Starting /dee2/code/volunteer_pipeline.sh SRR11389843 current disk space = 1544525787136 free memory = 1599243804 SRR11389843 SRAfilesize 084bf771cc5bce0f2d7880c81ebe2879 SRR11389843.sra SRR11389843.sra file validated SRR11389843 is paired end SRR11389843 is conventional basespace SRR11389843 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.97425 32.0 32.0 32.0 32.0 32.0 2 30.889 32.0 32.0 32.0 32.0 32.0 3 31.081 32.0 32.0 32.0 32.0 32.0 4 31.0875 32.0 32.0 32.0 32.0 32.0 5 31.118 32.0 32.0 32.0 32.0 32.0 6 33.94475 36.0 36.0 36.0 32.0 36.0 7 34.08825 36.0 36.0 36.0 32.0 36.0 8 33.88675 36.0 36.0 36.0 32.0 36.0 9 33.967 36.0 36.0 36.0 32.0 36.0 10-11 33.851375000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.021625 36.0 36.0 36.0 32.0 36.0 14-15 33.903375 36.0 36.0 36.0 32.0 36.0 16-17 33.95275 36.0 36.0 36.0 32.0 36.0 18-19 33.929 36.0 36.0 36.0 32.0 36.0 20-21 33.798874999999995 36.0 36.0 36.0 32.0 36.0 22-23 33.85925 36.0 36.0 36.0 32.0 36.0 24-25 33.6875 36.0 36.0 36.0 29.5 36.0 26-27 33.375375000000005 36.0 36.0 36.0 20.5 36.0 28-29 33.5115 36.0 36.0 36.0 24.0 36.0 30-31 33.3565 36.0 36.0 36.0 24.0 36.0 32-33 33.345 36.0 36.0 36.0 21.0 36.0 34-35 33.342875 36.0 36.0 36.0 21.0 36.0 36-37 33.18104526131533 36.0 36.0 36.0 14.0 36.0 38-39 33.19992498124531 36.0 36.0 36.0 14.0 36.0 40-41 33.00926307383701 36.0 36.0 36.0 14.0 36.0 42-43 33.089942456842635 36.0 36.0 36.0 14.0 36.0 44-45 32.88227813753208 36.0 36.0 36.0 14.0 36.0 46-47 33.0643301664208 36.0 36.0 36.0 17.5 36.0 48-49 32.775840279356615 36.0 36.0 36.0 14.0 36.0 50-51 32.72738661989476 36.0 34.0 36.0 14.0 36.0 52-53 32.55174141819093 36.0 34.0 36.0 14.0 36.0 54-55 32.32514620929673 36.0 32.0 36.0 14.0 36.0 56-57 32.298735357488866 36.0 32.0 36.0 14.0 36.0 58-59 32.084555821220775 36.0 32.0 36.0 14.0 36.0 60-61 32.15935086347673 36.0 32.0 36.0 14.0 36.0 62-63 31.91475896254076 36.0 32.0 36.0 14.0 36.0 64-65 32.13109125338326 36.0 32.0 36.0 14.0 36.0 66-67 31.876912157087723 36.0 32.0 36.0 14.0 36.0 68-69 31.786843473615694 36.0 32.0 36.0 14.0 36.0 70-71 31.899235522701098 36.0 32.0 36.0 14.0 36.0 72-73 31.63817766552615 36.0 32.0 36.0 14.0 36.0 74-75 31.599569802931946 36.0 32.0 36.0 14.0 36.0 76 30.37355248412402 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 4.0 22 6.0 23 8.0 24 25.0 25 59.0 26 75.0 27 102.0 28 136.0 29 177.0 30 271.0 31 318.0 32 436.0 33 562.0 34 883.0 35 933.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.9584896224056 10.877719429857464 14.978744686171543 40.1850462615654 2 23.85596399099775 12.07801950487622 31.45786446611653 32.6081520380095 3 22.380595148787197 17.454363590897724 23.830957739434858 36.33408352088022 4 28.457114278569644 24.256064016004 20.880220055013755 26.406601650412604 5 25.70642660665166 27.656914228557138 24.15603900975244 22.48062015503876 6 22.030507626906726 30.957739434858716 26.331582895723933 20.68017004251063 7 18.37959489872468 25.581395348837212 36.93423355838959 19.10477619404851 8 21.155288822205552 25.23130782695674 29.207301825456366 24.406101525381345 9 19.72993248312078 22.1055263815954 33.458364591147784 24.706176544136035 10-11 22.705676419104776 30.945236309077266 23.680920230057513 22.66816704176044 12-13 23.468367091772944 24.3935983995999 26.694173543385848 25.44386096524131 14-15 22.343085771442862 26.506626656664167 26.76919229807452 24.381095273818453 16-17 23.380845211302827 25.968992248062015 26.16904226056514 24.48112028007002 18-19 22.168042010502624 26.344086021505376 26.506626656664167 24.981245311327832 20-21 22.193048262065513 26.506626656664167 27.419354838709676 23.88097024256064 22-23 23.655913978494624 25.71892973243311 25.943985996499126 24.681170292573142 24-25 22.85571392848212 25.681420355088775 25.993998499624904 25.468867216804203 26-27 22.793198299574893 26.63165791447862 25.943985996499126 24.63115778944736 28-29 22.655663915978995 25.93148287071768 26.019004751187797 25.393848462115532 30-31 23.118279569892472 25.943985996499126 25.64391097774444 25.29382345586397 32-33 23.34333583395849 26.03150787696924 26.36909227306827 24.256064016004 34-35 22.718179544886222 26.331582895723933 26.65666416604151 24.293573393348336 36-37 22.330582645661416 24.718679669917478 26.981745436359088 25.968992248062015 38-39 22.393098274568644 26.581645411352838 26.069017254313575 24.956239059764943 40-41 22.773886943471737 25.937968984492244 26.87593796898449 24.412206103051524 42-43 23.2424318238679 25.93194896172129 25.268951713785338 25.55666750062547 44-45 23.095208307268862 25.347178781433755 25.997748029525837 25.55986488177155 46-47 22.327909887359198 25.944931163954944 25.65707133917397 26.070087609511887 48-49 22.467125860989352 26.36192861615529 25.360050093926112 25.810895428929243 50-51 22.751190177900277 25.870709095464793 26.10874467551992 25.26935605111501 52-53 23.740917063392633 25.72037083437735 25.043848659483835 25.49486344274618 54-55 22.929457461470992 25.73612329282045 25.122165142212754 26.212254103495802 56-57 23.37971668547073 25.159834524257242 26.100037608123355 25.360411182148678 58-59 23.46670011288097 25.912454534052426 25.37313432835821 25.24771102470839 60-61 23.502824858757062 25.260514752040176 26.08913998744507 25.14752040175769 62-63 22.843852149861704 25.35831028413377 26.653256223283883 25.144581342720645 64-65 23.444976076555022 25.346260387811636 25.33366910098212 25.87509443465122 66-67 23.403986878627304 24.665657330305322 26.532929598788797 25.397426192278576 68-69 23.75348013161225 24.90508731966591 25.13287775246773 26.208554796254113 70-71 23.487634749524414 25.09828788839569 25.93532022828155 25.478757133798354 72-73 24.767249075373037 24.38464481571228 26.080857033541637 24.767249075373037 74-75 24.20330778539734 22.307382008874548 27.040473309130025 26.44883689659809 76 26.74635786327979 0.0 35.786327979081065 37.467314157639144 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 12.0 2 3.5 3 2.5 4 1.0 5 1.0 6 1.5 7 1.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 1.0 14 1.5 15 2.0 16 2.5 17 2.5 18 7.0 19 11.5 20 12.0 21 15.0 22 18.0 23 18.0 24 13.5 25 9.5 26 10.5 27 15.5 28 20.5 29 20.5 30 21.5 31 26.0 32 31.0 33 38.0 34 44.5 35 62.5 36 90.5 37 116.0 38 133.5 39 157.5 40 176.5 41 190.5 42 203.5 43 220.0 44 236.0 45 232.5 46 227.0 47 210.5 48 191.0 49 176.5 50 177.0 51 173.5 52 151.5 53 131.5 54 116.0 55 116.0 56 128.0 57 125.0 58 116.0 59 108.0 60 95.5 61 88.5 62 88.0 63 81.0 64 69.5 65 55.5 66 47.0 67 48.5 68 49.5 69 44.0 70 35.0 71 33.5 72 37.5 73 37.5 74 28.0 75 23.5 76 20.0 77 14.0 78 9.0 79 5.5 80 4.5 81 5.0 82 4.5 83 3.5 84 4.0 85 4.0 86 3.0 87 2.0 88 1.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 2.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 2.0 47 1.0 48 1.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 1.0 56 1.0 57 1.0 58 1.0 59 1.0 60 5.0 61 1.0 62 4.0 63 3.0 64 2.0 65 5.0 66 4.0 67 8.0 68 4.0 69 4.0 70 5.0 71 10.0 72 19.0 73 61.0 74 263.0 75 910.0 76 2677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.35813237557723 95.85000000000001 2 1.3083632632119035 2.55 3 0.2052334530528476 0.6 4 0.0513083632632119 0.2 5 0.0 0.0 6 0.02565418163160595 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0513083632632119 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 16 0.4 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 10 0.25 No Hit CTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389843 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.254 32.0 32.0 32.0 21.0 32.0 2 30.0185 32.0 32.0 32.0 21.0 32.0 3 29.80175 32.0 32.0 32.0 14.0 32.0 4 29.9795 32.0 32.0 32.0 21.0 32.0 5 29.913 32.0 32.0 32.0 21.0 32.0 6 32.797 36.0 36.0 36.0 14.0 36.0 7 33.19175 36.0 36.0 36.0 21.0 36.0 8 32.54525 36.0 36.0 36.0 14.0 36.0 9 32.62975 36.0 36.0 36.0 14.0 36.0 10-11 32.7965 36.0 36.0 36.0 14.0 36.0 12-13 32.81762500000001 36.0 36.0 36.0 14.0 36.0 14-15 32.911 36.0 36.0 36.0 17.5 36.0 16-17 32.906375 36.0 36.0 36.0 17.5 36.0 18-19 32.739875 36.0 36.0 36.0 14.0 36.0 20-21 32.531125 36.0 36.0 36.0 14.0 36.0 22-23 32.594875 36.0 36.0 36.0 14.0 36.0 24-25 32.393 36.0 36.0 36.0 14.0 36.0 26-27 32.326125000000005 36.0 32.0 36.0 14.0 36.0 28-29 32.331500000000005 36.0 34.0 36.0 14.0 36.0 30-31 32.357875 36.0 36.0 36.0 14.0 36.0 32-33 32.17875 36.0 36.0 36.0 14.0 36.0 34-35 32.293499999999995 36.0 36.0 36.0 14.0 36.0 36-37 32.096649162290575 36.0 32.0 36.0 14.0 36.0 38-39 32.07826956739185 36.0 32.0 36.0 14.0 36.0 40-41 32.11801080117415 36.0 34.0 36.0 14.0 36.0 42-43 31.701275956967727 36.0 32.0 36.0 14.0 36.0 44-45 31.88551051051051 36.0 32.0 36.0 14.0 36.0 46-47 31.80715433831829 36.0 32.0 36.0 14.0 36.0 48-49 31.684595231188883 36.0 32.0 36.0 14.0 36.0 50-51 31.749749498997996 36.0 32.0 36.0 14.0 36.0 52-53 31.562374749499 36.0 32.0 36.0 14.0 36.0 54-55 31.368644580566794 36.0 32.0 36.0 14.0 36.0 56-57 31.18046840591074 36.0 32.0 36.0 14.0 36.0 58-59 31.129033734008647 36.0 32.0 36.0 14.0 36.0 60-61 31.124135302496192 36.0 32.0 36.0 14.0 36.0 62-63 31.170018856859752 36.0 32.0 36.0 14.0 36.0 64-65 31.186680358093284 36.0 32.0 36.0 14.0 36.0 66-67 30.973706495188893 36.0 32.0 36.0 14.0 36.0 68-69 31.036985659665927 36.0 32.0 36.0 14.0 36.0 70-71 31.153966205618964 36.0 32.0 36.0 14.0 36.0 72-73 30.921283520030876 36.0 29.5 36.0 14.0 36.0 74-75 30.692559301003072 36.0 29.5 36.0 14.0 36.0 76 29.37724784988272 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 5.0 15 15.0 16 9.0 17 12.0 18 9.0 19 9.0 20 15.0 21 12.0 22 17.0 23 35.0 24 50.0 25 76.0 26 107.0 27 159.0 28 195.0 29 248.0 30 293.0 31 348.0 32 499.0 33 607.0 34 736.0 35 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.908477119279816 17.179294823705927 13.528382095523881 35.38384596149037 2 28.107026756689173 24.60615153788447 26.30657664416104 20.980245061265315 3 27.631907976994246 29.607401850462615 18.879719929982496 23.88097024256064 4 30.90772693173293 31.207801950487625 18.154538634658664 19.72993248312078 5 30.23255813953488 31.857964491122782 20.4801200300075 17.429357339334832 6 23.1807951987997 35.38384596149037 21.905476369092273 19.529882470617654 7 24.15603900975244 18.254563640910227 32.958239559889975 24.63115778944736 8 25.10627656914228 23.455863965991497 25.506376594148538 25.93148287071768 9 24.256064016004 22.83070767691923 28.60715178794699 24.306076519129782 10-11 27.00675168792198 29.057264316079017 20.767691922980745 23.168292073018254 12-13 26.19404851212803 23.668417104276067 24.868717179294826 25.268817204301076 14-15 25.018754688672168 26.219054763690924 24.981245311327832 23.78094523630908 16-17 26.281570392598148 24.868717179294826 24.043510877719427 24.8062015503876 18-19 25.006251562890725 24.868717179294826 25.156289072268066 24.968742185546386 20-21 26.39409852463116 25.256314078519633 25.28132033008252 23.068267066766694 22-23 26.70667666916729 25.943985996499126 24.15603900975244 23.193298324581146 24-25 25.868967241810452 26.019004751187797 24.48112028007002 23.63090772693173 26-27 26.231557889472366 26.04401100275069 24.356089022255563 23.36834208552138 28-29 25.993998499624904 25.51887971992998 23.63090772693173 24.85621405351338 30-31 25.668917229307326 25.331332833208304 24.418604651162788 24.58114528632158 32-33 26.206551637909474 25.79394848712178 24.356089022255563 23.643410852713178 34-35 26.19404851212803 25.743935983995996 24.668667166791696 23.393348337084273 36-37 26.406601650412604 25.393848462115532 24.006001500375092 24.193548387096776 38-39 25.156289072268066 26.556639159789945 25.081270317579396 23.20580145036259 40-41 26.900950475237618 25.387693846923458 23.21160580290145 24.499749874937468 42-43 27.220415311483613 25.756817613209908 23.53014761070803 23.492619464598448 44-45 26.323032653571875 25.372200675591145 24.796697109971223 23.508069560865756 46-47 25.47866349643349 27.06795144537605 23.70166437241897 23.751720685771495 48-49 25.741830474521098 25.892074621259546 24.815324902967323 23.550770001252033 50-51 25.63877755511022 25.876753507014026 25.112725450901802 23.371743486973948 52-53 25.60120240480962 25.751503006012022 23.897795591182362 24.749498997995993 54-55 25.77978203682826 25.566829512714516 24.38932732055618 24.26406112990104 56-57 25.842837448301793 26.143627020929944 24.013034214813885 24.00050131595438 58-59 25.442006269592476 25.15360501567398 24.877742946708466 24.52664576802508 60-61 25.693485628216393 25.291828793774318 24.651688213882263 24.362997364127022 62-63 25.804424333836103 26.546003016591253 24.245852187028657 23.40372046254399 64-65 26.73716012084592 25.780463242698893 23.552366565961734 23.930010070493456 66-67 26.04035308953342 25.422446406052963 24.71626733921816 23.82093316519546 68-69 26.359726789779913 26.32178092587908 24.42448773083734 22.89400455350367 70-71 25.960684844641722 25.630944831959418 24.14711477488903 24.261255548509826 72-73 25.873056334437933 25.21029824114198 24.87891919449401 24.037726229926076 74-75 26.97270134456064 22.151297025668885 25.166372402553307 25.709629227217167 76 27.834245504300238 0.0 35.92650508209539 36.23924941360438 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 11.0 2 2.0 3 1.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 1.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 2.5 18 8.0 19 9.5 20 6.0 21 6.0 22 6.5 23 7.5 24 8.5 25 9.0 26 9.5 27 10.5 28 15.5 29 20.0 30 20.5 31 32.0 32 37.5 33 32.0 34 44.0 35 73.0 36 102.5 37 111.5 38 116.5 39 145.0 40 161.5 41 161.5 42 171.5 43 203.5 44 223.0 45 211.0 46 200.0 47 197.0 48 200.0 49 183.0 50 162.5 51 152.5 52 136.0 53 115.5 54 107.0 55 110.5 56 118.5 57 118.0 58 110.5 59 125.0 60 136.0 61 131.5 62 120.5 63 101.5 64 85.0 65 79.5 66 71.0 67 59.0 68 56.5 69 56.0 70 49.5 71 43.5 72 38.5 73 31.5 74 30.0 75 28.5 76 22.5 77 19.5 78 16.0 79 11.5 80 11.0 81 6.5 82 4.5 83 5.5 84 4.0 85 3.5 86 3.5 87 3.0 88 1.5 89 1.0 90 1.0 91 0.5 92 1.0 93 0.5 94 0.0 95 1.0 96 2.0 97 2.0 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 2.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 1.0 47 1.0 48 1.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 1.0 56 1.0 57 1.0 58 1.0 59 1.0 60 5.0 61 1.0 62 4.0 63 3.0 64 2.0 65 4.0 66 4.0 67 8.0 68 4.0 69 5.0 70 7.0 71 8.0 72 16.0 73 85.0 74 297.0 75 975.0 76 2558.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4147276911276 96.22500000000001 2 1.2273075939657376 2.4 3 0.12784454103809767 0.375 4 0.12784454103809767 0.5 5 0.10227563283047815 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit AGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840872 spots for SRR11389843.sra Written 840872 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra Read 840867 spots for SRR11389843.sra Written 840867 spots for SRR11389843.sra SRR ids: ['SRR11389843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qxbk0930 SRR11389843.sra spots: 16817345 blocks: [[1, 840867], [840868, 1681734], [1681735, 2522601], [2522602, 3363468], [3363469, 4204335], [4204336, 5045202], [5045203, 5886069], [5886070, 6726936], [6726937, 7567803], [7567804, 8408670], [8408671, 9249537], [9249538, 10090404], [10090405, 10931271], [10931272, 11772138], [11772139, 12613005], [12613006, 13453872], [13453873, 14294739], [14294740, 15135606], [15135607, 15976473], [15976474, 16817345]] SRR11389843 file size 3190347 SRR11389843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389843 SRR11389843_1.fastq SRR11389843_2.fastq Input file: SRR11389843_1.fastq Paired file: SRR11389843_2.fastq trimmed: SRR11389843-trimmed-pair1.fastq, SRR11389843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:01:01 2024 >> started Sat Dec 7 08:01:14 2024 >> done (13.183s) 16817345 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 56264 ( 0.33%) empty read pairs filtered out after trimming by size control 16761071 (99.67%) read pairs available; of these: 69772 ( 0.42%) trimmed read pairs available after processing 16691299 (99.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 0 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 3 0.00% 33 5 0.00% 34 3 0.00% 35 531 0.00% 36 596 0.00% 37 684 0.00% 38 839 0.01% 39 1102 0.01% 40 1280 0.01% 41 1597 0.01% 42 1710 0.01% 43 2010 0.01% 44 2197 0.01% 45 2355 0.01% 46 2623 0.02% 47 2938 0.02% 48 3323 0.02% 49 3747 0.02% 50 4120 0.02% 51 4631 0.03% 52 5427 0.03% 53 5887 0.04% 54 6420 0.04% 55 7174 0.04% 56 8091 0.05% 57 8748 0.05% 58 9784 0.06% 59 10844 0.06% 60 11442 0.07% 61 12499 0.07% 62 13663 0.08% 63 15177 0.09% 64 16576 0.10% 65 18157 0.11% 66 19526 0.12% 67 21515 0.13% 68 22120 0.13% 69 23795 0.14% 70 25653 0.15% 71 30684 0.18% 72 44723 0.27% 73 167587 1.00% 74 1222538 7.29% 75 7369620 43.97% 76 7627107 45.50% 16761071 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=9.60 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.9 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=7.72 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.0 sequence=CTCGAGAACCTGGCCGACCACCTGTCCGACCCAGTGAACAACAACGCCTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGCTTAGTTAGCAAGCTCCAGCGCCTGCTCTATGCTGAGGCGCTTGGCCGACGACGTCATTGTTGATGATGGATGCTGCTGCATGTGTCGAGATTGAGTCAGGAGTCAGGACTGATAGATGTTGCATGTGAAAGTCAGAGATGAGGAGTTGGTGTTGTACACTAAAGATGGTGTTTGTGTAATATCCCTCGGTTATTTGTGAGATGAATCCGGG SRR11389843 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:01:42 Started mapping on | Dec 07 08:01:42 Finished on | Dec 07 08:02:59 Mapping speed, Million of reads per hour | 783.63 Number of input reads | 16761071 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 13952501 Uniquely mapped reads % | 83.24% Average mapped length | 149.78 Number of splices: Total | 5847396 Number of splices: Annotated (sjdb) | 5555944 Number of splices: GT/AG | 5769194 Number of splices: GC/AG | 71196 Number of splices: AT/AC | 1785 Number of splices: Non-canonical | 5221 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1795416 % of reads mapped to multiple loci | 10.71% Number of reads mapped to too many loci | 37041 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.92% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1013154 1013154 1013154 N_multimapping 1795416 1795416 1795416 N_noFeature 506059 13437746 755250 N_ambiguous 365511 2636 109311 UnstrandedReadsAssigned:13080931 PositiveStrandReadsAssigned:512119 NegativeStrandReadsAssigned:13087940 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389843-trimmed-pair1.fastq SRR11389843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,761,071 reads, 14,933,110 reads pseudoaligned [quant] estimated average fragment length: 178.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR11389843.ke.tsv 35125 SRR11389843.se.tsv 88098 total ==> SRR11389843.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.406 29.4628 3.66353 PNS24247 1044 866.171 10.7168 1.16678 PNS24249 1928 1750.17 89.2505 4.80903 PNS24246 1044 866.171 10.7168 1.16678 PNS24248 1044 866.171 10.7168 1.16678 PNS24244 1471 1293.17 42.1364 3.07276 PNS24243 293 136.636 1 0.690179 KQK14069 1603 1425.17 2322.28 153.665 KQK14071 474 299.777 76.4401 24.0464 ==> SRR11389843.se.tsv <== BRADI_1g14170v3 2484 BRADI_1g53295v3 29 BRADI_1g59795v3 246 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 97 BRADI_1g74790v3 234 BRADI_1g09890v3 0 BRADI_1g77505v3 169 BRADI_1g48960v3 0 SRR11389843 completed mapping pipeline successfully