Starting /dee2/code/volunteer_pipeline.sh SRR11389838 current disk space = 1544461496320 free memory = 1603904996 SRR11389838 SRAfilesize f5317f5c9ad7a78487d76d6b22a5eb02 SRR11389838.sra SRR11389838.sra file validated SRR11389838 is paired end SRR11389838 is conventional basespace SRR11389838 read1 length is 57-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 57-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9875 32.0 32.0 32.0 32.0 32.0 2 31.0205 32.0 32.0 32.0 32.0 32.0 3 31.07475 32.0 32.0 32.0 32.0 32.0 4 31.15 32.0 32.0 32.0 32.0 32.0 5 31.10625 32.0 32.0 32.0 32.0 32.0 6 33.9475 36.0 36.0 36.0 32.0 36.0 7 33.884 36.0 36.0 36.0 32.0 36.0 8 34.0815 36.0 36.0 36.0 32.0 36.0 9 33.9945 36.0 36.0 36.0 32.0 36.0 10-11 33.91825 36.0 36.0 36.0 32.0 36.0 12-13 34.07225 36.0 36.0 36.0 32.0 36.0 14-15 34.008625 36.0 36.0 36.0 32.0 36.0 16-17 33.98375 36.0 36.0 36.0 32.0 36.0 18-19 34.016625000000005 36.0 36.0 36.0 32.0 36.0 20-21 33.941 36.0 36.0 36.0 32.0 36.0 22-23 33.779624999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.72475 36.0 36.0 36.0 32.0 36.0 26-27 33.596125 36.0 36.0 36.0 27.0 36.0 28-29 33.534 36.0 36.0 36.0 24.0 36.0 30-31 33.426125 36.0 36.0 36.0 21.0 36.0 32-33 33.348375000000004 36.0 36.0 36.0 21.0 36.0 34-35 33.344125000000005 36.0 36.0 36.0 21.0 36.0 36-37 33.440749999999994 36.0 36.0 36.0 24.0 36.0 38-39 33.36875 36.0 36.0 36.0 21.0 36.0 40-41 33.15475 36.0 36.0 36.0 14.0 36.0 42-43 33.112 36.0 36.0 36.0 17.5 36.0 44-45 32.9925 36.0 36.0 36.0 14.0 36.0 46-47 33.03225 36.0 36.0 36.0 17.5 36.0 48-49 32.896625 36.0 36.0 36.0 14.0 36.0 50-51 32.626875 36.0 34.0 36.0 14.0 36.0 52-53 32.685 36.0 34.0 36.0 14.0 36.0 54-55 32.5105 36.0 32.0 36.0 14.0 36.0 56-57 32.32275 36.0 32.0 36.0 14.0 36.0 58-59 32.06092069051789 36.0 32.0 36.0 14.0 36.0 60-61 32.22117929710586 36.0 32.0 36.0 14.0 36.0 62-63 32.014386562312794 36.0 32.0 36.0 14.0 36.0 64-65 32.24817459398878 36.0 32.0 36.0 14.0 36.0 66-67 31.849787020796793 36.0 32.0 36.0 14.0 36.0 68-69 31.889822010528952 36.0 32.0 36.0 14.0 36.0 70-71 31.89879939595494 36.0 32.0 36.0 14.0 36.0 72-73 31.720213920697066 36.0 32.0 36.0 14.0 36.0 74-75 31.473451466810396 36.0 32.0 36.0 14.0 36.0 76 30.150720354636128 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 7.0 23 9.0 24 20.0 25 28.0 26 70.0 27 105.0 28 133.0 29 183.0 30 259.0 31 352.0 32 445.0 33 632.0 34 918.0 35 836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.325 10.05 16.400000000000002 37.225 2 23.724999999999998 13.25 30.025000000000002 33.0 3 23.75 17.625 24.2 34.425 4 28.925 24.5 20.65 25.924999999999997 5 27.175 28.15 21.8 22.875 6 22.85 32.35 25.900000000000002 18.9 7 18.975 24.95 35.4 20.674999999999997 8 20.200000000000003 25.35 29.375 25.074999999999996 9 20.424999999999997 22.15 32.9 24.525 10-11 22.5625 30.275000000000002 24.087500000000002 23.075000000000003 12-13 23.4875 24.5 26.8375 25.174999999999997 14-15 22.9625 25.374999999999996 26.487500000000004 25.174999999999997 16-17 21.925 25.5625 26.187500000000004 26.325 18-19 22.7625 25.6 27.175 24.462500000000002 20-21 23.2875 26.2625 26.3625 24.087500000000002 22-23 24.0 25.112499999999997 25.650000000000002 25.2375 24-25 23.2375 25.9625 25.887500000000003 24.9125 26-27 23.0125 25.775 25.8125 25.4 28-29 23.4875 25.662499999999998 25.775 25.074999999999996 30-31 22.5 26.7625 25.4 25.337500000000002 32-33 22.8875 26.5125 26.1 24.5 34-35 23.150000000000002 24.875 26.337500000000002 25.637500000000003 36-37 23.35 24.45 26.424999999999997 25.775 38-39 23.474999999999998 25.5375 25.3 25.687500000000004 40-41 22.6875 25.724999999999998 25.624999999999996 25.9625 42-43 23.0625 25.112499999999997 25.775 26.05 44-45 23.6625 24.3125 26.150000000000002 25.874999999999996 46-47 24.762500000000003 25.0125 25.324999999999996 24.9 48-49 23.1625 25.3 25.575 25.9625 50-51 23.7375 24.1125 25.3 26.85 52-53 23.8875 25.3 24.9125 25.900000000000002 54-55 23.5625 24.224999999999998 26.0 26.2125 56-57 23.3125 25.55 26.0625 25.074999999999996 58-59 23.83037277958469 24.580935701776333 25.281461095821868 26.307230422817113 60-61 22.931530854925523 26.135936913255726 25.20966328701965 25.7228689447991 62-63 24.339551771628898 24.051583823713536 26.26768498810567 25.341179416551896 64-65 24.176374796442442 24.176374796442442 25.9050482274834 25.742202179631718 66-67 23.415184164369833 25.2442996742671 25.920821849160614 25.419694312202456 68-69 23.802958134870895 24.37954374529957 25.482577086989224 26.33492103284031 70-71 23.97792826686732 24.103335841484828 25.771256583897667 26.14747930775019 72-73 24.178315073668305 24.59387986399698 25.790202745246187 25.437602317088526 74-75 23.05658381808567 22.75251189846642 26.58646218931782 27.60444209413009 76 26.671592168452165 0.0 36.46102696712227 36.86738086442556 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 46.0 1 30.0 2 8.0 3 1.5 4 1.0 5 2.0 6 2.0 7 1.0 8 1.0 9 1.0 10 0.5 11 1.0 12 2.0 13 2.0 14 1.5 15 0.5 16 0.0 17 0.0 18 6.5 19 11.5 20 15.5 21 23.5 22 20.0 23 13.0 24 8.5 25 4.5 26 12.5 27 22.5 28 21.5 29 20.5 30 22.0 31 28.5 32 42.5 33 48.5 34 44.5 35 51.5 36 65.0 37 82.5 38 118.0 39 148.0 40 148.0 41 159.0 42 174.5 43 192.5 44 214.5 45 209.5 46 206.5 47 197.5 48 193.0 49 174.5 50 148.0 51 148.5 52 137.0 53 123.0 54 125.5 55 130.0 56 117.0 57 118.5 58 132.5 59 117.0 60 111.0 61 114.5 62 109.0 63 104.0 64 94.5 65 82.5 66 73.0 67 68.5 68 65.5 69 56.5 70 41.5 71 37.5 72 37.0 73 34.0 74 34.5 75 33.0 76 25.5 77 17.5 78 15.0 79 15.0 80 13.5 81 8.5 82 6.0 83 5.5 84 3.0 85 0.5 86 0.0 87 0.0 88 1.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 57 3.0 58 0.0 59 2.0 60 1.0 61 0.0 62 1.0 63 1.0 64 1.0 65 0.0 66 0.0 67 2.0 68 0.0 69 0.0 70 4.0 71 7.0 72 15.0 73 49.0 74 264.0 75 943.0 76 2707.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.16013673415725 92.375 2 2.103602419142782 4.0 3 0.473310544307126 1.35 4 0.1051801209571391 0.4 5 0.0 0.0 6 0.05259006047856955 0.3 7 0.026295030239284777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.07888509071785432 1.4000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 33 0.8250000000000001 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 13 0.325 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 6 0.15 No Hit GCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389838 read2 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.60675 32.0 32.0 32.0 32.0 32.0 2 30.32025 32.0 32.0 32.0 21.0 32.0 3 30.23625 32.0 32.0 32.0 21.0 32.0 4 30.24725 32.0 32.0 32.0 21.0 32.0 5 30.324 32.0 32.0 32.0 21.0 32.0 6 33.49525 36.0 36.0 36.0 21.0 36.0 7 33.39675 36.0 36.0 36.0 21.0 36.0 8 33.18925 36.0 36.0 36.0 21.0 36.0 9 33.17575 36.0 36.0 36.0 21.0 36.0 10-11 33.212 36.0 36.0 36.0 21.0 36.0 12-13 33.268375 36.0 36.0 36.0 21.0 36.0 14-15 33.306875 36.0 36.0 36.0 21.0 36.0 16-17 33.34 36.0 36.0 36.0 21.0 36.0 18-19 33.067125000000004 36.0 36.0 36.0 17.5 36.0 20-21 33.098125 36.0 36.0 36.0 21.0 36.0 22-23 33.003875 36.0 36.0 36.0 14.0 36.0 24-25 32.97125 36.0 36.0 36.0 14.0 36.0 26-27 32.908625 36.0 36.0 36.0 14.0 36.0 28-29 32.79625 36.0 36.0 36.0 14.0 36.0 30-31 32.78574999999999 36.0 36.0 36.0 14.0 36.0 32-33 32.857375 36.0 36.0 36.0 14.0 36.0 34-35 32.473749999999995 36.0 36.0 36.0 14.0 36.0 36-37 32.561875 36.0 36.0 36.0 14.0 36.0 38-39 32.518875 36.0 36.0 36.0 14.0 36.0 40-41 32.471000000000004 36.0 34.0 36.0 14.0 36.0 42-43 32.394125 36.0 34.0 36.0 14.0 36.0 44-45 32.272375 36.0 34.0 36.0 14.0 36.0 46-47 32.19025 36.0 34.0 36.0 14.0 36.0 48-49 32.074625 36.0 32.0 36.0 14.0 36.0 50-51 32.137875 36.0 32.0 36.0 14.0 36.0 52-53 31.919879938734685 36.0 32.0 36.0 14.0 36.0 54-55 31.984621155288824 36.0 32.0 36.0 14.0 36.0 56-57 31.681545386346585 36.0 32.0 36.0 14.0 36.0 58-59 31.66116116116116 36.0 32.0 36.0 14.0 36.0 60-61 31.463234514932928 36.0 32.0 36.0 14.0 36.0 62-63 31.472005211274038 36.0 32.0 36.0 14.0 36.0 64-65 31.56871664252086 36.0 32.0 36.0 14.0 36.0 66-67 31.430701754385964 36.0 32.0 36.0 14.0 36.0 68-69 31.376348131427136 36.0 32.0 36.0 14.0 36.0 70-71 31.38867886897477 36.0 32.0 36.0 14.0 36.0 72-73 31.169723037018315 36.0 32.0 36.0 14.0 36.0 74-75 31.198443707219823 36.0 32.0 36.0 14.0 36.0 76 29.55458680818802 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 9.0 15 15.0 16 19.0 17 20.0 18 13.0 19 8.0 20 15.0 21 12.0 22 15.0 23 20.0 24 23.0 25 52.0 26 90.0 27 109.0 28 149.0 29 208.0 30 255.0 31 327.0 32 432.0 33 612.0 34 891.0 35 706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.475 15.725 13.350000000000001 35.449999999999996 2 29.9 25.25 23.525 21.325 3 27.750000000000004 28.275 19.75 24.224999999999998 4 32.775 29.625 17.25 20.349999999999998 5 30.075000000000003 31.900000000000002 18.8 19.225 6 24.025 32.925 22.75 20.3 7 24.275 18.45 33.0 24.275 8 25.525 23.3 24.55 26.625 9 23.95 22.275 27.250000000000004 26.525 10-11 28.3625 26.1 20.325 25.2125 12-13 27.287499999999998 22.675 23.25 26.787499999999998 14-15 26.05 24.837500000000002 24.75 24.3625 16-17 28.349999999999998 23.2875 23.0375 25.324999999999996 18-19 25.25 23.9125 24.975 25.8625 20-21 26.625 24.9875 24.587500000000002 23.799999999999997 22-23 28.15 24.85 22.900000000000002 24.099999999999998 24-25 25.8125 24.6625 24.3625 25.162499999999998 26-27 26.0625 24.9 24.762500000000003 24.275 28-29 26.974999999999998 24.637500000000003 23.0875 25.3 30-31 26.2125 24.8125 23.425 25.55 32-33 26.3125 25.4625 23.775 24.45 34-35 27.0875 25.4875 22.7 24.725 36-37 26.900000000000002 24.55 23.45 25.1 38-39 27.0 25.525 23.5 23.974999999999998 40-41 27.275 24.0625 23.8125 24.85 42-43 26.400000000000002 25.387500000000003 23.6625 24.55 44-45 25.5 25.7875 24.0125 24.7 46-47 26.1 25.374999999999996 23.5875 24.9375 48-49 26.987499999999997 25.2 23.6125 24.2 50-51 26.3 25.5 23.724999999999998 24.474999999999998 52-53 26.67833479184898 24.965620702587824 23.452931616452055 24.90311288911114 54-55 26.9567391847962 25.04376094023506 23.80595148787197 24.193548387096776 56-57 25.98149537384346 26.006501625406354 23.93098274568642 24.081020255063766 58-59 27.164664664664667 24.56206206206206 23.5985985985986 24.674674674674673 60-61 26.142481532490297 24.96556904970577 23.92638036809816 24.96556904970577 62-63 26.52473387601753 26.136505948653728 23.681903569192237 23.656856606136508 64-65 26.525498057887482 25.247462723969427 23.242701415862673 24.984337802280415 66-67 26.629072681704262 24.14786967418546 24.598997493734338 24.62406015037594 68-69 25.42011537496865 25.4326561324304 24.492099322799096 24.655129169801857 70-71 26.282775059591017 24.852590641073892 24.13749843181533 24.72713586751976 72-73 26.21359223300971 24.259235909721347 24.120539654520236 25.406632202748707 74-75 25.34703683929525 22.744260544580886 25.907634810464497 26.00106780565937 76 29.71948445792267 0.0 33.69977255496588 36.58074298711145 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 45.0 1 25.0 2 4.0 3 2.0 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.5 15 2.0 16 3.5 17 2.5 18 6.5 19 6.5 20 4.5 21 10.5 22 10.0 23 6.0 24 6.5 25 8.5 26 12.0 27 15.0 28 18.0 29 18.5 30 16.0 31 21.5 32 30.0 33 34.0 34 42.0 35 58.0 36 81.5 37 97.5 38 106.0 39 117.5 40 126.5 41 135.5 42 148.0 43 169.0 44 180.5 45 168.0 46 158.0 47 164.0 48 167.5 49 165.0 50 159.0 51 137.0 52 121.0 53 129.0 54 133.5 55 142.0 56 140.0 57 134.0 58 141.5 59 137.5 60 140.5 61 130.5 62 109.5 63 109.5 64 104.5 65 95.5 66 103.0 67 109.0 68 97.5 69 79.0 70 71.0 71 69.0 72 57.5 73 46.0 74 36.5 75 29.0 76 26.0 77 20.5 78 16.0 79 14.0 80 12.5 81 8.5 82 4.5 83 2.5 84 2.5 85 3.0 86 2.5 87 2.5 88 2.0 89 1.5 90 1.0 91 1.0 92 2.0 93 2.5 94 1.5 95 0.5 96 1.0 97 1.0 98 1.5 99 6.0 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 3.0 58 0.0 59 2.0 60 1.0 61 0.0 62 1.0 63 1.0 64 1.0 65 0.0 66 0.0 67 3.0 68 0.0 69 0.0 70 3.0 71 11.0 72 15.0 73 72.0 74 280.0 75 968.0 76 2638.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 97.2200367164962 92.675 2 2.176763703120902 4.15 3 0.3671649619722004 1.05 4 0.07867820613690008 0.3 5 0.0 0.0 6 0.05245213742460005 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026226068712300026 0.22499999999999998 >10 0.07867820613690008 1.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 24 0.6 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 16 0.4 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 9 0.22499999999999998 No Hit ATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAA 6 0.15 No Hit CGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670711 spots for SRR11389838.sra Written 670711 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra Read 670693 spots for SRR11389838.sra Written 670693 spots for SRR11389838.sra SRR ids: ['SRR11389838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3rot679r SRR11389838.sra spots: 13413878 blocks: [[1, 670693], [670694, 1341386], [1341387, 2012079], [2012080, 2682772], [2682773, 3353465], [3353466, 4024158], [4024159, 4694851], [4694852, 5365544], [5365545, 6036237], [6036238, 6706930], [6706931, 7377623], [7377624, 8048316], [8048317, 8719009], [8719010, 9389702], [9389703, 10060395], [10060396, 10731088], [10731089, 11401781], [11401782, 12072474], [12072475, 12743167], [12743168, 13413878]] SRR11389838 file size 2545259 SRR11389838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389838 SRR11389838_1.fastq SRR11389838_2.fastq Input file: SRR11389838_1.fastq Paired file: SRR11389838_2.fastq trimmed: SRR11389838-trimmed-pair1.fastq, SRR11389838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:51:39 2024 >> started Sat Dec 7 07:51:52 2024 >> done (12.923s) 13413878 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 48745 ( 0.36%) empty read pairs filtered out after trimming by size control 13365129 (99.64%) read pairs available; of these: 133693 ( 1.00%) trimmed read pairs available after processing 13231436 (99.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 4 0.00% 29 3 0.00% 30 3 0.00% 31 3 0.00% 32 3 0.00% 33 7 0.00% 34 5 0.00% 35 175 0.00% 36 174 0.00% 37 240 0.00% 38 268 0.00% 39 325 0.00% 40 407 0.00% 41 487 0.00% 42 526 0.00% 43 581 0.00% 44 669 0.01% 45 739 0.01% 46 776 0.01% 47 874 0.01% 48 904 0.01% 49 1047 0.01% 50 1186 0.01% 51 1409 0.01% 52 1492 0.01% 53 1726 0.01% 54 1870 0.01% 55 2075 0.02% 56 2278 0.02% 57 2519 0.02% 58 2877 0.02% 59 3089 0.02% 60 3313 0.02% 61 3682 0.03% 62 4118 0.03% 63 4401 0.03% 64 5089 0.04% 65 5418 0.04% 66 5826 0.04% 67 6479 0.05% 68 6664 0.05% 69 7383 0.06% 70 8446 0.06% 71 10382 0.08% 72 20689 0.15% 73 113831 0.85% 74 1009553 7.55% 75 5861760 43.86% 76 6259346 46.83% 13365129 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.93 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.15 sequence-density-rank=27 fanout-score=8.70 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=4.3 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=0.69 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=9.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.0 sequence=CACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCA SRR11389838 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:52:21 Started mapping on | Dec 07 07:52:21 Finished on | Dec 07 07:53:30 Mapping speed, Million of reads per hour | 697.31 Number of input reads | 13365129 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 10906626 Uniquely mapped reads % | 81.61% Average mapped length | 150.07 Number of splices: Total | 4108363 Number of splices: Annotated (sjdb) | 3919644 Number of splices: GT/AG | 4055790 Number of splices: GC/AG | 45742 Number of splices: AT/AC | 944 Number of splices: Non-canonical | 5887 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1438317 % of reads mapped to multiple loci | 10.76% Number of reads mapped to too many loci | 33275 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.95% % of reads unmapped: other | 1.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1020186 1020186 1020186 N_multimapping 1438317 1438317 1438317 N_noFeature 332021 10495520 535634 N_ambiguous 282885 2036 82238 UnstrandedReadsAssigned:10291720 PositiveStrandReadsAssigned:409070 NegativeStrandReadsAssigned:10288754 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389838-trimmed-pair1.fastq SRR11389838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,365,129 reads, 11,827,841 reads pseudoaligned [quant] estimated average fragment length: 200.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 SRR11389838.ke.tsv 35125 SRR11389838.se.tsv 88098 total ==> SRR11389838.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 736.29 0 0 PNS24247 1044 844.104 4.43331 0.574138 PNS24249 1928 1728.1 40.2845 2.54832 PNS24246 1044 844.104 4.43331 0.574138 PNS24248 1044 844.104 4.43331 0.574138 PNS24244 1471 1271.1 35.4155 3.04577 PNS24243 293 119.693 0 0 KQK14069 1603 1403.1 702.458 54.7288 KQK14071 474 277.862 46.7701 18.4003 ==> SRR11389838.se.tsv <== BRADI_1g14170v3 814 BRADI_1g53295v3 9 BRADI_1g59795v3 375 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 62 BRADI_1g74790v3 50 BRADI_1g09890v3 0 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR11389838 completed mapping pipeline successfully