45565749235474 2 21.773700305810397 14.434250764525993 40.0611620795107 23.730886850152906 3 19.755351681957187 22.201834862385322 23.24159021406728 34.801223241590215 4 26.299694189602445 26.085626911314986 21.039755351681958 26.574923547400616 5 26.972477064220186 30.0 23.700305810397555 19.327217125382262 6 21.07033639143731 30.85626911314985 26.941896024464835 21.131498470948014 7 19.755351681957187 25.504587155963304 34.281345565749234 20.458715596330276 8 19.571865443425075 21.712538226299692 34.25076452599388 24.464831804281346 9 18.654434250764528 19.724770642201836 35.137614678899084 26.483180428134556 10-11 22.889908256880734 27.996941896024463 23.37920489296636 25.73394495412844 12-13 23.516819571865444 23.058103975535168 25.626911314984707 27.798165137614678 14-15 22.90519877675841 24.60244648318043 27.033639143730888 25.458715596330272 16-17 24.5565749235474 24.29663608562691 25.045871559633028 26.10091743119266 18-19 24.327217125382266 24.403669724770644 24.70948012232416 26.559633027522935 20-21 24.26605504587156 25.12232415902141 25.36697247706422 25.244648318042813 22-23 24.388379204892967 25.321100917431195 24.770642201834864 25.51987767584098 24-25 24.204892966360855 24.724770642201836 24.770642201834864 26.299694189602445 26-27 24.678899082568808 24.81651376146789 24.70948012232416 25.79510703363914 28-29 26.07033639143731 23.94495412844037 23.883792048929664 26.10091743119266 30-31 25.76452599388379 24.204892966360855 22.752293577981654 27.278287461773697 32-33 25.902140672782874 25.0 24.08256880733945 25.015290519877674 34-35 25.4434250764526 24.18960244648318 23.883792048929664 26.483180428134556 36-37 25.21034113507725 23.542909591555762 24.170108612513385 27.076640660853602 38-39 24.364860728497092 24.82399755127028 23.783287419651057 27.027854300581573 40-41 25.344352617079892 23.997551270278546 23.262932353841446 27.395163758800123 42-43 23.859810223446587 24.716865625956537 23.47719620446893 27.946127946127948 44-45 24.441383532292623 23.798591980410162 24.640342822161003 27.11968166513621 46-47 26.526863615490587 23.771621001071484 23.021582733812952 26.67993264962498 48-49 25.283307810107196 23.108728943338438 23.614088820826954 27.993874425727412 50-51 24.506049931076735 24.18440802573135 23.8168172767652 27.49272476642671 52-53 26.409313725490197 24.004289215686274 22.65625 26.93014705882353 54-55 25.22218817039534 22.54060680355501 24.088262335274287 28.148942690775357 56-57 24.333435488813976 23.996322402696904 24.51731535396874 27.15292675452038 58-59 25.191541526202883 23.659209316579837 23.904382470119522 27.244866687097762 60-61 25.13024823781796 23.276126264174074 23.8430891817346 27.750536316273365 62-63 25.589947900704875 23.904382470119522 23.55194606190622 26.953723567269382 64-65 26.364193746167995 23.697118332311465 23.74310239117106 26.19558553034948 66-67 25.962275724582117 22.818586106425396 23.431988958748658 27.78714921024383 68-69 25.8133824432167 22.8207489257213 24.877225291589934 26.488643339472066 70-71 26.247888189218244 22.377514974658272 23.851942865919213 27.52265397020427 72-73 25.798487887671655 22.55824718407653 24.34809442987193 27.29517049837988 74-75 26.933724149161375 19.491939423546654 25.044780980296366 28.5295554469956 76 30.531358885017422 0.0 30.923344947735192 38.545296167247386 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 732.0 1 366.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 0.5 21 0.5 22 7.5 23 8.5 24 3.0 25 3.5 26 5.0 27 9.5 28 11.0 29 10.5 30 23.0 31 30.5 32 25.0 33 25.0 34 33.0 35 52.0 36 75.5 37 81.5 38 86.5 39 108.0 40 124.5 41 134.5 42 133.0 43 135.0 44 150.5 45 156.0 46 149.5 47 148.5 48 145.5 49 134.0 50 125.5 51 124.5 52 121.0 53 117.0 54 120.5 55 108.5 56 94.0 57 100.5 58 102.0 59 95.5 60 97.0 61 98.0 62 97.0 63 90.5 64 77.0 65 70.5 66 67.5 67 59.0 68 60.5 69 60.0 70 56.5 71 59.0 72 52.5 73 43.0 74 41.5 75 42.0 76 32.0 77 21.0 78 16.5 79 13.5 80 12.0 81 11.0 82 7.0 83 3.0 84 1.5 85 1.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.25 2 18.25 3 18.25 4 18.25 5 18.25 6 18.25 7 18.25 8 18.25 9 18.25 10-11 18.25 12-13 18.25 14-15 18.25 16-17 18.25 18-19 18.25 20-21 18.25 22-23 18.25 24-25 18.25 26-27 18.25 28-29 18.25 30-31 18.25 32-33 18.25 34-35 18.25 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 730.0 36 3.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 1.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 2.0 65 0.0 66 1.0 67 2.0 68 0.0 69 2.0 70 1.0 71 6.0 72 17.0 73 49.0 74 225.0 75 662.0 76 2296.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.76045863030679 79.675 2 1.0845986984815619 1.7500000000000002 3 0.09296560272699102 0.22499999999999998 4 0.030988534242330338 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.030988534242330338 18.25 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 730 18.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.25 0.0 0.0 0.0 0.0 32 0.25 0.0 0.0 0.0 0.0 33 0.3 0.0 0.0 0.0 0.0 34 0.3 0.0 0.0 0.0 0.0 35 0.325 0.0 0.0 0.0 0.0 36 0.325 0.0 0.0 0.0 0.0 37 0.325 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.0 39 0.325 0.0 0.0 0.0 0.0 40 0.325 0.0 0.0 0.0 0.0 41 0.325 0.0 0.0 0.0 0.0 42 0.325 0.0 0.0 0.0 0.0 43 0.325 0.0 0.0 0.0 0.0 44 0.325 0.0 0.0 0.0 0.0 45 0.325 0.0 0.0 0.0 0.0 46 0.325 0.0 0.0 0.0 0.0 47 0.325 0.0 0.0 0.0 0.0 48 0.325 0.0 0.0 0.0 0.0 49 0.325 0.0 0.0 0.0 0.0 50 0.325 0.0 0.0 0.0 0.0 51 0.325 0.0 0.0 0.0 0.0 52 0.325 0.0 0.0 0.0 0.0 53 0.325 0.0 0.0 0.0 0.0 54 0.325 0.0 0.0 0.0 0.0 55 0.325 0.0 0.0 0.0 0.0 56 0.325 0.0 0.0 0.0 0.0 57 0.325 0.0 0.0 0.0 0.0 58 0.325 0.0 0.0 0.0 0.0 59 0.325 0.0 0.0 0.0 0.0 60 0.325 0.0 0.0 0.0 0.0 61 0.325 0.0 0.0 0.0 0.0 62 0.325 0.0 0.0 0.0 0.0 63 0.325 0.0 0.0 0.0 0.0 64 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389830 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389830_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.14725 32.0 21.0 32.0 2.0 32.0 2 24.8465 32.0 14.0 32.0 2.0 32.0 3 24.77975 32.0 14.0 32.0 2.0 32.0 4 24.77825 32.0 14.0 32.0 2.0 32.0 5 24.91825 32.0 14.0 32.0 2.0 32.0 6 27.27575 36.0 14.0 36.0 2.0 36.0 7 27.4965 36.0 14.0 36.0 2.0 36.0 8 27.476 36.0 14.0 36.0 2.0 36.0 9 27.4605 36.0 14.0 36.0 2.0 36.0 10-11 27.36125 36.0 14.0 36.0 2.0 36.0 12-13 27.444 36.0 17.5 36.0 2.0 36.0 14-15 27.157874999999997 36.0 14.0 36.0 2.0 36.0 16-17 27.30025 36.0 14.0 36.0 2.0 36.0 18-19 27.3855 36.0 14.0 36.0 2.0 36.0 20-21 27.0135 36.0 14.0 36.0 2.0 36.0 22-23 27.147125000000003 36.0 14.0 36.0 2.0 36.0 24-25 27.048625 36.0 14.0 36.0 2.0 36.0 26-27 26.996625 36.0 14.0 36.0 2.0 36.0 28-29 26.9195 36.0 14.0 36.0 2.0 36.0 30-31 26.917625 36.0 14.0 36.0 2.0 36.0 32-33 26.809125 36.0 14.0 36.0 2.0 36.0 34-35 26.704875 36.0 14.0 36.0 2.0 36.0 36-37 32.39791645239809 36.0 34.0 36.0 14.0 36.0 38-39 32.323919753086415 36.0 34.0 36.0 14.0 36.0 40-41 32.441820987654324 36.0 34.0 36.0 14.0 36.0 42-43 32.37006172839506 36.0 32.0 36.0 14.0 36.0 44-45 32.22947530864198 36.0 32.0 36.0 14.0 36.0 46-47 32.23171768123899 36.0 34.0 36.0 14.0 36.0 48-49 32.3185047883843 36.0 32.0 36.0 14.0 36.0 50-51 32.23003877256673 36.0 32.0 36.0 14.0 36.0 52-53 32.22836835599506 36.0 32.0 36.0 14.0 36.0 54-55 32.09412673879444 36.0 32.0 36.0 14.0 36.0 56-57 32.22519319938176 36.0 32.0 36.0 14.0 36.0 58-59 32.14992272024729 36.0 32.0 36.0 14.0 36.0 60-61 32.03276661514683 36.0 32.0 36.0 14.0 36.0 62-63 31.586089644513137 36.0 32.0 36.0 14.0 36.0 64-65 31.67224483220039 36.0 32.0 36.0 14.0 36.0 66-67 31.460538102167725 36.0 32.0 36.0 14.0 36.0 68-69 31.62774852895633 36.0 32.0 36.0 14.0 36.0 70-71 31.523416822899325 36.0 32.0 36.0 14.0 36.0 72-73 31.449351798698814 36.0 32.0 36.0 14.0 36.0 74-75 31.459360006825897 36.0 32.0 36.0 14.0 36.0 76 31.106749007498898 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 759.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 4.0 18 0.0 19 4.0 20 9.0 21 14.0 22 23.0 23 35.0 24 51.0 25 65.0 26 66.0 27 82.0 28 121.0 29 136.0 30 196.0 31 264.0 32 383.0 33 518.0 34 762.0 35 504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.64023449552607 20.518358531317496 8.855291576673865 44.98611539648257 2 27.57023772769373 23.186168570546464 31.52207471441803 17.72151898734177 3 20.610922554767047 29.065103363159515 22.523912372724467 27.800061709348967 4 24.436902190681888 31.19407590249923 20.98117864856526 23.387843258253625 5 30.206726319037337 31.71860536871336 18.790496760259177 19.284171551990127 6 20.178957112002468 34.64979944461586 21.56741746374576 23.603825979635914 7 21.2897253933971 18.389385991977786 33.1996297439062 27.12125887071891 8 22.061092255476705 20.518358531317496 26.689293427954336 30.731255785251467 9 22.739895094106757 21.382289416846653 28.910829990743597 26.966985498302993 10-11 26.643011416229555 27.198395556926876 19.932119716136995 26.22647331070657 12-13 25.525339925834363 22.095179233621757 24.242892459826948 28.136588380716937 14-15 24.632977901406274 24.818420645958895 23.968474733426053 26.58012671920878 16-17 25.787523162445954 22.961704756022236 23.764669549104386 27.486102532427424 18-19 25.540457072266832 24.10438542310068 24.011735639283508 26.343421865348983 20-21 26.776885043263288 24.58281829419036 22.867737948084056 25.772558714462303 22-23 25.80346106304079 25.247218788627933 23.223114956736712 25.72620519159456 24-25 25.972222222222225 24.04320987654321 22.73148148148148 27.253086419753085 26-27 26.752083976535967 24.49830194504477 23.355974066069773 25.39364001234949 28-29 27.081724084659353 24.177352077861887 22.21535609454658 26.525567742932182 30-31 26.16216216216216 25.35907335907336 22.44015444015444 26.038610038610038 32-33 26.864289022695694 24.671916010498688 22.89640265555041 25.56739231125521 34-35 27.812934094767712 23.352369192776663 22.5652106806606 26.26948603179503 36-37 26.95276319851806 24.34393331275085 22.491509725223835 26.211793763507256 38-39 27.730573150007725 23.68299088521551 21.890931561872392 26.695504402904373 40-41 27.546296296296298 22.51543209876543 23.271604938271608 26.666666666666668 42-43 26.61315220747144 24.313059586292066 22.723062673664714 26.350725532571783 44-45 27.01451065143563 24.251312133374498 22.074714418030254 26.659462797159616 46-47 28.957528957528954 23.56756756756757 21.266409266409266 26.20849420849421 48-49 26.371927654969856 24.424176843407018 23.589426495594374 25.61446900602875 50-51 26.446025363439528 25.00773275595422 22.70337148159604 25.84287039901021 52-53 27.37948084054388 24.81458590852905 21.600741656365884 26.20519159456119 54-55 27.89115646258503 24.10327767470625 21.753246753246753 26.25231910946197 56-57 28.207109737248842 22.96754250386399 23.40030911901082 25.42503863987635 58-59 27.666151468315302 22.93663060278207 22.519319938176196 26.877897990726428 60-61 26.696552790230328 23.403926418302675 23.218426341010975 26.681094450456023 62-63 27.449768160741883 23.9258114374034 23.523956723338486 25.100463678516228 64-65 28.13852813852814 22.294372294372295 22.758194186765614 26.808905380333954 66-67 26.825495049504948 23.700495049504948 23.035272277227723 26.438737623762375 68-69 26.354908640445956 24.79095695261691 22.235986373490242 26.618148033446886 70-71 27.193798449612405 22.62015503875969 23.5968992248062 26.589147286821706 72-73 27.782974742750234 22.123479887745557 23.261615216713437 26.831930152790772 74-75 28.392001322095524 20.376797223599404 23.450669310857712 27.780532143447363 76 29.554477282752533 0.0 30.65725628584032 39.788266431407145 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 760.0 1 380.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.5 14 1.5 15 0.0 16 0.5 17 1.5 18 2.5 19 3.0 20 4.5 21 5.5 22 5.0 23 4.5 24 9.5 25 15.0 26 11.0 27 7.0 28 13.5 29 19.5 30 18.0 31 21.0 32 28.5 33 33.0 34 37.5 35 48.5 36 57.5 37 61.5 38 70.0 39 80.5 40 88.5 41 101.0 42 111.5 43 121.0 44 135.0 45 145.5 46 149.0 47 142.5 48 129.5 49 118.5 50 116.5 51 120.0 52 111.5 53 98.5 54 88.5 55 97.5 56 111.0 57 107.5 58 113.0 59 123.0 60 120.5 61 116.5 62 116.0 63 106.0 64 95.0 65 84.0 66 78.5 67 80.5 68 77.0 69 73.5 70 70.0 71 63.5 72 60.5 73 56.5 74 43.0 75 31.0 76 29.5 77 23.5 78 15.0 79 12.0 80 9.0 81 5.5 82 3.5 83 3.5 84 5.0 85 3.5 86 1.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.975 2 19.025 3 18.975 4 18.975 5 18.975 6 18.975 7 18.975 8 18.975 9 18.975 10-11 18.975 12-13 19.1 14-15 19.112499999999997 16-17 19.05 18-19 19.05 20-21 19.1 22-23 19.1 24-25 19.0 26-27 19.025 28-29 19.0875 30-31 19.0625 32-33 19.037499999999998 34-35 19.0125 36-37 0.046289152908501774 38-39 0.10802469135802469 40-41 0.0 42-43 0.030864197530864196 44-45 0.030864197530864196 46-47 0.04631058968817536 48-49 0.07723200494284832 50-51 0.10814151089139502 52-53 0.0 54-55 0.030911901081916538 56-57 0.0 58-59 0.0 60-61 0.015455950540958269 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 759.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 2.0 47 1.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 2.0 65 0.0 66 2.0 67 2.0 68 0.0 69 2.0 70 4.0 71 7.0 72 18.0 73 63.0 74 219.0 75 649.0 76 2267.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.74686716791979 78.8 2 0.9398496240601504 1.5 3 0.2506265664160401 0.6 4 0.0 0.0 5 0.03132832080200501 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.03132832080200501 18.975 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 759 18.975 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.15 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 39 0.175 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.175 0.0 0.0 0.0 0.0 43 0.175 0.0 0.0 0.0 0.0 44 0.175 0.0 0.0 0.0 0.0 45 0.175 0.0 0.0 0.0 0.0 46 0.175 0.0 0.0 0.0 0.0 47 0.175 0.0 0.0 0.0 0.0 48 0.175 0.0 0.0 0.0 0.0 49 0.175 0.0 0.0 0.0 0.0 50 0.175 0.0 0.0 0.0 0.0 51 0.175 0.0 0.0 0.0 0.0 52 0.175 0.0 0.0 0.0 0.0 53 0.175 0.0 0.0 0.0 0.0 54 0.175 0.0 0.0 0.0 0.0 55 0.175 0.0 0.0 0.0 0.0 56 0.175 0.0 0.0 0.0 0.0 57 0.175 0.0 0.0 0.0 0.0 58 0.175 0.0 0.0 0.0 0.0 59 0.175 0.0 0.0 0.0 0.0 60 0.175 0.0 0.0 0.0 0.0 61 0.175 0.0 0.0 0.0 0.0 62 0.175 0.0 0.0 0.0 0.0 63 0.175 0.0 0.0 0.0 0.0 64 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323779 spots for SRR11389830.sra Written 323779 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra Read 323763 spots for SRR11389830.sra Written 323763 spots for SRR11389830.sra SRR ids: ['SRR11389830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i17fj2br SRR11389830.sra spots: 6475276 blocks: [[1, 323763], [323764, 647526], [647527, 971289], [971290, 1295052], [1295053, 1618815], [1618816, 1942578], [1942579, 2266341], [2266342, 2590104], [2590105, 2913867], [2913868, 3237630], [3237631, 3561393], [3561394, 3885156], [3885157, 4208919], [4208920, 4532682], [4532683, 4856445], [4856446, 5180208], [5180209, 5503971], [5503972, 5827734], [5827735, 6151497], [6151498, 6475276]] SRR11389830 file size 1127000 SRR11389830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389830 SRR11389830_1.fastq SRR11389830_2.fastq Input file: SRR11389830_1.fastq Paired file: SRR11389830_2.fastq trimmed: SRR11389830-trimmed-pair1.fastq, SRR11389830-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:37:48 2024 >> started Sat Dec 7 07:37:53 2024 >> done (5.531s) 6475276 read pairs processed; of these: 1311 ( 0.02%) short read pairs filtered out after trimming by size control 1359610 (21.00%) empty read pairs filtered out after trimming by size control 5114355 (78.98%) read pairs available; of these: 39733 ( 0.78%) trimmed read pairs available after processing 5074622 (99.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1957 0.04% 19 10 0.00% 20 3157 0.06% 21 15 0.00% 22 4663 0.09% 23 14 0.00% 24 6009 0.12% 25 20 0.00% 26 6913 0.14% 27 15 0.00% 28 6180 0.12% 29 13 0.00% 30 4351 0.09% 31 11 0.00% 32 2655 0.05% 33 7 0.00% 34 1322 0.03% 35 82 0.00% 36 2393 0.05% 37 92 0.00% 38 1107 0.02% 39 118 0.00% 40 610 0.01% 41 182 0.00% 42 401 0.01% 43 214 0.00% 44 328 0.01% 45 241 0.00% 46 265 0.01% 47 274 0.01% 48 318 0.01% 49 347 0.01% 50 367 0.01% 51 434 0.01% 52 490 0.01% 53 501 0.01% 54 553 0.01% 55 1069 0.02% 56 1339 0.03% 57 1030 0.02% 58 1021 0.02% 59 974 0.02% 60 897 0.02% 61 961 0.02% 62 966 0.02% 63 1136 0.02% 64 1164 0.02% 65 1213 0.02% 66 1399 0.03% 67 1590 0.03% 68 1561 0.03% 69 1722 0.03% 70 1914 0.04% 71 2629 0.05% 72 6456 0.13% 73 50413 0.99% 74 345922 6.76% 75 2168031 42.39% 76 2474319 48.38% 5114355 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=2.8 sequence=ATATATATATAGATCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=38.77 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=CTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATAT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=13 fanout-score=87.64 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=14.3 sequence=GCCGCCGCCACCCT SRR11389830 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:38:25 Started mapping on | Dec 07 07:38:25 Finished on | Dec 07 07:39:57 Mapping speed, Million of reads per hour | 200.13 Number of input reads | 5114355 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 4306489 Uniquely mapped reads % | 84.20% Average mapped length | 150.05 Number of splices: Total | 1928612 Number of splices: Annotated (sjdb) | 1844453 Number of splices: GT/AG | 1902604 Number of splices: GC/AG | 22820 Number of splices: AT/AC | 663 Number of splices: Non-canonical | 2525 Mismatch rate per base, % | 1.09% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367612 % of reads mapped to multiple loci | 7.19% Number of reads mapped to too many loci | 16220 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.35% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 440254 440254 440254 N_multimapping 367612 367612 367612 N_noFeature 148801 4178257 199304 N_ambiguous 106989 649 31267 UnstrandedReadsAssigned:4050699 PositiveStrandReadsAssigned:127583 NegativeStrandReadsAssigned:4075918 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389830 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389830-trimmed-pair1.fastq SRR11389830-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,114,355 reads, 4,389,922 reads pseudoaligned [quant] estimated average fragment length: 194.81 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52973 SRR11389830.ke.tsv 35125 SRR11389830.se.tsv 88098 total ==> SRR11389830.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.381 0 0 PNS24247 1044 850.19 7.61702 2.84878 PNS24249 1928 1734.19 20.1489 3.69441 PNS24246 1044 850.19 7.61702 2.84878 PNS24248 1044 850.19 7.61702 2.84878 PNS24244 1471 1277.19 0 0 PNS24243 293 115.499 0 0 KQK14069 1603 1409.19 10.6038 2.39266 KQK14071 474 282.777 1.39619 1.56997 ==> SRR11389830.se.tsv <== BRADI_1g14170v3 12 BRADI_1g53295v3 5 BRADI_1g59795v3 44 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 35 BRADI_1g74790v3 48 BRADI_1g09890v3 0 BRADI_1g77505v3 56 BRADI_1g48960v3 0 SRR11389830 completed mapping pipeline successfully