Starting /dee2/code/volunteer_pipeline.sh SRR11389833 current disk space = 1544418787328 free memory = 1601335708 SRR11389833 SRAfilesize 5c05fc604f8dcaeacadee5f37416d740 SRR11389833.sra SRR11389833.sra file validated SRR11389833 is paired end SRR11389833 is conventional basespace SRR11389833 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8165 32.0 32.0 32.0 32.0 32.0 2 30.78875 32.0 32.0 32.0 32.0 32.0 3 30.854 32.0 32.0 32.0 32.0 32.0 4 30.9215 32.0 32.0 32.0 32.0 32.0 5 30.89325 32.0 32.0 32.0 32.0 32.0 6 33.7435 36.0 36.0 36.0 32.0 36.0 7 33.795 36.0 36.0 36.0 32.0 36.0 8 33.7815 36.0 36.0 36.0 32.0 36.0 9 33.7375 36.0 36.0 36.0 32.0 36.0 10-11 33.764875 36.0 36.0 36.0 32.0 36.0 12-13 33.842124999999996 36.0 36.0 36.0 32.0 36.0 14-15 33.85375 36.0 36.0 36.0 32.0 36.0 16-17 33.976375000000004 36.0 36.0 36.0 32.0 36.0 18-19 33.850875 36.0 36.0 36.0 32.0 36.0 20-21 33.762 36.0 36.0 36.0 32.0 36.0 22-23 33.655249999999995 36.0 36.0 36.0 29.5 36.0 24-25 33.607 36.0 36.0 36.0 29.5 36.0 26-27 33.371875 36.0 36.0 36.0 24.0 36.0 28-29 33.289625 36.0 36.0 36.0 21.0 36.0 30-31 33.2615 36.0 36.0 36.0 21.0 36.0 32-33 32.9535 36.0 36.0 36.0 14.0 36.0 34-35 33.084375 36.0 36.0 36.0 14.0 36.0 36-37 33.254709871891485 36.0 36.0 36.0 21.0 36.0 38-39 33.28799296659131 36.0 36.0 36.0 17.5 36.0 40-41 33.181110273800556 36.0 36.0 36.0 17.5 36.0 42-43 32.93883446370259 36.0 36.0 36.0 14.0 36.0 44-45 32.90730972117558 36.0 36.0 36.0 14.0 36.0 46-47 33.044723081622635 36.0 36.0 36.0 17.5 36.0 48-49 32.87817390290803 36.0 36.0 36.0 14.0 36.0 50-51 32.62187944109212 36.0 34.0 36.0 14.0 36.0 52-53 32.68789033940175 36.0 34.0 36.0 14.0 36.0 54-55 32.421052631578945 36.0 32.0 36.0 14.0 36.0 56-57 32.37837789467872 36.0 32.0 36.0 14.0 36.0 58-59 32.10117295125936 36.0 32.0 36.0 14.0 36.0 60-61 32.06866985525199 36.0 32.0 36.0 14.0 36.0 62-63 31.95735324164528 36.0 32.0 36.0 14.0 36.0 64-65 32.0702797010569 36.0 32.0 36.0 14.0 36.0 66-67 32.05398209908546 36.0 32.0 36.0 14.0 36.0 68-69 31.934786209348616 36.0 32.0 36.0 14.0 36.0 70-71 32.00335685916199 36.0 32.0 36.0 14.0 36.0 72-73 31.90778241307033 36.0 32.0 36.0 14.0 36.0 74-75 31.60666120933677 36.0 32.0 36.0 14.0 36.0 76 30.30122722201562 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 3.0 22 4.0 23 14.0 24 26.0 25 42.0 26 68.0 27 88.0 28 143.0 29 211.0 30 236.0 31 325.0 32 473.0 33 526.0 34 906.0 35 913.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.122833458929914 10.625470987189148 14.56920371765888 43.682491836222056 2 23.43632253202713 13.740266264757597 33.710123084652096 29.113288118563176 3 23.461441848781714 18.236623963828183 22.682743029389602 35.619191158000504 4 27.60612911328812 26.601356443104745 18.965084149711128 26.827430293896004 5 27.028384827932676 29.891986937955288 21.753328309469982 21.32629992464205 6 21.954282843506657 33.534287867370004 25.92313489073097 18.588294398392364 7 17.533283094699826 28.284350665661893 34.33810600351671 19.844260236121578 8 19.166038683747804 24.74252700326551 30.746043707611154 25.345390605375535 9 20.69831700577744 21.376538558151218 34.1873901029892 23.73775433308214 10-11 22.594825420748556 31.198191409193672 23.235367997990455 22.97161517206732 12-13 24.114544084400904 24.717407686510928 25.83521728208993 25.332830946998243 14-15 22.61994473750314 25.596583772921377 26.72695302687767 25.056518462697813 16-17 23.39864355689525 25.445867872393872 25.445867872393872 25.709620698317003 18-19 22.343632253202713 26.563677467972873 26.38784225069078 24.704848028133636 20-21 24.026626475759862 27.01582516955539 25.106757096206984 23.85079125847777 22-23 22.720422004521478 26.68927405174579 26.136649083144935 24.453654860587793 24-25 22.984174830444612 25.973373524240138 25.571464456166794 25.470987189148453 26-27 23.38608389851796 26.601356443104745 25.533785481034915 24.478774177342377 28-29 23.373524240140668 25.42074855563929 25.521225822657623 25.68450138156242 30-31 23.67495604119568 25.734740015071587 25.92313489073097 24.667169053001757 32-33 22.996734488821904 26.174328058276814 25.62170308967596 25.20723436322532 34-35 22.569706103993973 25.722180356694295 26.287364983672447 25.42074855563929 36-37 23.247927656367747 26.651595076613916 25.219794021602617 24.880683245415725 38-39 23.712635016327553 25.985933182617433 25.84777694046722 24.453654860587793 40-41 23.700075357950265 25.45842753077116 25.810097965335345 25.03139914594323 42-43 22.519467470484802 25.860336598844512 25.50866616428033 26.11152976639036 44-45 23.3232856066315 24.20246169304195 26.48831951770912 25.985933182617433 46-47 23.024745634970483 26.10224846124859 25.763095088556714 25.109910815224218 48-49 22.40100565681961 25.16656191074796 26.77561282212445 25.656819610307984 50-51 22.89701999245568 25.29862944800704 26.053061737709037 25.75128882182824 52-53 23.51756263376558 25.380838474128165 24.60027697343573 26.501321918670527 54-55 22.57617728531856 25.736590279526567 25.812138000503655 25.87509443465122 56-57 22.962589746819496 25.053533190578158 25.658143342990304 26.325733719612042 58-59 21.847045483180043 25.32442988534711 26.748141615219858 26.080383016252995 60-61 22.971096806765114 25.369178341537296 26.53035466363751 25.12937018806008 62-63 23.07012002526848 25.319014529374606 25.950726468730256 25.660138976626655 64-65 24.32603467915454 24.401974433615997 26.09796228325528 25.17402860397418 66-67 22.90899860388374 24.736641705800228 27.071963447137964 25.282396243178066 68-69 23.916634896429027 23.942051086542126 25.82284915491168 26.318464862117168 70-71 23.923566878980893 25.452229299363054 25.872611464968152 24.751592356687897 72-73 23.158703727424108 24.18342513129243 26.591520430382992 26.066350710900476 74-75 23.95427034297243 22.62273032952253 26.41560188298588 27.007397444519164 76 25.399776868724434 0.0 37.560431387132766 37.0397917441428 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 34.0 1 20.0 2 3.5 3 1.5 4 2.0 5 2.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 1.5 16 2.5 17 1.5 18 7.0 19 11.5 20 20.5 21 33.0 22 28.5 23 21.5 24 14.5 25 8.0 26 11.0 27 16.5 28 16.5 29 18.0 30 19.0 31 30.0 32 41.5 33 41.5 34 48.5 35 63.0 36 86.0 37 116.5 38 144.5 39 159.0 40 167.0 41 184.0 42 197.5 43 207.0 44 220.5 45 213.5 46 203.0 47 196.5 48 188.5 49 181.5 50 173.5 51 161.5 52 141.0 53 133.5 54 135.0 55 116.5 56 99.5 57 112.0 58 126.5 59 112.0 60 88.0 61 94.0 62 104.0 63 87.5 64 77.5 65 73.0 66 57.5 67 48.5 68 48.0 69 42.5 70 39.0 71 42.5 72 40.5 73 42.5 74 36.0 75 23.5 76 20.5 77 17.5 78 14.0 79 12.0 80 9.0 81 5.0 82 3.0 83 1.5 84 1.5 85 1.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.475 3 0.475 4 0.475 5 0.475 6 0.475 7 0.475 8 0.475 9 0.475 10-11 0.475 12-13 0.475 14-15 0.475 16-17 0.475 18-19 0.475 20-21 0.475 22-23 0.475 24-25 0.475 26-27 0.475 28-29 0.475 30-31 0.475 32-33 0.475 34-35 0.475 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 19.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 2.0 48 1.0 49 0.0 50 1.0 51 4.0 52 1.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 1.0 59 5.0 60 3.0 61 0.0 62 5.0 63 3.0 64 3.0 65 7.0 66 5.0 67 0.0 68 5.0 69 5.0 70 4.0 71 9.0 72 21.0 73 55.0 74 241.0 75 908.0 76 2689.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.23538704581358 92.325 2 1.9747235387045814 3.75 3 0.421274354923644 1.2 4 0.18430753027909424 0.7000000000000001 5 0.0526592943654555 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02632964718272775 0.2 9 0.02632964718272775 0.22499999999999998 >10 0.07898894154818326 1.35 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 19 0.475 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 18 0.44999999999999996 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 17 0.42500000000000004 No Hit GCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTT 9 0.22499999999999998 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 8 0.2 No Hit TCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCT 5 0.125 No Hit CTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389833 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.51375 32.0 32.0 32.0 32.0 32.0 2 30.27425 32.0 32.0 32.0 21.0 32.0 3 30.43475 32.0 32.0 32.0 32.0 32.0 4 30.27625 32.0 32.0 32.0 21.0 32.0 5 30.227 32.0 32.0 32.0 21.0 32.0 6 33.60125 36.0 36.0 36.0 32.0 36.0 7 33.2735 36.0 36.0 36.0 21.0 36.0 8 33.22375 36.0 36.0 36.0 21.0 36.0 9 33.295 36.0 36.0 36.0 21.0 36.0 10-11 33.392875000000004 36.0 36.0 36.0 21.0 36.0 12-13 33.362750000000005 36.0 36.0 36.0 21.0 36.0 14-15 33.486875 36.0 36.0 36.0 21.0 36.0 16-17 33.435249999999996 36.0 36.0 36.0 21.0 36.0 18-19 33.02075 36.0 36.0 36.0 17.5 36.0 20-21 33.042 36.0 36.0 36.0 17.5 36.0 22-23 33.227375 36.0 36.0 36.0 21.0 36.0 24-25 32.99925 36.0 36.0 36.0 14.0 36.0 26-27 32.897875 36.0 36.0 36.0 14.0 36.0 28-29 32.936625 36.0 36.0 36.0 14.0 36.0 30-31 33.09125 36.0 36.0 36.0 14.0 36.0 32-33 32.92125 36.0 36.0 36.0 14.0 36.0 34-35 32.74225 36.0 36.0 36.0 14.0 36.0 36-37 32.891959798994975 36.0 36.0 36.0 14.0 36.0 38-39 32.825502512562814 36.0 36.0 36.0 14.0 36.0 40-41 32.68304020100503 36.0 34.0 36.0 14.0 36.0 42-43 32.643844221105525 36.0 34.0 36.0 14.0 36.0 44-45 32.642964824120604 36.0 36.0 36.0 14.0 36.0 46-47 32.59893530229685 36.0 36.0 36.0 14.0 36.0 48-49 32.49728472039175 36.0 34.0 36.0 14.0 36.0 50-51 32.44484767093125 36.0 34.0 36.0 14.0 36.0 52-53 32.22679378263189 36.0 32.0 36.0 14.0 36.0 54-55 32.19899244332494 36.0 32.0 36.0 14.0 36.0 56-57 31.95249867420086 36.0 32.0 36.0 14.0 36.0 58-59 32.081160628613475 36.0 32.0 36.0 14.0 36.0 60-61 31.956424374574368 36.0 32.0 36.0 14.0 36.0 62-63 31.898314226895483 36.0 32.0 36.0 14.0 36.0 64-65 31.872886245565933 36.0 32.0 36.0 14.0 36.0 66-67 31.94775721433714 36.0 32.0 36.0 14.0 36.0 68-69 31.756695151168316 36.0 32.0 36.0 14.0 36.0 70-71 31.788124736487852 36.0 32.0 36.0 14.0 36.0 72-73 31.625665402928558 36.0 32.0 36.0 14.0 36.0 74-75 31.510678835950575 36.0 32.0 36.0 14.0 36.0 76 29.530308806709876 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 11.0 16 10.0 17 8.0 18 5.0 19 8.0 20 8.0 21 9.0 22 12.0 23 21.0 24 28.0 25 49.0 26 79.0 27 101.0 28 141.0 29 195.0 30 248.0 31 319.0 32 441.0 33 571.0 34 910.0 35 803.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.92964824120603 19.17085427135678 13.090452261306531 36.80904522613066 2 28.643216080402013 25.95477386934673 26.38190954773869 19.020100502512562 3 26.28140703517588 29.04522613065327 19.899497487437188 24.77386934673367 4 28.618090452261306 32.185929648241206 18.291457286432163 20.90452261306533 5 30.778894472361806 34.04522613065327 18.44221105527638 16.733668341708544 6 22.889447236180903 35.92964824120603 21.231155778894472 19.949748743718594 7 22.286432160804022 18.894472361809044 34.949748743718594 23.869346733668344 8 24.472361809045225 21.758793969849247 27.33668341708543 26.4321608040201 9 23.115577889447238 22.688442211055275 28.316582914572862 25.879396984924625 10-11 27.261306532663315 28.32914572864322 20.829145728643216 23.580402010050253 12-13 26.532663316582916 22.449748743718594 24.459798994974875 26.55778894472362 14-15 25.364321608040203 26.507537688442213 24.309045226130653 23.819095477386934 16-17 26.670854271356788 24.78643216080402 24.459798994974875 24.082914572864322 18-19 25.48994974874372 24.87437185929648 25.56532663316583 24.07035175879397 20-21 26.733668341708544 24.309045226130653 24.635678391959797 24.321608040201003 22-23 26.36934673366834 26.168341708542712 23.517587939698494 23.944723618090453 24-25 26.293969849246228 25.42713567839196 24.44723618090452 23.831658291457288 26-27 25.364321608040203 26.306532663316585 24.522613065326635 23.80653266331658 28-29 25.95477386934673 25.90452261306533 24.459798994974875 23.680904522613066 30-31 26.331658291457288 25.66582914572864 23.555276381909547 24.44723618090452 32-33 26.218592964824122 26.80904522613065 24.28391959798995 22.688442211055275 34-35 26.482412060301506 25.678391959798997 23.492462311557787 24.34673366834171 36-37 25.90452261306533 25.301507537688444 24.610552763819097 24.183417085427138 38-39 25.515075376884422 26.670854271356788 23.80653266331658 24.00753768844221 40-41 26.41959798994975 25.85427135678392 23.530150753768844 24.195979899497488 42-43 26.28140703517588 26.306532663316585 24.082914572864322 23.329145728643216 44-45 24.811557788944725 26.84673366834171 24.547738693467338 23.79396984924623 46-47 26.045985676592537 25.870084181429824 23.98542530468652 24.098504837291117 48-49 24.506475543819942 25.487237520432544 25.05972588960141 24.94656104614611 50-51 25.31757011696642 25.68230411269023 25.493648597660673 23.506477172682683 52-53 25.11018763379927 25.563531041430547 24.82055156781262 24.50572975695756 54-55 24.710327455919394 26.09571788413098 24.370277078085643 24.82367758186398 56-57 24.644072067531813 26.06778379740456 24.933854101045736 24.354290034017893 58-59 25.507246376811594 26.099558916194077 24.360428481411468 24.03276622558286 60-61 26.32243403610655 25.148339856078778 24.744350460800405 23.784875647014267 62-63 25.17376469101479 26.41223303424744 24.60508024769367 23.808922027044105 64-65 26.484365109507536 26.06659070768452 23.559944296746423 23.889099886061526 66-67 25.24123920771966 25.952260030472317 24.898425596749618 23.908075165058403 68-69 25.556261919898283 25.149396058486968 24.742530197075652 24.551811824539097 70-71 24.80886850152905 26.55453618756371 24.732415902140673 23.904179408766566 72-73 25.75465639049454 25.728965960179835 24.482980089916506 24.03339755940912 74-75 25.561453654552878 22.88008711038519 26.473390499523614 25.085068735538314 76 28.364468166221883 0.0 37.59054517727793 34.04498665650019 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 34.0 1 18.0 2 1.0 3 1.0 4 2.0 5 2.5 6 2.0 7 0.5 8 0.0 9 0.5 10 0.5 11 1.0 12 2.0 13 1.5 14 1.0 15 0.5 16 0.5 17 2.0 18 8.5 19 14.5 20 10.0 21 5.0 22 8.5 23 10.0 24 8.0 25 9.5 26 9.5 27 12.0 28 15.0 29 16.5 30 22.5 31 36.0 32 48.0 33 44.0 34 48.0 35 74.5 36 88.5 37 91.5 38 115.0 39 140.0 40 157.0 41 165.5 42 162.5 43 186.0 44 208.0 45 205.5 46 196.0 47 183.0 48 171.5 49 163.5 50 159.0 51 151.5 52 142.5 53 133.0 54 126.5 55 124.5 56 126.0 57 129.5 58 133.5 59 138.0 60 144.0 61 128.5 62 109.0 63 97.5 64 86.5 65 83.5 66 76.5 67 71.5 68 64.5 69 57.5 70 51.5 71 43.0 72 41.0 73 38.0 74 26.5 75 16.5 76 15.0 77 15.5 78 10.5 79 5.0 80 6.5 81 6.0 82 2.5 83 1.0 84 1.0 85 1.0 86 1.5 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10-11 0.5 12-13 0.5 14-15 0.5 16-17 0.5 18-19 0.5 20-21 0.5 22-23 0.5 24-25 0.5 26-27 0.5 28-29 0.5 30-31 0.5 32-33 0.5 34-35 0.5 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 20.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 2.0 48 1.0 49 0.0 50 1.0 51 4.0 52 1.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 1.0 59 5.0 60 3.0 61 0.0 62 5.0 63 3.0 64 3.0 65 7.0 66 6.0 67 0.0 68 5.0 69 4.0 70 4.0 71 15.0 72 29.0 73 83.0 74 243.0 75 929.0 76 2623.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57370206104878 93.5 2 1.5914427341507955 3.05 3 0.4174276024002087 1.2 4 0.20871380120010435 0.8 5 0.15653535090007828 0.75 6 0.0 0.0 7 0.0 0.0 8 0.026089225150013044 0.2 9 0.0 0.0 >10 0.026089225150013044 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 0.2 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTT 5 0.125 No Hit TCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGC 5 0.125 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 5 0.125 No Hit GAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTAC 5 0.125 No Hit CGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580751 spots for SRR11389833.sra Written 580751 spots for SRR11389833.sra Read 580766 spots for SRR11389833.sra Written 580766 spots for SRR11389833.sra SRR ids: ['SRR11389833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmp864md SRR11389833.sra spots: 11615035 blocks: [[1, 580751], [580752, 1161502], [1161503, 1742253], [1742254, 2323004], [2323005, 2903755], [2903756, 3484506], [3484507, 4065257], [4065258, 4646008], [4646009, 5226759], [5226760, 5807510], [5807511, 6388261], [6388262, 6969012], [6969013, 7549763], [7549764, 8130514], [8130515, 8711265], [8711266, 9292016], [9292017, 9872767], [9872768, 10453518], [10453519, 11034269], [11034270, 11615035]] SRR11389833 file size 2186431 SRR11389833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389833 SRR11389833_1.fastq SRR11389833_2.fastq Input file: SRR11389833_1.fastq Paired file: SRR11389833_2.fastq trimmed: SRR11389833-trimmed-pair1.fastq, SRR11389833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:45:36 2024 >> started Sat Dec 7 07:45:46 2024 >> done (10.361s) 11615035 read pairs processed; of these: 310 ( 0.00%) short read pairs filtered out after trimming by size control 175848 ( 1.51%) empty read pairs filtered out after trimming by size control 11438877 (98.48%) read pairs available; of these: 44787 ( 0.39%) trimmed read pairs available after processing 11394090 (99.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 206 0.00% 19 2 0.00% 20 188 0.00% 21 3 0.00% 22 165 0.00% 23 2 0.00% 24 164 0.00% 25 2 0.00% 26 253 0.00% 27 4 0.00% 28 226 0.00% 29 2 0.00% 30 103 0.00% 31 3 0.00% 32 79 0.00% 33 2 0.00% 34 56 0.00% 35 368 0.00% 36 695 0.01% 37 498 0.00% 38 756 0.01% 39 709 0.01% 40 1073 0.01% 41 1039 0.01% 42 1361 0.01% 43 1380 0.01% 44 1701 0.01% 45 1788 0.02% 46 1893 0.02% 47 2113 0.02% 48 2493 0.02% 49 2556 0.02% 50 3023 0.03% 51 3357 0.03% 52 3650 0.03% 53 4146 0.04% 54 4554 0.04% 55 5278 0.05% 56 5781 0.05% 57 6158 0.05% 58 6777 0.06% 59 7516 0.07% 60 8030 0.07% 61 8666 0.08% 62 9609 0.08% 63 10370 0.09% 64 11717 0.10% 65 12448 0.11% 66 13195 0.12% 67 14602 0.13% 68 14565 0.13% 69 16067 0.14% 70 17845 0.16% 71 21498 0.19% 72 31205 0.27% 73 115871 1.01% 74 826804 7.23% 75 5074024 44.36% 76 5160238 45.11% 11438877 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=22 fanout-score=5.04 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=2.2 sequence=ACGCTGCCGAGACCAGCGCTGGCTGAGCGGCGGCCGATGGGGAGCCCGGCGGTGGA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.71 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=14.73 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389833 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:46:14 Started mapping on | Dec 07 07:46:15 Finished on | Dec 07 07:47:19 Mapping speed, Million of reads per hour | 643.44 Number of input reads | 11438877 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9330506 Uniquely mapped reads % | 81.57% Average mapped length | 149.83 Number of splices: Total | 3792791 Number of splices: Annotated (sjdb) | 3604079 Number of splices: GT/AG | 3742609 Number of splices: GC/AG | 45560 Number of splices: AT/AC | 1089 Number of splices: Non-canonical | 3533 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.01% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1431285 % of reads mapped to multiple loci | 12.51% Number of reads mapped to too many loci | 28576 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 677086 677086 677086 N_multimapping 1431285 1431285 1431285 N_noFeature 326055 8975238 503840 N_ambiguous 255770 2167 84470 UnstrandedReadsAssigned:8748681 PositiveStrandReadsAssigned:353101 NegativeStrandReadsAssigned:8742196 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389833-trimmed-pair1.fastq SRR11389833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,438,877 reads, 10,174,866 reads pseudoaligned [quant] estimated average fragment length: 175.568 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52973 SRR11389833.ke.tsv 35125 SRR11389833.se.tsv 88098 total ==> SRR11389833.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 761.522 0 0 PNS24247 1044 869.432 12.4378 1.96421 PNS24249 1928 1753.43 43.5069 3.40682 PNS24246 1044 869.432 12.4378 1.96421 PNS24248 1044 869.432 12.4378 1.96421 PNS24244 1471 1296.43 24.1797 2.56083 PNS24243 293 135.877 0 0 KQK14069 1603 1428.43 405.405 38.9681 KQK14071 474 301.49 24.1614 11.0034 ==> SRR11389833.se.tsv <== BRADI_1g14170v3 463 BRADI_1g53295v3 15 BRADI_1g59795v3 124 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 99 BRADI_1g74790v3 187 BRADI_1g09890v3 0 BRADI_1g77505v3 95 BRADI_1g48960v3 0 SRR11389833 completed mapping pipeline successfully