Starting /dee2/code/volunteer_pipeline.sh SRR11389839 current disk space = 1544464715776 free memory = 1601938308 SRR11389839 SRAfilesize aab0729cf489ac2c51410b80e588a72e SRR11389839.sra SRR11389839.sra file validated SRR11389839 is paired end SRR11389839 is conventional basespace SRR11389839 read1 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.907 32.0 32.0 32.0 32.0 32.0 2 30.983 32.0 32.0 32.0 32.0 32.0 3 30.99075 32.0 32.0 32.0 32.0 32.0 4 31.09775 32.0 32.0 32.0 32.0 32.0 5 31.06675 32.0 32.0 32.0 32.0 32.0 6 33.88175 36.0 36.0 36.0 32.0 36.0 7 33.835 36.0 36.0 36.0 32.0 36.0 8 33.91875 36.0 36.0 36.0 32.0 36.0 9 33.94675 36.0 36.0 36.0 32.0 36.0 10-11 33.898375 36.0 36.0 36.0 32.0 36.0 12-13 34.083625 36.0 36.0 36.0 32.0 36.0 14-15 33.979625 36.0 36.0 36.0 32.0 36.0 16-17 33.975125 36.0 36.0 36.0 32.0 36.0 18-19 33.8895 36.0 36.0 36.0 32.0 36.0 20-21 33.818124999999995 36.0 36.0 36.0 29.5 36.0 22-23 33.842124999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.740875 36.0 36.0 36.0 32.0 36.0 26-27 33.470875 36.0 36.0 36.0 24.0 36.0 28-29 33.406625 36.0 36.0 36.0 21.0 36.0 30-31 33.417125 36.0 36.0 36.0 24.0 36.0 32-33 33.16025 36.0 36.0 36.0 14.0 36.0 34-35 33.206125 36.0 36.0 36.0 17.5 36.0 36-37 33.107375000000005 36.0 36.0 36.0 14.0 36.0 38-39 33.08425 36.0 36.0 36.0 14.0 36.0 40-41 33.148875000000004 36.0 36.0 36.0 17.5 36.0 42-43 33.021375 36.0 36.0 36.0 17.5 36.0 44-45 32.838499999999996 36.0 36.0 36.0 14.0 36.0 46-47 32.93237346836709 36.0 36.0 36.0 14.0 36.0 48-49 32.73330832708177 36.0 36.0 36.0 14.0 36.0 50-51 32.575058941073436 36.0 34.0 36.0 14.0 36.0 52-53 32.6258758601217 36.0 34.0 36.0 14.0 36.0 54-55 32.23087518056229 36.0 32.0 36.0 14.0 36.0 56-57 32.17303657088438 36.0 32.0 36.0 14.0 36.0 58-59 31.954795296829573 36.0 32.0 36.0 14.0 36.0 60-61 31.91152338731009 36.0 32.0 36.0 14.0 36.0 62-63 31.93993096731462 36.0 32.0 36.0 14.0 36.0 64-65 31.928866591413737 36.0 32.0 36.0 14.0 36.0 66-67 31.780726212502103 36.0 32.0 36.0 14.0 36.0 68-69 31.69859218774284 36.0 32.0 36.0 14.0 36.0 70-71 31.7649764388455 36.0 32.0 36.0 14.0 36.0 72-73 31.748791116978765 36.0 32.0 36.0 14.0 36.0 74-75 31.50272530988196 36.0 32.0 36.0 14.0 36.0 76 30.19391495601173 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 9.0 23 20.0 24 28.0 25 33.0 26 75.0 27 106.0 28 152.0 29 197.0 30 238.0 31 369.0 32 448.0 33 586.0 34 879.0 35 860.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 10.274999999999999 16.8 37.35 2 24.075 13.675 29.7 32.550000000000004 3 25.674999999999997 17.5 22.1 34.725 4 29.75 25.825 19.85 24.575 5 27.400000000000002 28.225 21.75 22.625 6 22.05 31.674999999999997 25.8 20.474999999999998 7 19.0 25.525 35.775 19.7 8 21.375 24.275 30.625000000000004 23.724999999999998 9 20.125 21.775 34.5 23.599999999999998 10-11 23.1 29.9 23.4375 23.5625 12-13 23.3875 25.15 26.0 25.4625 14-15 22.8375 25.887500000000003 25.937500000000004 25.337500000000002 16-17 23.6125 25.575 25.8 25.0125 18-19 23.1375 26.474999999999998 26.075 24.3125 20-21 24.224999999999998 25.337500000000002 25.7125 24.725 22-23 23.3875 25.674999999999997 25.75 25.1875 24-25 23.599999999999998 25.412499999999998 25.412499999999998 25.575 26-27 23.625 25.137500000000003 25.2125 26.025 28-29 23.4875 24.65 25.8125 26.05 30-31 24.3125 24.8625 26.487500000000004 24.337500000000002 32-33 23.3375 25.9875 25.35 25.324999999999996 34-35 23.724999999999998 24.6625 25.4 26.2125 36-37 23.1375 25.575 26.224999999999998 25.0625 38-39 24.25 25.337500000000002 25.4875 24.925 40-41 23.7375 25.174999999999997 25.662499999999998 25.424999999999997 42-43 23.225 25.4625 25.937500000000004 25.374999999999996 44-45 24.075 25.424999999999997 24.75 25.75 46-47 24.190523815476936 26.365795724465556 24.30303787973497 25.14064258032254 48-49 23.080770192548137 26.156539134783696 24.69367341835459 26.069017254313575 50-51 22.883581343003627 25.184444166562457 26.32237088908341 25.609603601350507 52-53 23.677298311444652 24.390243902439025 24.42776735459662 27.504690431519702 54-55 22.913277437116754 25.165811537980225 25.29095232136153 26.629958703541483 56-57 23.137598597721297 25.328659070990362 25.566545636659573 25.96719669462877 58-59 23.76956793988729 25.046963055729492 24.896681277395118 26.286787726988102 60-61 23.549316957012156 25.905501942599322 25.491916280235614 25.053264820152904 62-63 23.491784773610938 25.059576069233664 25.736861908942682 25.71177724821272 64-65 24.739681344875173 24.814954209007652 25.3293187805796 25.116045665537573 66-67 23.920140632847815 23.80713209442491 25.615268709191362 26.65745856353591 68-69 23.87834611034309 24.330777931381174 26.09023501319593 25.700640945079805 70-71 24.172643764942745 24.39914433119416 25.644897445576948 25.783314458286142 72-73 24.497535077739858 24.47225382378966 24.573378839590443 26.45683225888004 74-75 24.510456906886905 22.139336619155454 26.20221126948182 27.147995204475823 76 26.796187683284455 0.0 35.043988269794724 38.15982404692082 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 43.0 1 24.5 2 6.0 3 4.0 4 2.0 5 1.5 6 2.0 7 2.5 8 2.0 9 1.5 10 1.5 11 2.0 12 2.0 13 1.0 14 1.5 15 1.5 16 0.0 17 1.5 18 7.0 19 11.5 20 15.0 21 20.0 22 16.5 23 11.0 24 8.0 25 5.5 26 7.5 27 16.0 28 18.0 29 13.5 30 19.0 31 26.0 32 31.5 33 35.0 34 47.5 35 49.0 36 52.5 37 81.5 38 118.5 39 155.0 40 168.5 41 170.5 42 181.5 43 201.5 44 209.0 45 201.0 46 203.5 47 203.0 48 187.0 49 161.0 50 145.0 51 136.0 52 131.0 53 129.5 54 123.5 55 124.0 56 117.0 57 119.0 58 130.5 59 136.0 60 136.5 61 127.0 62 119.5 63 100.0 64 84.0 65 86.0 66 74.0 67 64.0 68 65.0 69 57.5 70 44.5 71 42.0 72 41.5 73 35.0 74 26.5 75 22.5 76 20.5 77 14.5 78 10.0 79 7.5 80 7.5 81 6.0 82 4.0 83 3.5 84 1.5 85 0.5 86 1.5 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 1.5 94 2.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 1.0 53 1.0 54 1.0 55 1.0 56 1.0 57 0.0 58 1.0 59 2.0 60 1.0 61 2.0 62 1.0 63 0.0 64 1.0 65 2.0 66 2.0 67 1.0 68 3.0 69 2.0 70 3.0 71 5.0 72 23.0 73 66.0 74 249.0 75 901.0 76 2728.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.61717727153705 93.2 2 1.6496465043205029 3.15 3 0.4451427075150563 1.275 4 0.13092432573972246 0.5 5 0.02618486514794449 0.125 6 0.02618486514794449 0.15 7 0.0 0.0 8 0.02618486514794449 0.2 9 0.02618486514794449 0.22499999999999998 >10 0.05236973029588898 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 36 0.8999999999999999 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 11 0.27499999999999997 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit CCCAGACATACGCAATGCTTTAGCTAATACACGGAAATGCATACCATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389839 read2 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389839_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52875 32.0 32.0 32.0 32.0 32.0 2 30.1745 32.0 32.0 32.0 21.0 32.0 3 30.216 32.0 32.0 32.0 21.0 32.0 4 30.12 32.0 32.0 32.0 21.0 32.0 5 30.31975 32.0 32.0 32.0 21.0 32.0 6 33.385 36.0 36.0 36.0 21.0 36.0 7 33.4965 36.0 36.0 36.0 21.0 36.0 8 33.13975 36.0 36.0 36.0 21.0 36.0 9 33.04525 36.0 36.0 36.0 14.0 36.0 10-11 33.20225 36.0 36.0 36.0 21.0 36.0 12-13 33.309250000000006 36.0 36.0 36.0 21.0 36.0 14-15 33.321124999999995 36.0 36.0 36.0 21.0 36.0 16-17 33.29175 36.0 36.0 36.0 21.0 36.0 18-19 33.101 36.0 36.0 36.0 21.0 36.0 20-21 33.090374999999995 36.0 36.0 36.0 17.5 36.0 22-23 32.863375000000005 36.0 36.0 36.0 14.0 36.0 24-25 32.908249999999995 36.0 36.0 36.0 14.0 36.0 26-27 32.854124999999996 36.0 36.0 36.0 14.0 36.0 28-29 32.921875 36.0 36.0 36.0 14.0 36.0 30-31 32.854375000000005 36.0 36.0 36.0 14.0 36.0 32-33 32.840125 36.0 36.0 36.0 14.0 36.0 34-35 32.551125 36.0 36.0 36.0 14.0 36.0 36-37 32.68025 36.0 36.0 36.0 14.0 36.0 38-39 32.564125000000004 36.0 36.0 36.0 14.0 36.0 40-41 32.44 36.0 34.0 36.0 14.0 36.0 42-43 32.418125 36.0 34.0 36.0 14.0 36.0 44-45 32.283125 36.0 34.0 36.0 14.0 36.0 46-47 32.34115972743186 36.0 34.0 36.0 14.0 36.0 48-49 32.159539884971245 36.0 32.0 36.0 14.0 36.0 50-51 32.12452544101508 36.0 32.0 36.0 14.0 36.0 52-53 32.027263631815906 36.0 32.0 36.0 14.0 36.0 54-55 32.05677847599914 36.0 32.0 36.0 14.0 36.0 56-57 31.579176587158585 36.0 32.0 36.0 14.0 36.0 58-59 31.674964080230037 36.0 32.0 36.0 14.0 36.0 60-61 31.561334807828892 36.0 32.0 36.0 14.0 36.0 62-63 31.681131681978464 36.0 32.0 36.0 14.0 36.0 64-65 31.689445477027633 36.0 32.0 36.0 14.0 36.0 66-67 31.555187664268324 36.0 32.0 36.0 14.0 36.0 68-69 31.453823985115527 36.0 32.0 36.0 14.0 36.0 70-71 31.52727808919005 36.0 32.0 36.0 14.0 36.0 72-73 31.038327567568814 36.0 32.0 36.0 14.0 36.0 74-75 30.99201573010023 36.0 32.0 36.0 14.0 36.0 76 29.477229958599924 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 11.0 15 14.0 16 15.0 17 19.0 18 14.0 19 14.0 20 13.0 21 11.0 22 17.0 23 24.0 24 35.0 25 50.0 26 81.0 27 119.0 28 141.0 29 199.0 30 247.0 31 321.0 32 421.0 33 589.0 34 902.0 35 743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.425 16.25 13.225000000000001 37.1 2 30.375000000000004 24.15 24.375 21.099999999999998 3 27.750000000000004 28.675 19.325 24.25 4 31.075000000000003 31.25 17.7 19.975 5 30.075000000000003 30.95 20.1 18.875 6 24.6 33.125 22.375 19.900000000000002 7 23.225 18.8 32.475 25.5 8 26.575 22.775000000000002 24.7 25.95 9 25.025 20.95 26.825 27.200000000000003 10-11 28.475 26.8 19.675 25.05 12-13 26.950000000000003 22.525000000000002 23.5 27.025 14-15 25.9875 24.712500000000002 24.3875 24.9125 16-17 27.8125 24.337500000000002 22.775000000000002 25.074999999999996 18-19 26.5125 23.962500000000002 24.0625 25.4625 20-21 26.2875 24.6 24.1375 24.975 22-23 26.987499999999997 24.9375 23.6625 24.4125 24-25 26.937499999999996 25.025 23.325000000000003 24.712500000000002 26-27 27.200000000000003 25.724999999999998 23.125 23.95 28-29 27.575 25.15 22.775000000000002 24.5 30-31 26.087500000000002 24.95 23.7 25.2625 32-33 26.325 24.712500000000002 23.625 25.337500000000002 34-35 27.224999999999998 25.8125 23.0875 23.875 36-37 26.950000000000003 24.825 23.7125 24.5125 38-39 26.687499999999996 24.4 23.674999999999997 25.2375 40-41 26.787499999999998 24.3125 23.5625 25.337500000000002 42-43 26.700000000000003 24.725 23.849999999999998 24.725 44-45 26.8375 25.112499999999997 23.825 24.224999999999998 46-47 26.878359794974372 24.86560820102513 23.827978497312163 24.428053506688336 48-49 26.39409852463116 24.256064016004 24.193548387096776 25.156289072268066 50-51 26.35988495685882 24.92184569213455 24.0090033762661 24.70926597474053 52-53 27.301150575287643 24.474737368684345 22.923961980990494 25.30015007503752 54-55 25.760040035030652 25.73501814087326 23.758288502439633 24.74665332165645 56-57 25.935661534610087 24.77156089623232 24.433596194767805 24.859181374389784 58-59 27.582321272067112 23.72605483911356 23.337924126705897 25.353699762113436 60-61 25.660944743766446 25.360230547550433 23.380528755795012 25.59829595288811 62-63 26.733542319749215 25.968652037617556 23.28526645768025 24.012539184952978 64-65 26.439232409381663 24.984322087043772 23.52941176470588 25.04703373886868 66-67 25.746924428822492 25.03138337936229 24.152648757218177 25.069043434597038 68-69 26.14321608040201 25.113065326633166 24.095477386934675 24.64824120603015 70-71 26.453561540397686 24.691668764158067 24.075006292474203 24.779763402970048 72-73 26.129889859475885 24.64868970755792 24.167616153943534 25.053804279022664 74-75 26.454813622955214 21.775274872620002 25.851434700992222 25.918476803432554 76 29.092961987203616 0.0 34.32442604441099 36.5826119683854 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 36.0 1 21.0 2 4.0 3 1.0 4 0.0 5 1.5 6 2.0 7 1.0 8 1.0 9 1.5 10 1.0 11 0.0 12 0.0 13 1.5 14 2.0 15 2.0 16 3.0 17 2.0 18 3.0 19 4.0 20 3.0 21 3.5 22 5.5 23 8.0 24 10.5 25 13.0 26 11.5 27 7.5 28 10.0 29 16.5 30 19.5 31 26.0 32 34.0 33 37.0 34 37.5 35 50.5 36 73.0 37 80.0 38 94.0 39 110.5 40 119.0 41 143.5 42 167.5 43 182.5 44 192.5 45 178.0 46 168.5 47 158.5 48 148.0 49 151.5 50 142.0 51 141.0 52 145.0 53 138.0 54 130.5 55 135.5 56 135.5 57 136.5 58 143.0 59 146.0 60 162.0 61 161.5 62 137.5 63 114.5 64 106.0 65 104.5 66 87.0 67 78.0 68 82.0 69 73.0 70 63.0 71 58.5 72 57.5 73 48.0 74 35.0 75 33.0 76 27.0 77 22.0 78 17.0 79 11.5 80 10.5 81 8.0 82 4.0 83 2.5 84 3.0 85 1.5 86 0.0 87 0.5 88 2.0 89 1.5 90 0.0 91 0.5 92 1.5 93 1.5 94 1.5 95 1.0 96 0.0 97 0.0 98 1.5 99 6.5 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 1.0 55 1.0 56 1.0 57 0.0 58 1.0 59 2.0 60 1.0 61 2.0 62 1.0 63 0.0 64 1.0 65 2.0 66 2.0 67 1.0 68 2.0 69 3.0 70 6.0 71 8.0 72 25.0 73 85.0 74 246.0 75 949.0 76 2657.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.48182762201453 93.875 2 1.9730010384215992 3.8 3 0.4153686396677051 1.2 4 0.0 0.0 5 0.02596053997923157 0.125 6 0.05192107995846314 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05192107995846314 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 15 0.375 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713119 spots for SRR11389839.sra Written 713119 spots for SRR11389839.sra Read 713135 spots for SRR11389839.sra Written 713135 spots for SRR11389839.sra SRR ids: ['SRR11389839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ol6xl05c SRR11389839.sra spots: 14262396 blocks: [[1, 713119], [713120, 1426238], [1426239, 2139357], [2139358, 2852476], [2852477, 3565595], [3565596, 4278714], [4278715, 4991833], [4991834, 5704952], [5704953, 6418071], [6418072, 7131190], [7131191, 7844309], [7844310, 8557428], [8557429, 9270547], [9270548, 9983666], [9983667, 10696785], [10696786, 11409904], [11409905, 12123023], [12123024, 12836142], [12836143, 13549261], [13549262, 14262396]] SRR11389839 file size 2705933 SRR11389839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389839 SRR11389839_1.fastq SRR11389839_2.fastq Input file: SRR11389839_1.fastq Paired file: SRR11389839_2.fastq trimmed: SRR11389839-trimmed-pair1.fastq, SRR11389839-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:51:04 2024 >> started Sat Dec 7 07:51:16 2024 >> done (12.504s) 14262396 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 47458 ( 0.33%) empty read pairs filtered out after trimming by size control 14214935 (99.67%) read pairs available; of these: 119449 ( 0.84%) trimmed read pairs available after processing 14095486 (99.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 6 0.00% 34 10 0.00% 35 247 0.00% 36 313 0.00% 37 350 0.00% 38 397 0.00% 39 534 0.00% 40 628 0.00% 41 778 0.01% 42 860 0.01% 43 973 0.01% 44 1108 0.01% 45 1117 0.01% 46 1289 0.01% 47 1414 0.01% 48 1555 0.01% 49 1812 0.01% 50 2035 0.01% 51 2284 0.02% 52 2553 0.02% 53 2902 0.02% 54 3115 0.02% 55 3635 0.03% 56 3893 0.03% 57 4337 0.03% 58 4731 0.03% 59 5146 0.04% 60 5605 0.04% 61 6124 0.04% 62 6797 0.05% 63 7399 0.05% 64 8182 0.06% 65 9145 0.06% 66 9675 0.07% 67 10635 0.07% 68 11327 0.08% 69 12220 0.09% 70 13568 0.10% 71 16444 0.12% 72 27340 0.19% 73 126755 0.89% 74 1060165 7.46% 75 6257776 44.02% 76 6577735 46.27% 14214935 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.97 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=9.81 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.0 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.82 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=7.91 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.0 sequence=CACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCA SRR11389839 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:51:56 Started mapping on | Dec 07 07:51:56 Finished on | Dec 07 07:52:58 Mapping speed, Million of reads per hour | 825.38 Number of input reads | 14214935 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11974613 Uniquely mapped reads % | 84.24% Average mapped length | 149.97 Number of splices: Total | 4539327 Number of splices: Annotated (sjdb) | 4316878 Number of splices: GT/AG | 4481169 Number of splices: GC/AG | 50579 Number of splices: AT/AC | 1125 Number of splices: Non-canonical | 6454 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1245380 % of reads mapped to multiple loci | 8.76% Number of reads mapped to too many loci | 35115 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.45% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 994942 994942 994942 N_multimapping 1245380 1245380 1245380 N_noFeature 387264 11458457 673769 N_ambiguous 310937 2928 87797 UnstrandedReadsAssigned:11276412 PositiveStrandReadsAssigned:513228 NegativeStrandReadsAssigned:11213047 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389839 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389839-trimmed-pair1.fastq SRR11389839-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,214,935 reads, 12,542,781 reads pseudoaligned [quant] estimated average fragment length: 185.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52973 SRR11389839.ke.tsv 35125 SRR11389839.se.tsv 88098 total ==> SRR11389839.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.87 0 0 PNS24247 1044 859.783 9.26947 1.14212 PNS24249 1928 1743.78 46.9887 2.85461 PNS24246 1044 859.783 9.26947 1.14212 PNS24248 1044 859.783 9.26947 1.14212 PNS24244 1471 1286.78 59.2029 4.87397 PNS24243 293 129.56 0 0 KQK14069 1603 1418.78 1536.06 114.693 KQK14071 474 292.261 109.066 39.5334 ==> SRR11389839.se.tsv <== BRADI_1g14170v3 1741 BRADI_1g53295v3 5 BRADI_1g59795v3 414 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 93 BRADI_1g74790v3 137 BRADI_1g09890v3 0 BRADI_1g77505v3 115 BRADI_1g48960v3 0 SRR11389839 completed mapping pipeline successfully