Starting /dee2/code/volunteer_pipeline.sh SRR11389837 current disk space = 1516114137088 free memory = 1607768532 SRR11389837 SRAfilesize 4d5f3bcc91432810fdc48e388bbf302c SRR11389837.sra SRR11389837.sra file validated SRR11389837 is paired end SRR11389837 is conventional basespace SRR11389837 read1 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9555 32.0 32.0 32.0 32.0 32.0 2 30.96675 32.0 32.0 32.0 32.0 32.0 3 31.06475 32.0 32.0 32.0 32.0 32.0 4 31.0585 32.0 32.0 32.0 32.0 32.0 5 31.01825 32.0 32.0 32.0 32.0 32.0 6 34.01225 36.0 36.0 36.0 32.0 36.0 7 33.98175 36.0 36.0 36.0 32.0 36.0 8 33.86525 36.0 36.0 36.0 32.0 36.0 9 33.9955 36.0 36.0 36.0 32.0 36.0 10-11 33.8505 36.0 36.0 36.0 32.0 36.0 12-13 33.98225 36.0 36.0 36.0 32.0 36.0 14-15 33.97025 36.0 36.0 36.0 32.0 36.0 16-17 34.01325 36.0 36.0 36.0 32.0 36.0 18-19 33.938125 36.0 36.0 36.0 32.0 36.0 20-21 33.909375 36.0 36.0 36.0 32.0 36.0 22-23 33.801125 36.0 36.0 36.0 32.0 36.0 24-25 33.796875 36.0 36.0 36.0 32.0 36.0 26-27 33.529125 36.0 36.0 36.0 27.0 36.0 28-29 33.553 36.0 36.0 36.0 27.0 36.0 30-31 33.403999999999996 36.0 36.0 36.0 21.0 36.0 32-33 33.36687499999999 36.0 36.0 36.0 21.0 36.0 34-35 33.267250000000004 36.0 36.0 36.0 21.0 36.0 36-37 33.297250000000005 36.0 36.0 36.0 17.5 36.0 38-39 33.448750000000004 36.0 36.0 36.0 27.0 36.0 40-41 33.105625 36.0 36.0 36.0 14.0 36.0 42-43 33.021630407601904 36.0 36.0 36.0 14.0 36.0 44-45 32.94036009002251 36.0 36.0 36.0 14.0 36.0 46-47 32.87046761690423 36.0 36.0 36.0 14.0 36.0 48-49 32.79544886221555 36.0 36.0 36.0 14.0 36.0 50-51 32.69342335583896 36.0 34.0 36.0 14.0 36.0 52-53 32.61479937159672 36.0 34.0 36.0 14.0 36.0 54-55 32.31675390964324 36.0 32.0 36.0 14.0 36.0 56-57 32.27991987981973 36.0 32.0 36.0 14.0 36.0 58-59 31.907861792689033 36.0 32.0 36.0 14.0 36.0 60-61 31.946781868269472 36.0 32.0 36.0 14.0 36.0 62-63 31.896561153862947 36.0 32.0 36.0 14.0 36.0 64-65 32.06892646878511 36.0 32.0 36.0 14.0 36.0 66-67 31.863305743666917 36.0 32.0 36.0 14.0 36.0 68-69 31.819151606425702 36.0 32.0 36.0 14.0 36.0 70-71 31.68366759196187 36.0 32.0 36.0 14.0 36.0 72-73 31.695009045857066 36.0 32.0 36.0 14.0 36.0 74-75 31.610244481955256 36.0 32.0 36.0 14.0 36.0 76 30.42763397739701 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 8.0 23 15.0 24 19.0 25 39.0 26 79.0 27 93.0 28 141.0 29 206.0 30 264.0 31 313.0 32 443.0 33 627.0 34 913.0 35 840.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.125 10.5 14.95 39.425 2 24.125 13.55 31.25 31.075000000000003 3 23.25 18.725 23.625 34.4 4 29.65 24.85 20.474999999999998 25.025 5 26.55 28.575 22.975 21.9 6 22.1 32.375 26.224999999999998 19.3 7 19.475 26.25 33.85 20.424999999999997 8 20.424999999999997 24.375 31.4 23.799999999999997 9 19.975 21.875 32.7 25.45 10-11 22.2 29.7125 23.625 24.462500000000002 12-13 24.1625 24.0125 26.875 24.95 14-15 22.85 26.237500000000004 26.0 24.9125 16-17 24.462500000000002 25.1875 25.55 24.8 18-19 23.3625 24.8625 26.450000000000003 25.324999999999996 20-21 23.599999999999998 24.975 26.25 25.174999999999997 22-23 23.5125 25.587500000000002 25.5625 25.337500000000002 24-25 23.9875 24.725 26.025 25.2625 26-27 22.8125 25.95 26.150000000000002 25.087500000000002 28-29 23.974999999999998 25.825 25.2875 24.9125 30-31 23.1 25.95 25.924999999999997 25.025 32-33 23.974999999999998 25.4375 25.825 24.762500000000003 34-35 23.5 24.75 26.637499999999996 25.112499999999997 36-37 23.724999999999998 25.15 26.2875 24.837500000000002 38-39 23.775 25.4375 25.55 25.2375 40-41 24.975 24.875 25.4 24.75 42-43 23.280820205051263 26.156539134783696 25.331332833208304 25.23130782695674 44-45 23.418354588647162 24.76869217304326 25.993998499624904 25.818954738684667 46-47 23.93098274568642 25.568892223055762 25.55638909727432 24.943735933983497 48-49 23.718429607401852 25.068767191797946 25.331332833208304 25.881470367591895 50-51 24.20605151287822 24.343585896474117 26.244061015253813 25.206301575393848 52-53 24.137068534267133 24.487243621810904 25.52526263131566 25.850425212606304 54-55 23.2540675844806 24.30538172715895 25.64455569461827 26.795994993742177 56-57 22.984476715072606 25.30045067601402 26.32699048572859 25.38808212318478 58-59 23.510265398097147 24.98748122183275 25.137706559839764 26.364546820230345 60-61 23.716503881793138 25.181567743551213 25.43200601051841 25.66992236413724 62-63 24.283030682529745 24.62116468378209 25.159674389480273 25.936130244207888 64-65 24.285714285714285 25.03759398496241 25.726817042606516 24.949874686716793 66-67 23.78981690494106 23.401053423626784 26.573865061449712 26.235264609982444 68-69 24.661144578313255 23.707329317269078 25.690261044176705 25.941265060240966 70-71 23.765238155083573 23.68983285157723 26.63063968832475 25.914289305014453 72-73 23.65265682191089 24.03130127476966 26.606083554209263 25.709958349110185 74-75 23.847588595790032 21.24966693312017 26.791899813482544 28.11084465760725 76 27.597520962449874 0.0 36.638716733503465 35.763762304046665 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 44.0 1 24.0 2 4.0 3 3.5 4 3.0 5 2.5 6 1.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.5 16 3.0 17 3.0 18 5.0 19 9.5 20 11.5 21 13.0 22 13.0 23 13.5 24 13.0 25 10.5 26 10.5 27 14.5 28 17.0 29 15.5 30 22.5 31 31.5 32 36.0 33 41.0 34 44.0 35 56.0 36 77.5 37 90.5 38 108.0 39 137.0 40 165.0 41 183.0 42 192.0 43 202.0 44 219.0 45 217.5 46 207.0 47 199.0 48 185.0 49 183.0 50 177.5 51 156.0 52 138.0 53 126.5 54 120.5 55 120.0 56 120.0 57 128.0 58 131.5 59 121.5 60 113.0 61 108.5 62 101.0 63 90.5 64 83.5 65 83.5 66 79.5 67 72.0 68 61.0 69 47.5 70 43.5 71 45.5 72 43.0 73 36.0 74 29.5 75 26.5 76 23.5 77 18.0 78 14.5 79 14.0 80 9.0 81 3.5 82 3.0 83 4.0 84 5.0 85 4.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 1.0 54 2.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 1.0 63 0.0 64 4.0 65 1.0 66 0.0 67 3.0 68 0.0 69 5.0 70 1.0 71 6.0 72 21.0 73 78.0 74 240.0 75 890.0 76 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.8463933575506 94.27499999999999 2 1.7125064867669952 3.3000000000000003 3 0.3113648157758173 0.8999999999999999 4 0.0 0.0 5 0.05189413596263622 0.25 6 0.02594706798131811 0.15 7 0.0 0.0 8 0.02594706798131811 0.2 9 0.0 0.0 >10 0.02594706798131811 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37 0.9249999999999999 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 5 0.125 No Hit CCCAACGATAGTTGTAGTACTCTTATAATAGTAGTACTCATGAATACAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389837 read2 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.45175 32.0 32.0 32.0 21.0 32.0 2 30.02475 32.0 32.0 32.0 21.0 32.0 3 30.08375 32.0 32.0 32.0 21.0 32.0 4 29.892 32.0 32.0 32.0 21.0 32.0 5 30.00275 32.0 32.0 32.0 21.0 32.0 6 32.86775 36.0 36.0 36.0 14.0 36.0 7 33.20225 36.0 36.0 36.0 21.0 36.0 8 32.7085 36.0 36.0 36.0 14.0 36.0 9 32.7485 36.0 36.0 36.0 14.0 36.0 10-11 32.804874999999996 36.0 36.0 36.0 14.0 36.0 12-13 32.80875 36.0 36.0 36.0 17.5 36.0 14-15 33.0835 36.0 36.0 36.0 21.0 36.0 16-17 32.982 36.0 36.0 36.0 21.0 36.0 18-19 32.704750000000004 36.0 36.0 36.0 14.0 36.0 20-21 32.794375 36.0 36.0 36.0 14.0 36.0 22-23 32.57 36.0 36.0 36.0 14.0 36.0 24-25 32.556625 36.0 36.0 36.0 14.0 36.0 26-27 32.463625 36.0 36.0 36.0 14.0 36.0 28-29 32.54775 36.0 36.0 36.0 14.0 36.0 30-31 32.340999999999994 36.0 34.0 36.0 14.0 36.0 32-33 32.315125 36.0 34.0 36.0 14.0 36.0 34-35 32.128625 36.0 36.0 36.0 14.0 36.0 36-37 32.10425 36.0 32.0 36.0 14.0 36.0 38-39 32.16625 36.0 34.0 36.0 14.0 36.0 40-41 32.105125 36.0 32.0 36.0 14.0 36.0 42-43 31.7664416104026 36.0 32.0 36.0 14.0 36.0 44-45 32.04776194048512 36.0 32.0 36.0 14.0 36.0 46-47 31.937859464866218 36.0 32.0 36.0 14.0 36.0 48-49 31.737059264816203 36.0 32.0 36.0 14.0 36.0 50-51 31.568392098024507 36.0 32.0 36.0 14.0 36.0 52-53 31.650609362373118 36.0 32.0 36.0 14.0 36.0 54-55 31.502743255014174 36.0 32.0 36.0 14.0 36.0 56-57 31.342474330077636 36.0 32.0 36.0 14.0 36.0 58-59 31.436748496993985 36.0 32.0 36.0 14.0 36.0 60-61 31.143071911801552 36.0 32.0 36.0 14.0 36.0 62-63 31.16624906038587 36.0 32.0 36.0 14.0 36.0 64-65 31.284464443040484 36.0 32.0 36.0 14.0 36.0 66-67 31.191670847967888 36.0 32.0 36.0 14.0 36.0 68-69 31.054732613607833 36.0 32.0 36.0 14.0 36.0 70-71 30.978074498565885 36.0 32.0 36.0 14.0 36.0 72-73 30.870640865799473 36.0 32.0 36.0 14.0 36.0 74-75 30.765891970907653 36.0 29.5 36.0 14.0 36.0 76 29.405610310841546 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 16.0 16 16.0 17 14.0 18 15.0 19 16.0 20 12.0 21 14.0 22 19.0 23 27.0 24 55.0 25 71.0 26 98.0 27 130.0 28 189.0 29 215.0 30 301.0 31 374.0 32 436.0 33 581.0 34 789.0 35 606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.550000000000004 17.424999999999997 13.0 36.025 2 27.85 26.275 25.55 20.325 3 27.625 28.475 18.575 25.324999999999996 4 31.2 31.55 17.05 20.200000000000003 5 30.0 31.85 18.9 19.25 6 22.825 34.175 21.975 21.025 7 23.75 18.65 32.324999999999996 25.275 8 24.95 23.05 25.0 27.0 9 24.125 22.425 28.175 25.275 10-11 27.375 27.125 20.6875 24.8125 12-13 27.150000000000002 23.425 23.6375 25.7875 14-15 26.1125 25.1 24.2875 24.5 16-17 27.1375 24.4375 23.175 25.25 18-19 26.525 24.087500000000002 23.775 25.6125 20-21 26.674999999999997 25.45 23.8875 23.9875 22-23 27.425 25.900000000000002 22.287499999999998 24.3875 24-25 25.7625 25.874999999999996 23.8875 24.474999999999998 26-27 26.450000000000003 25.887500000000003 23.6875 23.974999999999998 28-29 26.5375 24.5125 24.087500000000002 24.8625 30-31 26.35 24.825 23.875 24.95 32-33 26.987499999999997 25.674999999999997 23.3625 23.974999999999998 34-35 26.625 25.4 23.25 24.725 36-37 26.775 24.65 23.599999999999998 24.975 38-39 26.637499999999996 25.650000000000002 22.95 24.762500000000003 40-41 26.4125 24.9875 23.325000000000003 25.275 42-43 26.319079769942487 25.506376594148538 23.99349837459365 24.18104526131533 44-45 25.79394848712178 25.543885971492873 24.48112028007002 24.18104526131533 46-47 26.744186046511626 25.456364091022753 24.18104526131533 23.618404601150285 48-49 25.28132033008252 25.70642660665166 23.93098274568642 25.081270317579396 50-51 26.319079769942487 25.668917229307326 23.118279569892472 24.893723430857715 52-53 26.92596298149075 24.68734367183592 23.47423711855928 24.912456228114056 54-55 26.089133700550825 25.38808212318478 23.810716074111166 24.71206810215323 56-57 26.10818933132983 24.906085649887302 24.229902329075884 24.75582268970699 58-59 26.87875751503006 24.912324649298597 23.371743486973948 24.837174348697395 60-61 25.645201703833624 25.544976196441993 23.853670759208217 24.95615134051616 62-63 26.59734402405412 25.870709095464793 24.129290904535207 23.402655975945876 64-65 27.13712709952369 25.269491100526448 23.226372524442215 24.367009275507645 66-67 25.075263421976917 25.89061716006021 23.79578524836929 25.23833416959358 68-69 25.82224453929199 25.583730856138587 23.499874466482552 25.094150138086867 70-71 26.178800452659374 24.707657487740477 24.116685527473912 24.99685653212624 72-73 25.242963523917705 25.798308721443895 23.854600530102235 25.10412722453616 74-75 25.736081370449675 22.979122055674516 25.214132762312637 26.070663811563172 76 28.544351781652765 0.0 34.83699772554966 36.61865049279757 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 40.0 1 20.0 2 1.0 3 1.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 2.0 12 3.0 13 2.5 14 1.0 15 1.0 16 3.0 17 3.5 18 7.0 19 9.5 20 6.0 21 3.0 22 4.5 23 7.0 24 11.5 25 14.5 26 13.0 27 15.0 28 17.0 29 18.5 30 17.5 31 18.5 32 23.0 33 29.0 34 45.0 35 69.5 36 93.0 37 102.0 38 108.5 39 122.5 40 136.5 41 154.0 42 166.5 43 175.0 44 185.5 45 179.0 46 171.0 47 182.5 48 172.5 49 149.5 50 142.0 51 136.5 52 138.0 53 138.5 54 135.5 55 129.5 56 124.0 57 128.0 58 129.5 59 138.0 60 136.5 61 125.5 62 129.0 63 114.0 64 91.5 65 85.5 66 92.5 67 98.5 68 81.0 69 66.5 70 64.0 71 61.0 72 60.5 73 54.5 74 38.0 75 26.5 76 25.5 77 21.0 78 12.5 79 8.5 80 10.5 81 8.0 82 6.0 83 7.5 84 3.5 85 1.5 86 2.0 87 1.0 88 2.5 89 4.0 90 2.0 91 0.5 92 1.0 93 0.5 94 1.5 95 4.0 96 5.0 97 3.5 98 2.5 99 4.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 2.0 54 2.0 55 0.0 56 0.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 4.0 65 1.0 66 0.0 67 3.0 68 0.0 69 4.0 70 5.0 71 5.0 72 15.0 73 79.0 74 278.0 75 959.0 76 2638.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22576497814349 95.5 2 1.4913859604011315 2.9000000000000004 3 0.15428130624839292 0.44999999999999996 4 0.05142710208279763 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025713551041398816 0.17500000000000002 8 0.0 0.0 9 0.025713551041398816 0.22499999999999998 >10 0.025713551041398816 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 22 0.5499999999999999 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758807 spots for SRR11389837.sra Written 758807 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra Read 758801 spots for SRR11389837.sra Written 758801 spots for SRR11389837.sra SRR ids: ['SRR11389837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tw5m2rh9 SRR11389837.sra spots: 15176026 blocks: [[1, 758801], [758802, 1517602], [1517603, 2276403], [2276404, 3035204], [3035205, 3794005], [3794006, 4552806], [4552807, 5311607], [5311608, 6070408], [6070409, 6829209], [6829210, 7588010], [7588011, 8346811], [8346812, 9105612], [9105613, 9864413], [9864414, 10623214], [10623215, 11382015], [11382016, 12140816], [12140817, 12899617], [12899618, 13658418], [13658419, 14417219], [14417220, 15176026]] SRR11389837 file size 2881805 SRR11389837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389837 SRR11389837_1.fastq SRR11389837_2.fastq Input file: SRR11389837_1.fastq Paired file: SRR11389837_2.fastq trimmed: SRR11389837-trimmed-pair1.fastq, SRR11389837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:11:06 2024 >> started Thu Dec 12 02:11:19 2024 >> done (12.442s) 15176026 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 46189 ( 0.30%) empty read pairs filtered out after trimming by size control 15129836 (99.70%) read pairs available; of these: 115967 ( 0.77%) trimmed read pairs available after processing 15013869 (99.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 6 0.00% 31 4 0.00% 32 2 0.00% 33 8 0.00% 34 5 0.00% 35 226 0.00% 36 254 0.00% 37 289 0.00% 38 387 0.00% 39 473 0.00% 40 582 0.00% 41 665 0.00% 42 793 0.01% 43 846 0.01% 44 915 0.01% 45 1008 0.01% 46 1144 0.01% 47 1216 0.01% 48 1289 0.01% 49 1532 0.01% 50 1709 0.01% 51 1877 0.01% 52 2134 0.01% 53 2393 0.02% 54 2572 0.02% 55 3019 0.02% 56 3274 0.02% 57 3645 0.02% 58 3900 0.03% 59 4157 0.03% 60 4538 0.03% 61 4973 0.03% 62 5554 0.04% 63 6094 0.04% 64 6868 0.05% 65 7489 0.05% 66 8074 0.05% 67 8973 0.06% 68 9246 0.06% 69 10397 0.07% 70 11557 0.08% 71 14062 0.09% 72 25547 0.17% 73 131135 0.87% 74 1112714 7.35% 75 6589323 43.55% 76 7132952 47.14% 15129836 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=15 prefix-density=0.90 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=12.16 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=1.3 sequence=CCCGAACATGGAGAACATGGCGAG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.66 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=19.26 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=CATCGAGTAGACCTTGTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTCCTGGGGAAGACAGTCAATGGATCTGTTATGTAGCTTATCCATTAGATCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCC SRR11389837 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:11:46 Started mapping on | Dec 12 02:11:46 Finished on | Dec 12 02:12:57 Mapping speed, Million of reads per hour | 767.15 Number of input reads | 15129836 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 12744454 Uniquely mapped reads % | 84.23% Average mapped length | 150.01 Number of splices: Total | 5464665 Number of splices: Annotated (sjdb) | 5218254 Number of splices: GT/AG | 5392512 Number of splices: GC/AG | 63824 Number of splices: AT/AC | 1491 Number of splices: Non-canonical | 6838 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1326994 % of reads mapped to multiple loci | 8.77% Number of reads mapped to too many loci | 37007 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.49% % of reads unmapped: other | 1.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1058388 1058388 1058388 N_multimapping 1326994 1326994 1326994 N_noFeature 394164 12257372 655910 N_ambiguous 309978 2571 90964 UnstrandedReadsAssigned:12040312 PositiveStrandReadsAssigned:484511 NegativeStrandReadsAssigned:11997580 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389837-trimmed-pair1.fastq SRR11389837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,129,836 reads, 13,430,125 reads pseudoaligned [quant] estimated average fragment length: 195.982 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR11389837.ke.tsv 35125 SRR11389837.se.tsv 88098 total ==> SRR11389837.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.185 0 0 PNS24247 1044 849.018 16.7297 2.00421 PNS24249 1928 1733.02 41.6367 2.44369 PNS24246 1044 849.018 16.7297 2.00421 PNS24248 1044 849.018 16.7297 2.00421 PNS24244 1471 1276.02 15.1743 1.20955 PNS24243 293 125.805 0 0 KQK14069 1603 1408.02 33.2546 2.40224 KQK14071 474 283.353 2.74539 0.985482 ==> SRR11389837.se.tsv <== BRADI_1g14170v3 33 BRADI_1g53295v3 12 BRADI_1g59795v3 176 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 126 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 117 BRADI_1g48960v3 0 SRR11389837 completed mapping pipeline successfully