Starting /dee2/code/volunteer_pipeline.sh SRR11389832 current disk space = 1544430964736 free memory = 1604542000 SRR11389832 SRAfilesize c94ff6f0941cd5fb2e30fce58521419b SRR11389832.sra SRR11389832.sra file validated SRR11389832 is paired end SRR11389832 is conventional basespace SRR11389832 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.88125 32.0 32.0 32.0 32.0 32.0 2 29.82925 32.0 32.0 32.0 27.0 32.0 3 29.798 32.0 32.0 32.0 21.0 32.0 4 29.85375 32.0 32.0 32.0 21.0 32.0 5 29.9575 32.0 32.0 32.0 32.0 32.0 6 32.67275 36.0 36.0 36.0 21.0 36.0 7 32.66425 36.0 36.0 36.0 21.0 36.0 8 32.6295 36.0 36.0 36.0 21.0 36.0 9 32.7145 36.0 36.0 36.0 21.0 36.0 10-11 32.6715 36.0 36.0 36.0 17.5 36.0 12-13 32.727875 36.0 36.0 36.0 21.0 36.0 14-15 32.61875 36.0 36.0 36.0 17.5 36.0 16-17 32.637 36.0 36.0 36.0 21.0 36.0 18-19 32.62375 36.0 36.0 36.0 17.5 36.0 20-21 32.50125 36.0 36.0 36.0 17.5 36.0 22-23 32.501625000000004 36.0 36.0 36.0 14.0 36.0 24-25 32.479375000000005 36.0 36.0 36.0 14.0 36.0 26-27 32.24375 36.0 36.0 36.0 14.0 36.0 28-29 32.284625 36.0 36.0 36.0 14.0 36.0 30-31 32.093875 36.0 36.0 36.0 14.0 36.0 32-33 31.928624999999997 36.0 36.0 36.0 14.0 36.0 34-35 31.932375 36.0 36.0 36.0 14.0 36.0 36-37 33.162796764936076 36.0 36.0 36.0 14.0 36.0 38-39 33.29141664492565 36.0 36.0 36.0 17.5 36.0 40-41 33.12470649621706 36.0 36.0 36.0 14.0 36.0 42-43 33.13892512392382 36.0 36.0 36.0 17.5 36.0 44-45 32.95327479007433 36.0 36.0 36.0 17.5 36.0 46-47 33.049973903966595 36.0 36.0 36.0 14.0 36.0 48-49 32.858559498956154 36.0 36.0 36.0 14.0 36.0 50-51 32.683760590316666 36.0 34.0 36.0 14.0 36.0 52-53 32.61093709214305 36.0 34.0 36.0 14.0 36.0 54-55 32.4948318070325 36.0 32.0 36.0 14.0 36.0 56-57 32.23071096830769 36.0 32.0 36.0 14.0 36.0 58-59 32.18039907968433 36.0 32.0 36.0 14.0 36.0 60-61 32.148689027927205 36.0 32.0 36.0 14.0 36.0 62-63 32.17742628627961 36.0 32.0 36.0 14.0 36.0 64-65 32.312086734706135 36.0 32.0 36.0 14.0 36.0 66-67 31.98263339497769 36.0 32.0 36.0 14.0 36.0 68-69 31.99909435589296 36.0 32.0 36.0 14.0 36.0 70-71 31.956905471470435 36.0 32.0 36.0 14.0 36.0 72-73 31.89779677513919 36.0 32.0 36.0 14.0 36.0 74-75 31.867582547905872 36.0 32.0 36.0 14.0 36.0 76 30.784775888717157 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 167.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 7.0 22 12.0 23 19.0 24 25.0 25 41.0 26 63.0 27 94.0 28 129.0 29 166.0 30 225.0 31 300.0 32 412.0 33 542.0 34 911.0 35 887.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.68092877641534 10.748760761805375 13.853378554656926 44.71693190712236 2 22.984607357161494 14.688233759457345 34.985650926167494 27.341507957213672 3 21.732324549960865 18.471171406209237 22.984607357161494 36.811896686668405 4 26.871901904513436 26.45447430211323 20.688755543960344 25.98486824941299 5 24.49778241586225 29.37646751891469 24.34124706496217 21.784503000260894 6 21.210540046960606 31.8027654578659 28.35898773806418 18.627706757109312 7 17.531959300808765 25.567440647012784 36.368379859118185 20.532220193060265 8 18.001565353509 25.541351421862768 32.55935298721628 23.89773023741195 9 19.12340203495956 21.31489694756066 36.3944690842682 23.167231933211582 10-11 21.771458387685886 31.659274719540832 24.30211322723715 22.26715366553613 12-13 23.049830420036525 25.28045917036264 26.85885729193843 24.810853117662404 14-15 21.64101226193582 26.911035742238454 27.484998695538742 23.962953300286983 16-17 22.21497521523611 26.884946517088444 26.780589616488392 24.11948865118706 18-19 22.501956691886253 25.88051134881294 27.328463344638664 24.289068614662142 20-21 22.045395251761022 26.493608139838248 27.04148186798852 24.41951474041221 22-23 23.18027654578659 25.98486824941299 26.571875815288287 24.262979389512132 24-25 22.188885990086092 26.010957474563007 26.93712496738847 24.86303156796243 26-27 21.70623532481085 26.924080354813462 27.250195669188628 24.11948865118706 28-29 23.44116879728672 26.493608139838248 25.723975997912863 24.34124706496217 30-31 21.967127576310983 26.089225150013046 26.96321419253848 24.98043308113749 32-33 22.371510566136184 26.715366553613357 26.506652752413252 24.406470127837203 34-35 22.893295069136446 26.219671275763112 26.741455778763374 24.145577876337075 36-37 22.88025045656144 26.284894338638143 25.802243673362902 25.032611531437514 38-39 22.593268979911297 26.232715888338117 26.793634229063397 24.38038090268719 40-41 21.614923036785807 25.580485259587793 26.793634229063397 26.010957474563007 42-43 22.488912079311245 24.758674667362378 27.10670493086355 25.645708322462824 44-45 22.23091976516634 25.94911937377691 26.575342465753426 25.244618395303327 46-47 23.969206680584552 24.791231732776616 27.231210855949893 24.008350730688935 48-49 22.62526096033403 24.830375782881003 26.97025052192067 25.5741127348643 50-51 22.536865457392665 25.277306537909432 27.208665013702205 24.977162990995694 52-53 23.675280605586007 25.82876533542156 24.445314539284784 26.050639519707648 54-55 22.516642735935257 25.231692990471217 27.09829004046469 25.153374233128833 56-57 22.183052617835227 25.695260477869176 27.170648909779345 24.951037994516255 58-59 22.41672109732201 25.66949706074461 27.01502286087524 24.89875898105813 60-61 22.78017523211717 24.911730090231462 27.91944553419642 24.38864914345495 62-63 22.90985215229622 24.990187099306553 27.58079288237603 24.519167866021196 64-65 23.23814514016243 25.281634791721245 26.853549908304952 24.62667015981137 66-67 22.443890274314214 25.43640897755611 27.09016931355821 25.029531434571467 68-69 22.63157894736842 25.144736842105264 26.026315789473685 26.19736842105263 70-71 23.770599868160843 25.141727092946603 26.591957811470007 24.495715227422544 72-73 22.95559973492379 24.3870112657389 26.428098078197483 26.229290921139825 74-75 22.766610831937463 23.19932998324958 28.112786152987155 25.9212730318258 76 25.50231839258114 0.0 37.596599690880986 36.90108191653786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 188.0 1 97.0 2 5.0 3 2.0 4 0.0 5 1.5 6 2.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 2.0 17 3.5 18 14.5 19 27.0 20 32.0 21 34.5 22 24.5 23 16.5 24 12.5 25 7.5 26 13.0 27 21.0 28 21.5 29 21.0 30 23.5 31 33.5 32 47.0 33 50.0 34 59.5 35 73.0 36 93.5 37 120.0 38 135.0 39 162.0 40 164.0 41 165.0 42 190.5 43 210.0 44 220.0 45 224.0 46 236.0 47 211.0 48 178.0 49 160.5 50 143.0 51 137.5 52 136.5 53 124.0 54 102.0 55 100.0 56 101.5 57 103.0 58 103.5 59 89.5 60 84.0 61 85.0 62 80.0 63 71.5 64 65.0 65 58.5 66 51.5 67 52.0 68 55.5 69 41.0 70 27.5 71 31.0 72 34.5 73 31.0 74 22.5 75 19.5 76 18.0 77 15.0 78 10.5 79 8.0 80 9.5 81 6.5 82 2.0 83 1.0 84 0.5 85 1.0 86 1.5 87 1.0 88 0.5 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.175 2 4.175 3 4.175 4 4.175 5 4.175 6 4.175 7 4.175 8 4.175 9 4.175 10-11 4.175 12-13 4.175 14-15 4.175 16-17 4.175 18-19 4.175 20-21 4.175 22-23 4.175 24-25 4.175 26-27 4.175 28-29 4.175 30-31 4.175 32-33 4.175 34-35 4.175 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 167.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 1.0 58 1.0 59 3.0 60 1.0 61 1.0 62 1.0 63 2.0 64 4.0 65 2.0 66 7.0 67 5.0 68 2.0 69 3.0 70 7.0 71 8.0 72 17.0 73 64.0 74 236.0 75 876.0 76 2588.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.10743801652893 88.125 2 1.8457300275482096 3.35 3 0.5509641873278237 1.5 4 0.27548209366391185 1.0 5 0.055096418732782364 0.25 6 0.027548209366391182 0.15 7 0.027548209366391182 0.17500000000000002 8 0.0 0.0 9 0.027548209366391182 0.22499999999999998 >10 0.055096418732782364 1.05 >50 0.0 0.0 >100 0.027548209366391182 4.175 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 167 4.175 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 21 0.525 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 21 0.525 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCT 7 0.17500000000000002 No Hit CGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTC 6 0.15 No Hit TTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTA 5 0.125 No Hit CTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389832 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.058 32.0 32.0 32.0 14.0 32.0 2 28.66975 32.0 32.0 32.0 14.0 32.0 3 28.8425 32.0 32.0 32.0 14.0 32.0 4 28.7785 32.0 32.0 32.0 14.0 32.0 5 28.697 32.0 32.0 32.0 14.0 32.0 6 31.3365 36.0 32.0 36.0 14.0 36.0 7 31.328 36.0 32.0 36.0 14.0 36.0 8 31.07125 36.0 32.0 36.0 14.0 36.0 9 31.2325 36.0 32.0 36.0 14.0 36.0 10-11 31.089750000000002 36.0 32.0 36.0 14.0 36.0 12-13 31.211375 36.0 32.0 36.0 14.0 36.0 14-15 31.321875 36.0 32.0 36.0 14.0 36.0 16-17 31.163249999999998 36.0 32.0 36.0 14.0 36.0 18-19 30.979374999999997 36.0 32.0 36.0 14.0 36.0 20-21 31.149375 36.0 32.0 36.0 14.0 36.0 22-23 30.742874999999998 36.0 32.0 36.0 14.0 36.0 24-25 30.962375 36.0 32.0 36.0 14.0 36.0 26-27 30.82 36.0 32.0 36.0 14.0 36.0 28-29 30.495125 36.0 32.0 36.0 14.0 36.0 30-31 30.778875 36.0 32.0 36.0 14.0 36.0 32-33 30.619 36.0 32.0 36.0 14.0 36.0 34-35 30.591625 36.0 32.0 36.0 14.0 36.0 36-37 31.406937613253948 36.0 32.0 36.0 14.0 36.0 38-39 31.35102252135646 36.0 32.0 36.0 14.0 36.0 40-41 31.506989386487184 36.0 32.0 36.0 14.0 36.0 42-43 31.218741910432307 36.0 32.0 36.0 14.0 36.0 44-45 31.33617766611037 36.0 32.0 36.0 14.0 36.0 46-47 31.299974106680477 36.0 32.0 36.0 14.0 36.0 48-49 31.121957534955982 36.0 32.0 36.0 14.0 36.0 50-51 30.926812978340685 36.0 32.0 36.0 14.0 36.0 52-53 30.776612276612276 36.0 32.0 36.0 14.0 36.0 54-55 30.73823145766151 36.0 32.0 36.0 14.0 36.0 56-57 30.475050752765554 36.0 27.0 36.0 14.0 36.0 58-59 30.52107755714163 36.0 27.0 36.0 14.0 36.0 60-61 30.56908001111421 36.0 27.0 36.0 14.0 36.0 62-63 30.592647410161433 36.0 27.0 36.0 14.0 36.0 64-65 30.261085124706028 36.0 27.0 36.0 14.0 36.0 66-67 30.381476369016752 36.0 27.0 36.0 14.0 36.0 68-69 30.163936229978816 36.0 27.0 36.0 14.0 36.0 70-71 30.337709224119443 36.0 27.0 36.0 14.0 36.0 72-73 30.204562982317427 36.0 27.0 36.0 14.0 36.0 74-75 29.962422909341853 36.0 27.0 36.0 14.0 36.0 76 28.951152794060178 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 137.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 7.0 15 8.0 16 3.0 17 7.0 18 7.0 19 7.0 20 21.0 21 27.0 22 32.0 23 48.0 24 62.0 25 96.0 26 125.0 27 167.0 28 255.0 29 274.0 30 374.0 31 426.0 32 487.0 33 553.0 34 607.0 35 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.018897230132023 19.777375097074813 12.39968936060057 38.804038312192596 2 28.630597980843902 27.413926999741133 27.3103805332643 16.64509448615066 3 24.618172404866684 32.151177841056175 21.14936577789283 22.081283976184313 4 27.621019932694796 33.16075588920528 19.622055397359564 19.59616878074036 5 28.527051514367074 34.09267408749677 19.751488480455603 17.62878591768056 6 21.770644576753817 36.914315298990424 22.10717059280352 19.20786953145224 7 22.210717059280352 18.690137199068083 35.8529640176029 23.246181724048668 8 23.32384157390629 22.13305720942273 28.164638881698163 26.37846233497282 9 23.32384157390629 21.822417809992235 29.717835878850636 25.13590473725084 10-11 26.15842609370955 28.138752265078953 22.13305720942273 23.569764431788766 12-13 25.666580377944605 23.47916127362154 25.446544136681336 25.407714211752523 14-15 24.398136163603418 26.313745793424797 25.22650789541807 24.061610147553715 16-17 26.28785917680559 24.229873155578566 23.98395029769609 25.498317369919754 18-19 25.834843385969453 24.70877556303391 25.899559927517473 23.55682112347916 20-21 26.132539477090344 25.614807144706187 24.954698420916387 23.297954957287082 22-23 26.197256018638367 25.912503235827078 23.919233756148074 23.97100698938649 24-25 25.30416774527569 26.02899301061351 24.24281646388817 24.424022780222625 26-27 25.925446544136683 26.132539477090344 24.773492104581933 23.168521874191043 28-29 25.407714211752523 26.106652860471137 23.103805332643024 25.381827595133316 30-31 26.14548278539995 25.35594097851411 24.100440072482527 24.398136163603418 32-33 26.494952109759257 25.77012684442143 23.738027439813617 23.996893606005695 34-35 26.663215117784105 24.721718871343516 24.320476313745793 24.294589697126586 36-37 26.197256018638367 24.889981879368367 24.022780222624903 24.889981879368367 38-39 25.938389852446285 25.575977219777375 24.436966088532227 24.04866683924411 40-41 26.391405643282422 25.317111053585293 23.401501423763914 24.889981879368367 42-43 25.653637069635 26.041936318923113 24.281646388816984 24.022780222624903 44-45 26.51132686084142 26.80906148867314 23.792880258899675 22.88673139158576 46-47 26.77369238736406 25.89331952356292 24.029000517866393 23.303987571206626 48-49 26.307612635939925 25.479026411185913 24.508026929052303 23.70533402382185 50-51 25.909620613751134 25.793085588501878 24.43351029392723 23.86378350381976 52-53 26.638176638176635 25.058275058275058 24.229474229474228 24.074074074074073 54-55 26.965418987177824 25.670249967620773 24.232612355912448 23.131718689288952 56-57 25.404845187200415 26.713304832232154 24.601632335794793 23.280217644772637 58-59 26.830848995463384 25.45690213869086 24.03110823071938 23.681140635126376 60-61 25.600103801738676 25.664979888413132 24.704813805631247 24.030102504216945 62-63 26.23653122160197 27.080358301960278 23.54926651953784 23.13384395689991 64-65 25.79932414868729 25.40940992981544 24.148687288796463 24.642578632700808 66-67 25.159525979945307 25.61531449407475 24.039588488084384 25.18557103789556 68-69 26.39686684073107 24.83028720626632 25.0 23.772845953002612 70-71 25.965187802643637 25.310823190681848 25.022902761418663 23.701086245255855 72-73 25.991305493347383 26.083519957844814 24.713476485311553 23.211698063496243 74-75 27.415981034723192 22.869892623065123 25.352112676056336 24.362013666155345 76 29.54279015240328 0.0 34.97459945291129 35.48261039468542 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 157.0 1 78.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 1.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.5 14 1.5 15 1.5 16 3.5 17 3.0 18 9.5 19 13.5 20 10.0 21 9.0 22 5.5 23 4.0 24 8.5 25 11.5 26 13.5 27 16.0 28 20.5 29 22.0 30 20.0 31 25.5 32 40.0 33 49.5 34 52.5 35 64.0 36 87.0 37 107.5 38 115.5 39 122.5 40 144.5 41 168.5 42 186.0 43 208.5 44 206.0 45 190.0 46 189.0 47 182.5 48 181.0 49 175.0 50 164.5 51 149.5 52 128.5 53 127.0 54 125.5 55 115.0 56 112.5 57 116.0 58 118.0 59 117.0 60 117.0 61 112.0 62 106.0 63 99.0 64 85.5 65 78.5 66 65.5 67 54.0 68 56.5 69 57.5 70 53.0 71 48.5 72 42.0 73 33.5 74 26.0 75 21.5 76 20.0 77 13.5 78 7.5 79 6.0 80 4.0 81 4.5 82 4.5 83 4.0 84 3.5 85 3.0 86 2.0 87 1.0 88 1.0 89 0.5 90 2.5 91 3.0 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 1.5 98 2.0 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 3.4250000000000003 3 3.4250000000000003 4 3.4250000000000003 5 3.4250000000000003 6 3.4250000000000003 7 3.4250000000000003 8 3.4250000000000003 9 3.4250000000000003 10-11 3.4250000000000003 12-13 3.4250000000000003 14-15 3.4250000000000003 16-17 3.4250000000000003 18-19 3.4250000000000003 20-21 3.4250000000000003 22-23 3.4250000000000003 24-25 3.4250000000000003 26-27 3.4250000000000003 28-29 3.4250000000000003 30-31 3.4250000000000003 32-33 3.4250000000000003 34-35 3.4250000000000003 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 137.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 1.0 58 1.0 59 3.0 60 1.0 61 1.0 62 1.0 63 2.0 64 4.0 65 2.0 66 7.0 67 5.0 68 2.0 69 3.0 70 11.0 71 9.0 72 21.0 73 69.0 74 261.0 75 896.0 76 2559.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.72544822049773 91.3 2 1.6323253947016323 3.05 3 0.3746320578003747 1.05 4 0.1337971635001338 0.5 5 0.0 0.0 6 0.08027829810008028 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.02675943270002676 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.02675943270002676 3.4250000000000003 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 137 3.4250000000000003 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 6 0.15 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit ATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.225 0.0 0.0 0.0 0.0 20 0.225 0.0 0.0 0.0 0.0 21 0.25 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.25 0.0 0.0 0.0 0.0 24 0.25 0.0 0.0 0.0 0.0 25 0.25 0.0 0.0 0.0 0.0 26 0.25 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.25 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.25 0.0 0.0 0.0 0.0 31 0.25 0.0 0.0 0.0 0.0 32 0.25 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.25 0.0 0.0 0.0 0.0 39 0.25 0.0 0.0 0.0 0.0 40 0.25 0.0 0.0 0.0 0.0 41 0.25 0.0 0.0 0.0 0.0 42 0.25 0.0 0.0 0.0 0.0 43 0.25 0.0 0.0 0.0 0.0 44 0.25 0.0 0.0 0.0 0.0 45 0.25 0.0 0.0 0.0 0.0 46 0.25 0.0 0.0 0.0 0.0 47 0.25 0.0 0.0 0.0 0.0 48 0.25 0.0 0.0 0.0 0.0 49 0.25 0.0 0.0 0.0 0.0 50 0.25 0.0 0.0 0.0 0.0 51 0.25 0.0 0.0 0.0 0.0 52 0.25 0.0 0.0 0.0 0.0 53 0.25 0.0 0.0 0.0 0.0 54 0.25 0.0 0.0 0.0 0.0 55 0.25 0.0 0.0 0.0 0.0 56 0.25 0.0 0.0 0.0 0.0 57 0.25 0.0 0.0 0.0 0.0 58 0.25 0.0 0.0 0.0 0.0 59 0.25 0.0 0.0 0.0 0.0 60 0.25 0.0 0.0 0.0 0.0 61 0.25 0.0 0.0 0.0 0.0 62 0.25 0.0 0.0 0.0 0.0 63 0.25 0.0 0.0 0.0 0.0 64 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476575 spots for SRR11389832.sra Written 476575 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra Read 476568 spots for SRR11389832.sra Written 476568 spots for SRR11389832.sra SRR ids: ['SRR11389832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytb7ysq0 SRR11389832.sra spots: 9531367 blocks: [[1, 476568], [476569, 953136], [953137, 1429704], [1429705, 1906272], [1906273, 2382840], [2382841, 2859408], [2859409, 3335976], [3335977, 3812544], [3812545, 4289112], [4289113, 4765680], [4765681, 5242248], [5242249, 5718816], [5718817, 6195384], [6195385, 6671952], [6671953, 7148520], [7148521, 7625088], [7625089, 8101656], [8101657, 8578224], [8578225, 9054792], [9054793, 9531367]] SRR11389832 file size 1749312 SRR11389832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389832 SRR11389832_1.fastq SRR11389832_2.fastq Input file: SRR11389832_1.fastq Paired file: SRR11389832_2.fastq trimmed: SRR11389832-trimmed-pair1.fastq, SRR11389832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:44:01 2024 >> started Sat Dec 7 07:44:09 2024 >> done (7.740s) 9531367 read pairs processed; of these: 2461 ( 0.03%) short read pairs filtered out after trimming by size control 671572 ( 7.05%) empty read pairs filtered out after trimming by size control 8857334 (92.93%) read pairs available; of these: 44876 ( 0.51%) trimmed read pairs available after processing 8812458 (99.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1989 0.02% 19 11 0.00% 20 1429 0.02% 21 7 0.00% 22 1274 0.01% 23 10 0.00% 24 1187 0.01% 25 10 0.00% 26 1174 0.01% 27 6 0.00% 28 897 0.01% 29 8 0.00% 30 705 0.01% 31 7 0.00% 32 455 0.01% 33 7 0.00% 34 325 0.00% 35 273 0.00% 36 793 0.01% 37 395 0.00% 38 682 0.01% 39 544 0.01% 40 834 0.01% 41 787 0.01% 42 1086 0.01% 43 1095 0.01% 44 1348 0.02% 45 1438 0.02% 46 1510 0.02% 47 1637 0.02% 48 1802 0.02% 49 2019 0.02% 50 2301 0.03% 51 2637 0.03% 52 2943 0.03% 53 3293 0.04% 54 3462 0.04% 55 4205 0.05% 56 5191 0.06% 57 5247 0.06% 58 5705 0.06% 59 6245 0.07% 60 6412 0.07% 61 6504 0.07% 62 7188 0.08% 63 7854 0.09% 64 8806 0.10% 65 9731 0.11% 66 10071 0.11% 67 11221 0.13% 68 11187 0.13% 69 11881 0.13% 70 12992 0.15% 71 15358 0.17% 72 22710 0.26% 73 87412 0.99% 74 635411 7.17% 75 3884126 43.85% 76 4041497 45.63% 8857334 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.92 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=7.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.8 sequence=TACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.62 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=21.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=CGGCGAGCGCGATGCTTGCGGGCGGCGCCATGGCGCAGGACGTGCTGCTGGGTGCCAACGGCGGCGTGCTGGTGTTCGAGCCGAACGAGTTCAGCGTCAAGGCCGGGGAGACGATCACGTTCAAGAACAACGCCGGGTTCCCCCACAACATCGTGTTCGACGAGGACGCCGTGCCCAGCGGCGTCGACGTCTCCAAGATCTCCCAGGAGGAGTACCTCAACGCCCCCGGCGAGACTTTCTCCGTCACGCTCACTGTCCCTGGCACCTACGGCTTCTACTGCGAGCCACATGCCGGGGCCGGCATGGTCGGCAAGGTCACCGTCAACTGATTGATGCATCGCCCGGCCCGCCTTAATTTCTCCGTTTCAAGGGTGTCAATATATGATGATGTGTTGTTATAATGTACGCGCCTGCAAACTATATACATGCAGGATCATTGATGAGCCAGCTGATACTATATATTTCTCCATCTCTGTGAGTCATATGCT SRR11389832 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:44:38 Started mapping on | Dec 07 07:44:39 Finished on | Dec 07 07:45:25 Mapping speed, Million of reads per hour | 693.18 Number of input reads | 8857334 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 7219409 Uniquely mapped reads % | 81.51% Average mapped length | 149.73 Number of splices: Total | 2816126 Number of splices: Annotated (sjdb) | 2671347 Number of splices: GT/AG | 2780311 Number of splices: GC/AG | 32406 Number of splices: AT/AC | 769 Number of splices: Non-canonical | 2640 Mismatch rate per base, % | 0.82% Deletion rate per base | 0.01% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1146037 % of reads mapped to multiple loci | 12.94% Number of reads mapped to too many loci | 19449 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491888 491888 491888 N_multimapping 1146037 1146037 1146037 N_noFeature 274229 6966997 385952 N_ambiguous 207660 1488 74252 UnstrandedReadsAssigned:6737520 PositiveStrandReadsAssigned:250924 NegativeStrandReadsAssigned:6759205 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389832-trimmed-pair1.fastq SRR11389832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,857,334 reads, 7,912,240 reads pseudoaligned [quant] estimated average fragment length: 184.776 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52973 SRR11389832.ke.tsv 35125 SRR11389832.se.tsv 88098 total ==> SRR11389832.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.333 0 0 PNS24247 1044 860.224 8.46272 1.73584 PNS24249 1928 1744.22 34.6143 3.50159 PNS24246 1044 860.224 8.46272 1.73584 PNS24248 1044 860.224 8.46272 1.73584 PNS24244 1471 1287.22 12.9975 1.78163 PNS24243 293 130.004 0 0 KQK14069 1603 1419.22 589.043 73.2332 KQK14071 474 293.024 23.9844 14.4423 ==> SRR11389832.se.tsv <== BRADI_1g14170v3 655 BRADI_1g53295v3 11 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 66 BRADI_1g74790v3 142 BRADI_1g09890v3 0 BRADI_1g77505v3 85 BRADI_1g48960v3 0 SRR11389832 completed mapping pipeline successfully