Starting /dee2/code/volunteer_pipeline.sh SRR11389835 current disk space = 1544476491776 free memory = 1600834672 SRR11389835 SRAfilesize 345dd507428388f91fd70a4f57076414 SRR11389835.sra SRR11389835.sra file validated SRR11389835 is paired end SRR11389835 is conventional basespace SRR11389835 read1 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.993 32.0 32.0 32.0 32.0 32.0 2 31.008 32.0 32.0 32.0 32.0 32.0 3 31.07275 32.0 32.0 32.0 32.0 32.0 4 31.0805 32.0 32.0 32.0 32.0 32.0 5 31.08275 32.0 32.0 32.0 32.0 32.0 6 33.8535 36.0 36.0 36.0 32.0 36.0 7 34.10175 36.0 36.0 36.0 32.0 36.0 8 34.00625 36.0 36.0 36.0 32.0 36.0 9 33.904 36.0 36.0 36.0 32.0 36.0 10-11 33.994625 36.0 36.0 36.0 32.0 36.0 12-13 34.027375000000006 36.0 36.0 36.0 32.0 36.0 14-15 34.05525 36.0 36.0 36.0 32.0 36.0 16-17 33.89475 36.0 36.0 36.0 32.0 36.0 18-19 33.929 36.0 36.0 36.0 32.0 36.0 20-21 33.968374999999995 36.0 36.0 36.0 32.0 36.0 22-23 33.708 36.0 36.0 36.0 29.5 36.0 24-25 33.836 36.0 36.0 36.0 32.0 36.0 26-27 33.620625000000004 36.0 36.0 36.0 27.0 36.0 28-29 33.460875 36.0 36.0 36.0 24.0 36.0 30-31 33.508875 36.0 36.0 36.0 27.0 36.0 32-33 33.387 36.0 36.0 36.0 24.0 36.0 34-35 33.151624999999996 36.0 36.0 36.0 17.5 36.0 36-37 33.328 36.0 36.0 36.0 17.5 36.0 38-39 33.227374999999995 36.0 36.0 36.0 17.5 36.0 40-41 33.332625 36.0 36.0 36.0 21.0 36.0 42-43 33.13225 36.0 36.0 36.0 17.5 36.0 44-45 32.83667033566796 36.0 36.0 36.0 14.0 36.0 46-47 32.8615169071022 36.0 36.0 36.0 14.0 36.0 48-49 32.62665832290363 36.0 36.0 36.0 14.0 36.0 50-51 32.45525165724031 36.0 34.0 36.0 14.0 36.0 52-53 32.291426422662326 36.0 32.0 36.0 14.0 36.0 54-55 32.06999100001859 36.0 32.0 36.0 14.0 36.0 56-57 32.08066261422749 36.0 32.0 36.0 14.0 36.0 58-59 32.15467806841046 36.0 32.0 36.0 14.0 36.0 60-61 31.967166046961935 36.0 32.0 36.0 14.0 36.0 62-63 31.848888992871327 36.0 32.0 36.0 14.0 36.0 64-65 32.02525423512155 36.0 32.0 36.0 14.0 36.0 66-67 31.741148915081183 36.0 32.0 36.0 14.0 36.0 68-69 31.856671021701516 36.0 32.0 36.0 14.0 36.0 70-71 31.671890251297512 36.0 32.0 36.0 14.0 36.0 72-73 31.57619511157023 36.0 32.0 36.0 14.0 36.0 74-75 31.45412145109855 36.0 32.0 36.0 14.0 36.0 76 29.938066465256796 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 3.0 22 13.0 23 14.0 24 30.0 25 62.0 26 81.0 27 105.0 28 145.0 29 179.0 30 230.0 31 340.0 32 397.0 33 588.0 34 855.0 35 955.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.4 10.299999999999999 15.299999999999999 39.0 2 22.675 16.0 30.8 30.525000000000002 3 24.4 17.5 24.675 33.425 4 28.4 24.725 20.674999999999997 26.200000000000003 5 27.400000000000002 28.475 22.975 21.15 6 22.825 31.825 25.7 19.650000000000002 7 17.525 28.875 34.449999999999996 19.15 8 18.375 26.950000000000003 31.075000000000003 23.599999999999998 9 21.0 22.825 32.775 23.400000000000002 10-11 21.875 31.4875 24.0 22.6375 12-13 23.075000000000003 25.912499999999998 26.3625 24.65 14-15 21.625 27.525 27.224999999999998 23.625 16-17 23.1875 26.737499999999997 25.2 24.875 18-19 21.837500000000002 26.525 26.974999999999998 24.6625 20-21 23.3875 26.025 26.7125 23.875 22-23 22.325 28.325 25.387500000000003 23.962500000000002 24-25 22.35 26.200000000000003 26.437500000000004 25.0125 26-27 21.9625 25.900000000000002 25.525 26.6125 28-29 23.150000000000002 25.8 26.625 24.425 30-31 22.925 26.0625 26.6625 24.349999999999998 32-33 22.15 26.700000000000003 26.0375 25.112499999999997 34-35 23.2375 27.1625 26.174999999999997 23.425 36-37 21.375 26.825 26.9625 24.837500000000002 38-39 22.2625 25.674999999999997 27.037499999999998 25.025 40-41 23.599999999999998 25.6 26.987499999999997 23.8125 42-43 23.3125 26.8 26.687499999999996 23.200000000000003 44-45 22.12079529823684 25.872202075778418 27.047642866074778 24.959359759909965 46-47 23.742807105328996 25.9819864898674 25.869402051538653 24.405804353264948 48-49 22.252816020025033 26.846057571964955 26.382978723404253 24.518147684605758 50-51 22.74264245460238 25.87351283656857 27.73951158422041 23.64433312460864 52-53 23.414389571321134 24.85585359739283 24.555026322386563 27.174730508899476 54-55 22.502510040160644 26.44327309236948 25.903614457831324 25.150602409638555 56-57 22.078411661221413 25.760241266649913 26.82834883136466 25.33299824076401 58-59 23.201710261569417 25.51559356136821 26.62223340040241 24.660462776659962 60-61 23.694475902856425 25.921731470995347 26.827733736001008 23.556058890147224 62-63 22.74331820474029 26.386787695410995 26.462430660615226 24.407463439233485 64-65 23.764378713184172 24.661863228416127 27.455441789912783 24.118316268486918 66-67 23.288539553752535 25.786004056795132 26.140973630831642 24.78448275862069 68-69 22.661413319776308 26.169293340111842 25.965937976614136 25.203355363497714 70-71 22.11599745060548 25.59592096876992 26.131293817718294 26.15678776290631 72-73 23.169637132965764 25.977689447365048 26.298243364533914 24.554430055135274 74-75 22.868741542625166 22.922868741542626 27.834912043301756 26.37347767253045 76 26.51057401812689 0.0 35.68731117824773 37.80211480362537 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 47.0 1 31.0 2 11.5 3 5.5 4 3.0 5 2.0 6 2.0 7 1.5 8 0.5 9 0.5 10 1.5 11 3.0 12 3.0 13 1.5 14 0.0 15 0.5 16 1.0 17 2.5 18 11.5 19 17.5 20 23.5 21 32.5 22 25.5 23 19.0 24 16.0 25 12.0 26 12.5 27 17.5 28 22.0 29 22.5 30 30.0 31 35.5 32 40.5 33 45.5 34 46.5 35 64.5 36 88.5 37 104.0 38 134.0 39 151.0 40 145.5 41 168.5 42 197.5 43 207.5 44 223.5 45 213.5 46 203.5 47 218.5 48 217.5 49 188.0 50 166.0 51 165.5 52 147.0 53 125.0 54 113.0 55 105.5 56 102.0 57 102.5 58 110.0 59 118.0 60 120.0 61 105.0 62 90.5 63 81.0 64 64.5 65 62.0 66 57.0 67 48.0 68 44.0 69 33.5 70 34.5 71 41.5 72 34.5 73 26.5 74 30.5 75 30.0 76 20.0 77 15.0 78 10.5 79 5.5 80 5.5 81 7.0 82 5.5 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 1.0 45 0.0 46 2.0 47 1.0 48 0.0 49 1.0 50 3.0 51 2.0 52 0.0 53 4.0 54 2.0 55 3.0 56 2.0 57 2.0 58 0.0 59 2.0 60 1.0 61 5.0 62 4.0 63 3.0 64 11.0 65 3.0 66 6.0 67 3.0 68 8.0 69 3.0 70 9.0 71 10.0 72 17.0 73 69.0 74 254.0 75 920.0 76 2648.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.7134905910416 91.225 2 2.2263450834879404 4.2 3 0.8216273522395972 2.325 4 0.0795123244102836 0.3 5 0.026504108136761195 0.125 6 0.026504108136761195 0.15 7 0.0 0.0 8 0.026504108136761195 0.2 9 0.026504108136761195 0.22499999999999998 >10 0.05300821627352239 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37 0.9249999999999999 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 13 0.325 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTT 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCGCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389835 read2 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.259 32.0 32.0 32.0 21.0 32.0 2 29.818 32.0 32.0 32.0 14.0 32.0 3 29.8115 32.0 32.0 32.0 14.0 32.0 4 29.82575 32.0 32.0 32.0 21.0 32.0 5 29.7175 32.0 32.0 32.0 14.0 32.0 6 32.8025 36.0 36.0 36.0 14.0 36.0 7 32.871 36.0 36.0 36.0 21.0 36.0 8 32.49175 36.0 36.0 36.0 14.0 36.0 9 32.4755 36.0 36.0 36.0 14.0 36.0 10-11 32.444 36.0 34.0 36.0 14.0 36.0 12-13 32.516000000000005 36.0 34.0 36.0 14.0 36.0 14-15 32.501 36.0 36.0 36.0 14.0 36.0 16-17 32.615625 36.0 34.0 36.0 14.0 36.0 18-19 32.38225 36.0 34.0 36.0 14.0 36.0 20-21 32.193 36.0 34.0 36.0 14.0 36.0 22-23 32.299625 36.0 32.0 36.0 14.0 36.0 24-25 32.188625 36.0 34.0 36.0 14.0 36.0 26-27 32.16 36.0 32.0 36.0 14.0 36.0 28-29 31.86425 36.0 32.0 36.0 14.0 36.0 30-31 32.042874999999995 36.0 32.0 36.0 14.0 36.0 32-33 31.9965 36.0 32.0 36.0 14.0 36.0 34-35 31.761375 36.0 32.0 36.0 14.0 36.0 36-37 31.643125 36.0 32.0 36.0 14.0 36.0 38-39 31.725625 36.0 32.0 36.0 14.0 36.0 40-41 31.62775 36.0 32.0 36.0 14.0 36.0 42-43 31.490250000000003 36.0 32.0 36.0 14.0 36.0 44-45 31.43564633654662 36.0 32.0 36.0 14.0 36.0 46-47 31.517633942096175 36.0 32.0 36.0 14.0 36.0 48-49 31.366366366366364 36.0 32.0 36.0 14.0 36.0 50-51 31.19292383264652 36.0 32.0 36.0 14.0 36.0 52-53 31.097243107769422 36.0 32.0 36.0 14.0 36.0 54-55 31.05405295290545 36.0 32.0 36.0 14.0 36.0 56-57 30.87333393559089 36.0 29.5 36.0 14.0 36.0 58-59 30.81627263581489 36.0 32.0 36.0 14.0 36.0 60-61 30.71206154248779 36.0 29.5 36.0 14.0 36.0 62-63 30.81422609432473 36.0 29.5 36.0 14.0 36.0 64-65 30.84985082401516 36.0 29.5 36.0 14.0 36.0 66-67 30.6110666461513 36.0 27.0 36.0 14.0 36.0 68-69 30.699625064872865 36.0 29.5 36.0 14.0 36.0 70-71 30.76277802161842 36.0 29.5 36.0 14.0 36.0 72-73 30.669344649013777 36.0 27.0 36.0 14.0 36.0 74-75 30.253656902180666 36.0 27.0 36.0 14.0 36.0 76 29.038401861908458 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 30.0 16 38.0 17 36.0 18 28.0 19 17.0 20 21.0 21 18.0 22 27.0 23 27.0 24 49.0 25 80.0 26 93.0 27 139.0 28 167.0 29 222.0 30 273.0 31 368.0 32 489.0 33 570.0 34 789.0 35 513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.375 16.975 14.674999999999999 33.975 2 29.75 25.074999999999996 25.124999999999996 20.05 3 30.4 26.950000000000003 18.925 23.724999999999998 4 32.2 30.9 17.25 19.650000000000002 5 31.324999999999996 31.225 20.375 17.075000000000003 6 25.275 33.85 21.875 19.0 7 24.425 19.325 32.9 23.35 8 26.200000000000003 23.974999999999998 24.775 25.05 9 23.95 22.75 29.45 23.849999999999998 10-11 27.925 27.737499999999997 21.087500000000002 23.25 12-13 28.075 22.400000000000002 24.1625 25.362499999999997 14-15 27.1125 25.937500000000004 23.6875 23.2625 16-17 27.8375 24.6875 23.45 24.025 18-19 25.874999999999996 25.074999999999996 25.1 23.95 20-21 27.0625 24.6875 25.8125 22.4375 22-23 27.525 25.924999999999997 24.0625 22.4875 24-25 26.400000000000002 26.0625 24.5125 23.025000000000002 26-27 26.3 25.112499999999997 25.624999999999996 22.9625 28-29 26.8125 25.3 24.15 23.7375 30-31 26.1 25.0625 25.0 23.8375 32-33 26.4625 25.8 24.85 22.8875 34-35 26.987499999999997 25.7125 24.087500000000002 23.2125 36-37 26.7125 25.674999999999997 24.3625 23.25 38-39 26.650000000000002 25.837500000000002 24.1125 23.400000000000002 40-41 26.424999999999997 26.275 24.2625 23.0375 42-43 26.825 25.75 25.124999999999996 22.3 44-45 25.94723021132925 26.672502188320617 24.871826935100664 22.50844066524947 46-47 26.507380535401552 25.106329747310486 24.74355766825119 23.642732049036777 48-49 24.81231231231231 25.38788788788789 25.93843843843844 23.86136136136136 50-51 26.117440841367223 25.053211468636533 25.178414924251907 23.650932765744333 52-53 26.604010025062657 25.426065162907268 24.837092731829575 23.1328320802005 54-55 27.289836888331244 25.796737766624844 23.801756587202007 23.111668757841908 56-57 26.595477386934675 25.791457286432163 24.597989949748744 23.015075376884422 58-59 26.597082494969822 26.62223340040241 24.019114688128774 22.761569416498993 60-61 26.399899333081667 25.883981376620106 24.675978356612557 23.040140933685667 62-63 27.49621785173979 26.853252647503783 23.461926374180532 22.188603126575895 64-65 27.240551131336115 25.154847680444952 24.270003792188092 23.334597396030844 66-67 26.51793636709342 26.467232855875267 24.439092407149197 22.575738369882114 68-69 26.000762485703394 25.772016774685476 25.07307154657517 23.154149193035963 70-71 26.028793476876032 25.480952987641736 25.098738692827112 23.391514842655113 72-73 26.316465450809147 25.533007963010533 24.86514256357565 23.285384022604674 74-75 26.66575641725833 23.89404696886947 25.914800655379572 23.525395958492627 76 28.355314197051978 0.0 35.6865787432118 35.95810705973623 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 55.0 1 27.5 2 0.5 3 2.0 4 3.0 5 2.0 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 0.5 12 1.0 13 2.5 14 2.0 15 1.5 16 3.5 17 3.0 18 5.0 19 10.5 20 12.0 21 8.5 22 7.5 23 8.0 24 11.5 25 15.0 26 12.0 27 11.5 28 17.0 29 22.5 30 25.5 31 35.0 32 40.5 33 37.5 34 47.0 35 65.5 36 85.0 37 99.5 38 116.5 39 136.0 40 147.0 41 160.0 42 166.0 43 182.0 44 199.0 45 197.5 46 209.0 47 203.0 48 176.5 49 164.0 50 155.0 51 146.5 52 133.0 53 130.5 54 136.5 55 132.5 56 122.0 57 123.5 58 131.0 59 129.0 60 120.0 61 108.5 62 106.5 63 95.0 64 88.5 65 86.5 66 79.5 67 79.0 68 73.5 69 58.0 70 39.5 71 33.5 72 45.0 73 44.0 74 29.5 75 26.0 76 22.0 77 18.0 78 16.5 79 13.5 80 7.0 81 4.5 82 6.0 83 5.0 84 5.0 85 5.0 86 5.5 87 5.0 88 4.0 89 3.5 90 1.5 91 1.5 92 3.0 93 2.5 94 1.0 95 0.0 96 0.0 97 1.0 98 2.0 99 9.0 100 16.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 1.0 45 0.0 46 2.0 47 0.0 48 0.0 49 1.0 50 3.0 51 2.0 52 0.0 53 4.0 54 2.0 55 3.0 56 2.0 57 3.0 58 0.0 59 2.0 60 1.0 61 5.0 62 4.0 63 3.0 64 11.0 65 2.0 66 7.0 67 3.0 68 7.0 69 2.0 70 9.0 71 13.0 72 28.0 73 71.0 74 292.0 75 938.0 76 2578.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.53668763102725 93.05 2 1.7033542976939202 3.25 3 0.4979035639412998 1.425 4 0.052410901467505246 0.2 5 0.10482180293501049 0.5 6 0.026205450733752623 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07861635220125787 1.425 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19 0.475 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 18 0.44999999999999996 No Hit CTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCA 6 0.15 No Hit CCGGTAGATACTATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAACAAAATAAAAAG 5 0.125 No Hit GCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGG 5 0.125 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit CCGAAATCTTTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra Read 703226 spots for SRR11389835.sra Written 703226 spots for SRR11389835.sra SRR ids: ['SRR11389835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x7o9_2qe SRR11389835.sra spots: 14064520 blocks: [[1, 703226], [703227, 1406452], [1406453, 2109678], [2109679, 2812904], [2812905, 3516130], [3516131, 4219356], [4219357, 4922582], [4922583, 5625808], [5625809, 6329034], [6329035, 7032260], [7032261, 7735486], [7735487, 8438712], [8438713, 9141938], [9141939, 9845164], [9845165, 10548390], [10548391, 11251616], [11251617, 11954842], [11954843, 12658068], [12658069, 13361294], [13361295, 14064520]] SRR11389835 file size 2661341 SRR11389835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389835 SRR11389835_1.fastq SRR11389835_2.fastq Input file: SRR11389835_1.fastq Paired file: SRR11389835_2.fastq trimmed: SRR11389835-trimmed-pair1.fastq, SRR11389835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:50:46 2024 >> started Sat Dec 7 07:50:58 2024 >> done (11.882s) 14064520 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 362996 ( 2.58%) empty read pairs filtered out after trimming by size control 13701509 (97.42%) read pairs available; of these: 127525 ( 0.93%) trimmed read pairs available after processing 13573984 (99.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 3 0.00% 34 3 0.00% 35 620 0.00% 36 678 0.00% 37 864 0.01% 38 1105 0.01% 39 1349 0.01% 40 1667 0.01% 41 1990 0.01% 42 2214 0.02% 43 2377 0.02% 44 2813 0.02% 45 3102 0.02% 46 3478 0.03% 47 3655 0.03% 48 4010 0.03% 49 4486 0.03% 50 4988 0.04% 51 5789 0.04% 52 6598 0.05% 53 6994 0.05% 54 7859 0.06% 55 8487 0.06% 56 9655 0.07% 57 10547 0.08% 58 11352 0.08% 59 12415 0.09% 60 13556 0.10% 61 14328 0.10% 62 15824 0.12% 63 16940 0.12% 64 18729 0.14% 65 20606 0.15% 66 21778 0.16% 67 23528 0.17% 68 24327 0.18% 69 26351 0.19% 70 28446 0.21% 71 32887 0.24% 72 44696 0.33% 73 143628 1.05% 74 1054010 7.69% 75 5966419 43.55% 76 6116348 44.64% 13701509 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.80 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=60.85 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=1.1 sequence=GGCATATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGTAGATACTATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAAC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=17 prefix-density=0.82 prefix-fanout=2.4 sequence=AAGAAGGAGTACCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=6.77 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.1 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR11389835 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:51:36 Started mapping on | Dec 07 07:51:36 Finished on | Dec 07 07:52:55 Mapping speed, Million of reads per hour | 624.37 Number of input reads | 13701509 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 10874335 Uniquely mapped reads % | 79.37% Average mapped length | 149.54 Number of splices: Total | 4194834 Number of splices: Annotated (sjdb) | 3986393 Number of splices: GT/AG | 4140090 Number of splices: GC/AG | 49369 Number of splices: AT/AC | 1279 Number of splices: Non-canonical | 4096 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1692909 % of reads mapped to multiple loci | 12.36% Number of reads mapped to too many loci | 29416 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.89% % of reads unmapped: other | 1.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1134265 1134265 1134265 N_multimapping 1692909 1692909 1692909 N_noFeature 348960 10324930 681668 N_ambiguous 301188 3546 91874 UnstrandedReadsAssigned:10224187 PositiveStrandReadsAssigned:545859 NegativeStrandReadsAssigned:10100793 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389835-trimmed-pair1.fastq SRR11389835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,701,509 reads, 11,941,405 reads pseudoaligned [quant] estimated average fragment length: 172.008 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52973 SRR11389835.ke.tsv 35125 SRR11389835.se.tsv 88098 total ==> SRR11389835.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.105 0 0 PNS24247 1044 872.992 6.84331 0.886069 PNS24249 1928 1756.99 55.0585 3.54214 PNS24246 1044 872.992 6.84331 0.886069 PNS24248 1044 872.992 6.84331 0.886069 PNS24244 1471 1299.99 30.4116 2.64429 PNS24243 293 140.937 1 0.802023 KQK14069 1603 1431.99 649.383 51.2592 KQK14071 474 305.609 36.7873 13.6064 ==> SRR11389835.se.tsv <== BRADI_1g14170v3 704 BRADI_1g53295v3 7 BRADI_1g59795v3 149 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 72 BRADI_1g74790v3 177 BRADI_1g09890v3 0 BRADI_1g77505v3 121 BRADI_1g48960v3 0 SRR11389835 completed mapping pipeline successfully