Starting /dee2/code/volunteer_pipeline.sh SRR11389831 current disk space = 1544416186368 free memory = 1601739344 SRR11389831 SRAfilesize 3492e3aa67fe5bbd898c5e8697b7c2c9 SRR11389831.sra SRR11389831.sra file validated SRR11389831 is paired end SRR11389831 is conventional basespace SRR11389831 read1 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01775 32.0 32.0 32.0 32.0 32.0 2 30.90875 32.0 32.0 32.0 32.0 32.0 3 31.04125 32.0 32.0 32.0 32.0 32.0 4 31.06875 32.0 32.0 32.0 32.0 32.0 5 31.10275 32.0 32.0 32.0 32.0 32.0 6 33.95775 36.0 36.0 36.0 32.0 36.0 7 33.84175 36.0 36.0 36.0 32.0 36.0 8 34.01975 36.0 36.0 36.0 32.0 36.0 9 34.146 36.0 36.0 36.0 32.0 36.0 10-11 33.951499999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.003125 36.0 36.0 36.0 32.0 36.0 14-15 33.918875 36.0 36.0 36.0 32.0 36.0 16-17 34.037125 36.0 36.0 36.0 32.0 36.0 18-19 33.884 36.0 36.0 36.0 32.0 36.0 20-21 33.82062500000001 36.0 36.0 36.0 32.0 36.0 22-23 33.754875 36.0 36.0 36.0 29.5 36.0 24-25 33.761375 36.0 36.0 36.0 32.0 36.0 26-27 33.669624999999996 36.0 36.0 36.0 29.5 36.0 28-29 33.514624999999995 36.0 36.0 36.0 27.0 36.0 30-31 33.419875000000005 36.0 36.0 36.0 24.0 36.0 32-33 33.2795 36.0 36.0 36.0 17.5 36.0 34-35 33.200125 36.0 36.0 36.0 17.5 36.0 36-37 33.21325 36.0 36.0 36.0 14.0 36.0 38-39 33.2625 36.0 36.0 36.0 17.5 36.0 40-41 33.182625 36.0 36.0 36.0 17.5 36.0 42-43 33.17375 36.0 36.0 36.0 17.5 36.0 44-45 32.963499999999996 36.0 36.0 36.0 14.0 36.0 46-47 32.985872343085774 36.0 36.0 36.0 14.0 36.0 48-49 32.756064016004004 36.0 36.0 36.0 14.0 36.0 50-51 32.607401850462615 36.0 34.0 36.0 14.0 36.0 52-53 32.576144036009 36.0 34.0 36.0 14.0 36.0 54-55 32.39134783695924 36.0 32.0 36.0 14.0 36.0 56-57 32.10540135033759 36.0 32.0 36.0 14.0 36.0 58-59 32.033258314578646 36.0 32.0 36.0 14.0 36.0 60-61 32.030382595648916 36.0 32.0 36.0 14.0 36.0 62-63 32.074268567141786 36.0 32.0 36.0 14.0 36.0 64-65 32.15179917415572 36.0 32.0 36.0 14.0 36.0 66-67 31.950967162760563 36.0 32.0 36.0 14.0 36.0 68-69 31.82344844844845 36.0 32.0 36.0 14.0 36.0 70-71 31.873012451188345 36.0 32.0 36.0 14.0 36.0 72-73 31.826710833813245 36.0 32.0 36.0 14.0 36.0 74-75 31.530595676280925 36.0 32.0 36.0 14.0 36.0 76 30.206846321922797 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 6.0 23 10.0 24 28.0 25 39.0 26 62.0 27 94.0 28 149.0 29 195.0 30 247.0 31 322.0 32 479.0 33 619.0 34 907.0 35 839.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.175000000000004 10.424999999999999 16.575 35.825 2 24.325 12.8 29.299999999999997 33.575 3 24.275 17.775 24.5 33.45 4 29.825000000000003 24.775 20.925 24.474999999999998 5 27.05 27.425 23.3 22.225 6 21.975 32.25 26.125 19.650000000000002 7 18.325 25.5 35.5 20.674999999999997 8 19.8 25.75 29.65 24.8 9 19.3 22.325 34.375 24.0 10-11 22.05 29.425 24.474999999999998 24.05 12-13 23.3125 23.7625 27.0625 25.8625 14-15 23.1125 25.2 26.3125 25.374999999999996 16-17 23.025000000000002 26.3125 25.9625 24.7 18-19 23.6375 25.45 26.787499999999998 24.125 20-21 23.4875 25.7 26.437500000000004 24.375 22-23 23.549999999999997 24.6625 26.174999999999997 25.6125 24-25 23.2625 25.55 26.1625 25.025 26-27 22.875 25.887500000000003 25.374999999999996 25.8625 28-29 23.3875 25.387500000000003 26.150000000000002 25.074999999999996 30-31 23.375 26.2125 25.362499999999997 25.05 32-33 23.549999999999997 25.05 26.187500000000004 25.2125 34-35 22.7375 25.0375 26.55 25.674999999999997 36-37 23.1875 25.15 27.05 24.6125 38-39 23.5 25.025 26.424999999999997 25.05 40-41 24.15 24.962500000000002 25.674999999999997 25.2125 42-43 23.3375 25.7875 26.737499999999997 24.1375 44-45 23.5875 25.25 26.0 25.162499999999998 46-47 24.065508188523566 25.390673834229275 25.490686335791974 25.053131641455185 48-49 22.393098274568644 25.531382845711427 26.11902975743936 25.95648912228057 50-51 22.61815453863466 26.056514128532132 26.03150787696924 25.29382345586397 52-53 22.780695173793447 25.49387346836709 25.831457864466117 25.893973493373345 54-55 22.13053263315829 25.35633908477119 26.84421105276319 25.668917229307326 56-57 22.968242060515127 25.243810952738183 25.78144536134033 26.006501625406354 58-59 22.680670167541887 25.331332833208304 25.93148287071768 26.056514128532132 60-61 22.043010752688172 25.49387346836709 26.744186046511626 25.71892973243311 62-63 23.705926481620406 24.756189047261813 26.431607901975497 25.10627656914228 64-65 24.771789421032885 24.934350381393024 25.62210829060898 24.671751906965113 66-67 23.279959969977483 24.818613960470355 26.494871153365025 25.40655491618714 68-69 23.41091091091091 25.212712712712715 25.650650650650654 25.725725725725724 70-71 23.888819331413547 24.026543132590458 25.679228746713413 26.405408789282586 72-73 23.377766599597585 24.899396378269618 25.943158953722335 25.779678068410462 74-75 23.772985844688453 23.111522688186266 26.26008731313666 26.855404153988623 76 25.855790240349602 0.0 35.906773488710854 38.237436270939554 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 24.0 1 18.5 2 7.0 3 1.5 4 2.0 5 2.5 6 1.5 7 0.5 8 1.0 9 0.5 10 0.0 11 2.0 12 4.0 13 3.0 14 1.5 15 1.5 16 4.5 17 6.0 18 10.5 19 12.5 20 16.5 21 25.5 22 19.5 23 12.5 24 10.5 25 6.5 26 7.5 27 14.0 28 17.0 29 15.0 30 20.5 31 36.0 32 44.0 33 42.0 34 41.5 35 54.0 36 75.0 37 92.0 38 119.5 39 145.5 40 152.0 41 169.5 42 193.0 43 211.5 44 228.0 45 231.0 46 227.0 47 213.5 48 200.5 49 190.0 50 174.5 51 150.5 52 131.5 53 129.5 54 131.0 55 123.0 56 114.5 57 111.5 58 106.0 59 113.0 60 121.0 61 113.0 62 101.5 63 88.0 64 74.5 65 69.5 66 57.0 67 44.0 68 47.0 69 48.5 70 40.5 71 36.0 72 34.5 73 31.5 74 30.5 75 31.0 76 24.5 77 14.0 78 9.5 79 8.5 80 8.0 81 4.5 82 3.5 83 5.0 84 4.0 85 2.5 86 1.5 87 1.0 88 1.5 89 2.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 2.0 67 0.0 68 0.0 69 0.0 70 5.0 71 3.0 72 24.0 73 70.0 74 229.0 75 919.0 76 2746.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.24742268041237 95.3 2 1.3917525773195878 2.7 3 0.18041237113402062 0.525 4 0.10309278350515465 0.4 5 0.0 0.0 6 0.025773195876288662 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051546391752577324 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 22 0.5499999999999999 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 15 0.375 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAACAC 15 0.0021164005 69.575005 55 >>END_MODULE SRR11389831 read2 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5495 32.0 32.0 32.0 32.0 32.0 2 30.189 32.0 32.0 32.0 21.0 32.0 3 30.312 32.0 32.0 32.0 21.0 32.0 4 30.309 32.0 32.0 32.0 21.0 32.0 5 30.26125 32.0 32.0 32.0 21.0 32.0 6 33.442 36.0 36.0 36.0 21.0 36.0 7 33.342 36.0 36.0 36.0 21.0 36.0 8 33.237 36.0 36.0 36.0 21.0 36.0 9 33.10325 36.0 36.0 36.0 14.0 36.0 10-11 33.11125 36.0 36.0 36.0 17.5 36.0 12-13 33.175625 36.0 36.0 36.0 21.0 36.0 14-15 33.27925 36.0 36.0 36.0 21.0 36.0 16-17 33.297375 36.0 36.0 36.0 21.0 36.0 18-19 32.88225 36.0 36.0 36.0 14.0 36.0 20-21 33.0235 36.0 36.0 36.0 14.0 36.0 22-23 32.86125 36.0 36.0 36.0 14.0 36.0 24-25 32.80275 36.0 36.0 36.0 14.0 36.0 26-27 32.768375 36.0 36.0 36.0 14.0 36.0 28-29 32.828625 36.0 36.0 36.0 14.0 36.0 30-31 32.6605 36.0 36.0 36.0 14.0 36.0 32-33 32.485 36.0 36.0 36.0 14.0 36.0 34-35 32.523375 36.0 36.0 36.0 14.0 36.0 36-37 32.50775 36.0 36.0 36.0 14.0 36.0 38-39 32.51675 36.0 36.0 36.0 14.0 36.0 40-41 32.377250000000004 36.0 34.0 36.0 14.0 36.0 42-43 32.132000000000005 36.0 32.0 36.0 14.0 36.0 44-45 32.291250000000005 36.0 34.0 36.0 14.0 36.0 46-47 32.22264522380595 36.0 34.0 36.0 14.0 36.0 48-49 32.02238059514879 36.0 32.0 36.0 14.0 36.0 50-51 31.91185296324081 36.0 32.0 36.0 14.0 36.0 52-53 31.977869467366844 36.0 32.0 36.0 14.0 36.0 54-55 31.871217804451113 36.0 32.0 36.0 14.0 36.0 56-57 31.560265066266567 36.0 32.0 36.0 14.0 36.0 58-59 31.601775443860966 36.0 32.0 36.0 14.0 36.0 60-61 31.44998749687422 36.0 32.0 36.0 14.0 36.0 62-63 31.385846461615404 36.0 32.0 36.0 14.0 36.0 64-65 31.48880444848581 36.0 32.0 36.0 14.0 36.0 66-67 31.276759133805925 36.0 32.0 36.0 14.0 36.0 68-69 31.271964956195244 36.0 32.0 36.0 14.0 36.0 70-71 31.447914701791966 36.0 32.0 36.0 14.0 36.0 72-73 30.99308035652205 36.0 32.0 36.0 14.0 36.0 74-75 31.03155455534408 36.0 32.0 36.0 14.0 36.0 76 29.273684210526316 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 13.0 16 17.0 17 19.0 18 19.0 19 15.0 20 15.0 21 10.0 22 12.0 23 37.0 24 33.0 25 61.0 26 90.0 27 106.0 28 157.0 29 187.0 30 288.0 31 313.0 32 430.0 33 580.0 34 911.0 35 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.025 15.5 15.075 34.4 2 29.575000000000003 24.375 24.9 21.15 3 29.95 27.025 19.05 23.974999999999998 4 31.5 31.25 16.85 20.4 5 30.475 31.624999999999996 18.325 19.575 6 25.525 34.325 20.875 19.275000000000002 7 24.275 18.675 31.5 25.55 8 25.15 23.599999999999998 24.4 26.85 9 25.275 21.6 27.224999999999998 25.900000000000002 10-11 27.287499999999998 27.462500000000002 20.5625 24.6875 12-13 27.3875 22.9375 23.9125 25.7625 14-15 26.775 25.05 24.1375 24.0375 16-17 28.449999999999996 24.2375 23.5 23.8125 18-19 26.987499999999997 24.2375 23.3875 25.387500000000003 20-21 26.2625 25.900000000000002 24.2375 23.599999999999998 22-23 27.425 26.075 22.8375 23.6625 24-25 26.087500000000002 25.025 24.15 24.7375 26-27 26.775 24.962500000000002 25.05 23.2125 28-29 27.55 24.712500000000002 23.225 24.5125 30-31 26.5625 25.937500000000004 23.5 24.0 32-33 27.675 24.587500000000002 23.9375 23.799999999999997 34-35 27.425 25.087500000000002 22.9375 24.55 36-37 25.724999999999998 26.325 23.775 24.175 38-39 26.337500000000002 25.25 23.7 24.712500000000002 40-41 26.7625 24.3625 23.95 24.925 42-43 25.887500000000003 25.35 24.0125 24.75 44-45 26.087500000000002 25.587500000000002 24.3625 23.962500000000002 46-47 27.29091136392049 24.40305038129766 24.103012876609576 24.20302537817227 48-49 25.868967241810452 25.156289072268066 24.493623405851466 24.48112028007002 50-51 26.669167291822955 25.406351587896975 24.143535883970994 23.78094523630908 52-53 25.79394848712178 25.668917229307326 23.55588897224306 24.981245311327832 54-55 25.943985996499126 25.481370342585645 23.918479619904975 24.656164041010253 56-57 26.344086021505376 25.55638909727432 23.80595148787197 24.293573393348336 58-59 26.081520380095025 25.36884221055264 23.218304576144035 25.331332833208304 60-61 26.969242310577645 25.63140785196299 24.081020255063766 23.3183295823956 62-63 26.71917979494874 25.04376094023506 23.605901475368842 24.63115778944736 64-65 26.60997874202826 25.159434788045516 23.03363761410529 25.196948855820935 66-67 25.875875875875877 26.5015015015015 23.886386386386384 23.736236236236234 68-69 25.819774718397998 26.0450563204005 23.892365456821025 24.242803504380475 70-71 26.164246369554334 25.625938908362546 23.372558838257387 24.837255883825737 72-73 24.978001257071025 26.813324952859833 24.211187932118165 23.997485857950974 74-75 27.173333333333332 22.24 25.36 25.226666666666663 76 29.24812030075188 0.0 34.43609022556391 36.31578947368421 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 16.5 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.5 14 1.5 15 2.0 16 3.0 17 3.5 18 5.0 19 4.5 20 5.5 21 9.0 22 5.5 23 6.5 24 12.5 25 12.5 26 8.0 27 7.0 28 12.0 29 20.0 30 23.0 31 23.0 32 32.5 33 38.0 34 41.0 35 57.0 36 79.5 37 89.0 38 98.5 39 121.5 40 139.0 41 161.0 42 180.0 43 183.0 44 197.0 45 204.0 46 193.0 47 182.5 48 173.5 49 171.5 50 167.0 51 148.5 52 138.0 53 128.5 54 122.0 55 135.5 56 136.5 57 118.0 58 108.0 59 128.5 60 146.5 61 132.0 62 114.5 63 103.0 64 91.5 65 86.5 66 83.5 67 81.0 68 80.5 69 69.5 70 51.0 71 39.5 72 41.0 73 43.0 74 36.5 75 33.0 76 28.5 77 23.0 78 17.5 79 13.0 80 13.0 81 9.5 82 6.0 83 5.0 84 3.0 85 3.0 86 3.0 87 1.5 88 1.0 89 1.5 90 2.0 91 2.0 92 1.5 93 2.5 94 2.5 95 1.0 96 1.0 97 2.5 98 3.0 99 5.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 2.0 67 0.0 68 0.0 69 0.0 70 2.0 71 5.0 72 21.0 73 72.0 74 290.0 75 945.0 76 2660.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.19634114918834 95.275 2 1.3398608606029374 2.6 3 0.2834321051275444 0.8250000000000001 4 0.0 0.0 5 0.1030662200463798 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07729966503478485 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCA 5 0.125 No Hit CGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCTTACTTCTTC 5 0.125 No Hit CCGACGCCACGCAGGTGCTAAAGGAGCTGGAGGAGGTGAAGAAGGAGTAC 5 0.125 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680512 spots for SRR11389831.sra Written 680512 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra Read 680494 spots for SRR11389831.sra Written 680494 spots for SRR11389831.sra SRR ids: ['SRR11389831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ilur5yk3 SRR11389831.sra spots: 13609898 blocks: [[1, 680494], [680495, 1360988], [1360989, 2041482], [2041483, 2721976], [2721977, 3402470], [3402471, 4082964], [4082965, 4763458], [4763459, 5443952], [5443953, 6124446], [6124447, 6804940], [6804941, 7485434], [7485435, 8165928], [8165929, 8846422], [8846423, 9526916], [9526917, 10207410], [10207411, 10887904], [10887905, 11568398], [11568399, 12248892], [12248893, 12929386], [12929387, 13609898]] SRR11389831 file size 2583544 SRR11389831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389831 SRR11389831_1.fastq SRR11389831_2.fastq Input file: SRR11389831_1.fastq Paired file: SRR11389831_2.fastq trimmed: SRR11389831-trimmed-pair1.fastq, SRR11389831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:38:06 2024 >> started Sat Dec 7 07:38:18 2024 >> done (11.605s) 13609898 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 53892 ( 0.40%) empty read pairs filtered out after trimming by size control 13556004 (99.60%) read pairs available; of these: 99218 ( 0.73%) trimmed read pairs available after processing 13456786 (99.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 4 0.00% 34 5 0.00% 35 146 0.00% 36 131 0.00% 37 161 0.00% 38 210 0.00% 39 241 0.00% 40 304 0.00% 41 383 0.00% 42 368 0.00% 43 435 0.00% 44 504 0.00% 45 507 0.00% 46 582 0.00% 47 611 0.00% 48 688 0.01% 49 821 0.01% 50 867 0.01% 51 1015 0.01% 52 1101 0.01% 53 1223 0.01% 54 1376 0.01% 55 1481 0.01% 56 1624 0.01% 57 1798 0.01% 58 1907 0.01% 59 2165 0.02% 60 2364 0.02% 61 2582 0.02% 62 2840 0.02% 63 3205 0.02% 64 3438 0.03% 65 3857 0.03% 66 4126 0.03% 67 4798 0.04% 68 4721 0.03% 69 5203 0.04% 70 6159 0.05% 71 7686 0.06% 72 17201 0.13% 73 114215 0.84% 74 1023278 7.55% 75 6023463 44.43% 76 6306201 46.52% 13556004 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.71 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=59.37 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.7 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=0.61 prefix-fanout=2.1 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=5.44 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.1 sequence=CCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTATGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCT SRR11389831 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:38:52 Started mapping on | Dec 07 07:38:52 Finished on | Dec 07 07:39:53 Mapping speed, Million of reads per hour | 800.03 Number of input reads | 13556004 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11422307 Uniquely mapped reads % | 84.26% Average mapped length | 150.07 Number of splices: Total | 5141161 Number of splices: Annotated (sjdb) | 4885202 Number of splices: GT/AG | 5071455 Number of splices: GC/AG | 61206 Number of splices: AT/AC | 1483 Number of splices: Non-canonical | 7017 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1148020 % of reads mapped to multiple loci | 8.47% Number of reads mapped to too many loci | 27812 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.82% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985677 985677 985677 N_multimapping 1148020 1148020 1148020 N_noFeature 410301 10922026 685347 N_ambiguous 303441 2981 84176 UnstrandedReadsAssigned:10708565 PositiveStrandReadsAssigned:497300 NegativeStrandReadsAssigned:10652784 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389831-trimmed-pair1.fastq SRR11389831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,556,004 reads, 11,899,539 reads pseudoaligned [quant] estimated average fragment length: 212.805 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR11389831.ke.tsv 35125 SRR11389831.se.tsv 88098 total ==> SRR11389831.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.345 0 0 PNS24247 1044 832.195 29.5366 4.00794 PNS24249 1928 1716.2 86.3731 5.68326 PNS24246 1044 832.195 29.5366 4.00794 PNS24248 1044 832.195 29.5366 4.00794 PNS24244 1471 1259.2 19.017 1.70543 PNS24243 293 108.877 0 0 KQK14069 1603 1391.2 1917.65 155.656 KQK14071 474 265.933 90.2934 38.3415 ==> SRR11389831.se.tsv <== BRADI_1g14170v3 2061 BRADI_1g53295v3 19 BRADI_1g59795v3 181 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 81 BRADI_1g74790v3 153 BRADI_1g09890v3 0 BRADI_1g77505v3 145 BRADI_1g48960v3 0 SRR11389831 completed mapping pipeline successfully