Starting /dee2/code/volunteer_pipeline.sh SRR11389845 current disk space = 1544538615808 free memory = 1506473136 SRR11389845 SRAfilesize f877a9d54eb71a63149cf29e1c55ccc5 SRR11389845.sra SRR11389845.sra file validated SRR11389845 is paired end SRR11389845 is conventional basespace SRR11389845 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.042 32.0 32.0 32.0 32.0 32.0 2 31.03575 32.0 32.0 32.0 32.0 32.0 3 31.00725 32.0 32.0 32.0 32.0 32.0 4 31.102 32.0 32.0 32.0 32.0 32.0 5 31.193 32.0 32.0 32.0 32.0 32.0 6 34.10925 36.0 36.0 36.0 32.0 36.0 7 33.83475 36.0 36.0 36.0 32.0 36.0 8 33.98225 36.0 36.0 36.0 32.0 36.0 9 33.8255 36.0 36.0 36.0 32.0 36.0 10-11 33.888374999999996 36.0 36.0 36.0 32.0 36.0 12-13 33.88325 36.0 36.0 36.0 32.0 36.0 14-15 33.942875 36.0 36.0 36.0 32.0 36.0 16-17 33.797625 36.0 36.0 36.0 32.0 36.0 18-19 33.760875 36.0 36.0 36.0 29.5 36.0 20-21 33.616375 36.0 36.0 36.0 27.0 36.0 22-23 33.623374999999996 36.0 36.0 36.0 29.5 36.0 24-25 33.508875 36.0 36.0 36.0 27.0 36.0 26-27 33.39875 36.0 36.0 36.0 24.0 36.0 28-29 33.18575 36.0 36.0 36.0 17.5 36.0 30-31 33.308 36.0 36.0 36.0 21.0 36.0 32-33 33.229625 36.0 36.0 36.0 17.5 36.0 34-35 33.00725 36.0 36.0 36.0 14.0 36.0 36-37 32.981375 36.0 36.0 36.0 14.0 36.0 38-39 33.110875 36.0 36.0 36.0 17.5 36.0 40-41 33.0328832208052 36.0 36.0 36.0 17.5 36.0 42-43 32.80443460039597 36.0 36.0 36.0 14.0 36.0 44-45 32.90120060030015 36.0 36.0 36.0 14.0 36.0 46-47 32.562406203101546 36.0 32.0 36.0 14.0 36.0 48-49 32.40057528764382 36.0 32.0 36.0 14.0 36.0 50-51 32.39382191095548 36.0 32.0 36.0 14.0 36.0 52-53 32.160205102551274 36.0 32.0 36.0 14.0 36.0 54-55 32.05865432716358 36.0 32.0 36.0 14.0 36.0 56-57 32.138194097048526 36.0 32.0 36.0 14.0 36.0 58-59 31.84538403802852 36.0 32.0 36.0 14.0 36.0 60-61 31.877783337503125 36.0 32.0 36.0 14.0 36.0 62-63 31.71728796597448 36.0 32.0 36.0 14.0 36.0 64-65 31.702252816020025 36.0 32.0 36.0 14.0 36.0 66-67 31.604380475594496 36.0 32.0 36.0 14.0 36.0 68-69 31.60775969962453 36.0 32.0 36.0 14.0 36.0 70-71 31.480011945327252 36.0 32.0 36.0 14.0 36.0 72-73 31.48064822297794 36.0 32.0 36.0 14.0 36.0 74-75 31.423786993334424 36.0 32.0 36.0 14.0 36.0 76 29.67287331142753 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 7.0 22 7.0 23 15.0 24 15.0 25 45.0 26 65.0 27 98.0 28 166.0 29 209.0 30 311.0 31 344.0 32 481.0 33 637.0 34 934.0 35 665.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.475 9.1 14.149999999999999 31.275 2 30.275000000000002 10.8 27.800000000000004 31.125000000000004 3 27.075 16.8 21.675 34.449999999999996 4 30.325000000000003 22.425 20.325 26.924999999999997 5 28.549999999999997 25.575 22.3 23.575 6 23.474999999999998 30.275000000000002 25.4 20.849999999999998 7 17.075000000000003 25.575 35.425000000000004 21.925 8 22.25 23.775 29.9 24.075 9 19.725 22.075 32.875 25.324999999999996 10-11 22.787499999999998 29.612500000000004 24.5125 23.0875 12-13 24.125 24.637500000000003 25.0 26.237500000000004 14-15 23.6875 26.0125 25.1875 25.112499999999997 16-17 23.9 25.387500000000003 25.6125 25.1 18-19 24.15 25.1875 25.174999999999997 25.4875 20-21 23.775 25.7375 25.087500000000002 25.4 22-23 24.775 24.25 24.675 26.3 24-25 23.962500000000002 25.0125 24.762500000000003 26.2625 26-27 24.1375 26.387500000000003 23.4375 26.0375 28-29 24.6875 25.05 25.025 25.2375 30-31 23.7625 25.087500000000002 24.337500000000002 26.8125 32-33 23.849999999999998 25.362499999999997 24.525 26.2625 34-35 23.8125 25.087500000000002 25.45 25.650000000000002 36-37 24.099999999999998 25.662499999999998 23.7375 26.5 38-39 24.0125 25.324999999999996 24.525 26.137500000000003 40-41 23.55588897224306 25.1937984496124 24.55613903475869 26.694173543385848 42-43 24.184069025884707 24.721770663999 24.20907840440165 26.885081905714642 44-45 23.449224612306153 24.512256128064035 25.53776888444222 26.500750375187593 46-47 23.59929964982491 24.77488744372186 24.562281140570285 27.063531765882942 48-49 24.58729364682341 24.537268634317158 25.42521260630315 25.45022511255628 50-51 24.637318659329665 25.025012506253123 24.087043521760883 26.25062531265633 52-53 24.61230615307654 24.58729364682341 24.84992496248124 25.950475237618807 54-55 24.12456228114057 24.23711855927964 25.387693846923458 26.25062531265633 56-57 24.187093546773387 24.949974987493746 24.487243621810904 26.375687843921963 58-59 24.69352014010508 24.330748061045785 24.168126094570926 26.80760570427821 60-61 23.117338003502628 24.7935951963973 24.73104828621466 27.358018513885412 62-63 24.143107330497873 24.568426319739807 25.168876657493122 26.1195896922692 64-65 25.56946182728411 24.46808510638298 24.85607008760951 25.106382978723403 66-67 24.543178973717147 23.041301627033793 25.65707133917397 26.758448060075096 68-69 26.070087609511887 23.57947434292866 24.69336670838548 25.65707133917397 70-71 24.24583802728752 24.446113405933158 24.49618225059457 26.81186631618475 72-73 24.4410952022105 23.21024868123587 25.2323536799799 27.116302436573726 74-75 24.59730657512543 21.2305254819118 25.65355162397676 28.518616318986005 76 25.48375319459657 0.0 36.29061701350858 38.225629791894846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 2.5 19 4.0 20 3.5 21 4.5 22 4.5 23 4.0 24 5.5 25 7.5 26 7.5 27 10.0 28 12.5 29 13.0 30 17.0 31 24.0 32 33.5 33 41.5 34 49.5 35 61.0 36 75.0 37 83.5 38 103.5 39 137.5 40 161.5 41 172.0 42 186.0 43 210.0 44 209.0 45 206.0 46 205.5 47 201.5 48 201.0 49 188.5 50 176.5 51 169.5 52 153.0 53 133.5 54 129.5 55 117.0 56 107.0 57 121.0 58 132.0 59 128.5 60 125.0 61 121.5 62 119.0 63 108.5 64 91.0 65 77.0 66 66.5 67 63.5 68 62.5 69 60.5 70 51.5 71 44.5 72 47.0 73 43.0 74 30.5 75 22.5 76 20.5 77 15.5 78 11.5 79 10.0 80 8.5 81 8.5 82 6.5 83 3.5 84 3.0 85 2.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 2.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 6.0 72 14.0 73 63.0 74 248.0 75 924.0 76 2739.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34225962764602 96.39999999999999 2 1.3516959959194084 2.65 3 0.2550369803621525 0.75 4 0.0510073960724305 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389845 read2 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389845_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68375 32.0 32.0 32.0 32.0 32.0 2 30.297 32.0 32.0 32.0 21.0 32.0 3 30.1485 32.0 32.0 32.0 21.0 32.0 4 30.3685 32.0 32.0 32.0 21.0 32.0 5 30.3225 32.0 32.0 32.0 21.0 32.0 6 33.32825 36.0 36.0 36.0 21.0 36.0 7 33.244 36.0 36.0 36.0 21.0 36.0 8 33.184 36.0 36.0 36.0 21.0 36.0 9 33.2135 36.0 36.0 36.0 21.0 36.0 10-11 33.0935 36.0 36.0 36.0 17.5 36.0 12-13 33.05275 36.0 36.0 36.0 17.5 36.0 14-15 32.979749999999996 36.0 36.0 36.0 14.0 36.0 16-17 32.959999999999994 36.0 36.0 36.0 21.0 36.0 18-19 32.998000000000005 36.0 36.0 36.0 21.0 36.0 20-21 32.891875 36.0 36.0 36.0 14.0 36.0 22-23 32.815625 36.0 36.0 36.0 17.5 36.0 24-25 32.680125000000004 36.0 36.0 36.0 14.0 36.0 26-27 32.62412500000001 36.0 36.0 36.0 14.0 36.0 28-29 32.463375 36.0 34.0 36.0 14.0 36.0 30-31 32.4865 36.0 34.0 36.0 14.0 36.0 32-33 32.393249999999995 36.0 32.0 36.0 14.0 36.0 34-35 32.3 36.0 32.0 36.0 14.0 36.0 36-37 32.29675 36.0 32.0 36.0 14.0 36.0 38-39 32.327 36.0 34.0 36.0 14.0 36.0 40-41 32.00425106276569 36.0 32.0 36.0 14.0 36.0 42-43 31.95709216823966 36.0 32.0 36.0 14.0 36.0 44-45 31.878939469734867 36.0 32.0 36.0 14.0 36.0 46-47 31.979739869934967 36.0 32.0 36.0 14.0 36.0 48-49 31.81728364182091 36.0 32.0 36.0 14.0 36.0 50-51 31.789644822411205 36.0 32.0 36.0 14.0 36.0 52-53 31.51438219109555 36.0 32.0 36.0 14.0 36.0 54-55 31.404577288644322 36.0 32.0 36.0 14.0 36.0 56-57 30.967858929464732 36.0 32.0 36.0 14.0 36.0 58-59 31.251063297473106 36.0 32.0 36.0 14.0 36.0 60-61 31.07042782086565 36.0 32.0 36.0 14.0 36.0 62-63 31.124468351263445 36.0 32.0 36.0 14.0 36.0 64-65 30.82490613266583 36.0 29.5 36.0 14.0 36.0 66-67 30.91389236545682 36.0 32.0 36.0 14.0 36.0 68-69 30.83000292052597 36.0 29.5 36.0 14.0 36.0 70-71 30.753597917547832 36.0 29.5 36.0 14.0 36.0 72-73 30.724495095232506 36.0 29.5 36.0 14.0 36.0 74-75 30.52508270323692 36.0 27.0 36.0 14.0 36.0 76 28.73821609862219 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 10.0 16 18.0 17 18.0 18 13.0 19 10.0 20 17.0 21 13.0 22 12.0 23 32.0 24 58.0 25 69.0 26 100.0 27 131.0 28 176.0 29 226.0 30 279.0 31 385.0 32 467.0 33 584.0 34 825.0 35 554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6591647911978 16.029007251812956 13.378344586146538 33.93348337084271 2 31.782945736434108 22.655663915978995 24.406101525381345 21.155288822205552 3 29.425 26.224999999999998 19.625 24.725 4 31.8 30.225 16.650000000000002 21.325 5 30.75768942235559 30.15753938484621 19.02975743935984 20.05501375343836 6 25.074999999999996 31.624999999999996 21.525 21.775 7 23.0 17.8 32.05 27.150000000000002 8 26.224999999999998 22.425 23.225 28.125 9 24.85 22.55 25.7 26.900000000000002 10-11 28.812500000000004 27.075 19.6875 24.425 12-13 27.825 22.4625 23.3 26.4125 14-15 26.700000000000003 24.4375 24.05 24.8125 16-17 28.425 23.674999999999997 22.975 24.925 18-19 26.575 24.962500000000002 23.0875 25.374999999999996 20-21 27.0 25.2 22.662499999999998 25.137500000000003 22-23 28.1 24.6625 22.3625 24.875 24-25 26.4125 25.825 22.5625 25.2 26-27 27.35 24.9875 23.3625 24.3 28-29 27.625 24.95 22.6375 24.7875 30-31 27.537499999999998 25.0375 22.662499999999998 24.762500000000003 32-33 27.224999999999998 25.650000000000002 23.325000000000003 23.799999999999997 34-35 27.925 24.2875 22.725 25.0625 36-37 26.35 24.925 23.375 25.35 38-39 28.125 24.7875 22.537499999999998 24.55 40-41 27.494373593398347 24.01850462615654 23.23080770192548 25.256314078519633 42-43 26.73502563461298 24.296611229210953 24.071526822558457 24.896836313617605 44-45 27.67633816908454 24.84992496248124 23.21160580290145 24.262131065532767 46-47 27.963981990995496 24.374687343671837 22.24862431215608 25.41270635317659 48-49 26.513256628314156 25.387693846923458 22.448724362181093 25.65032516258129 50-51 26.075537768884445 24.912456228114056 22.998999499749875 26.013006503251624 52-53 27.37618809404702 23.486743371685844 23.67433716858429 25.46273136568284 54-55 26.625812906453227 24.987493746873437 23.12406203101551 25.26263131565783 56-57 27.026013006503252 25.012506253126567 23.04902451225613 24.912456228114056 58-59 27.24543407555667 24.26820115086315 22.10407805854391 26.38228671503628 60-61 26.169627220415308 25.39404553415061 23.455091318488865 24.981235926945207 62-63 27.257943457593193 24.83112334250688 23.29246935201401 24.618463847885916 64-65 26.883604505632043 25.056320400500624 22.690863579474343 25.36921151439299 66-67 26.533166458072593 25.20650813516896 22.57822277847309 25.682102628285357 68-69 26.84941794968081 24.9342846413819 23.77018400300413 24.446113405933158 70-71 26.975579211020662 24.270507201001877 23.544145272385723 25.209768315591734 72-73 27.307015338194617 24.339954739753583 23.5730450088006 24.779984913251194 74-75 26.886855020559757 21.528054118583366 24.910465578989253 26.67462528186762 76 28.57142857142857 0.0 33.756345177664976 37.672226250906455 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 1.5 17 1.5 18 1.5 19 2.0 20 1.5 21 2.5 22 3.5 23 4.0 24 5.5 25 4.5 26 4.0 27 6.5 28 8.5 29 13.0 30 20.0 31 21.0 32 24.0 33 32.5 34 49.0 35 64.5 36 80.0 37 95.5 38 103.0 39 121.5 40 132.0 41 141.5 42 151.5 43 156.5 44 172.5 45 191.5 46 215.5 47 195.0 48 171.5 49 160.0 50 137.5 51 154.5 52 160.0 53 146.5 54 150.0 55 145.5 56 137.0 57 136.0 58 136.5 59 145.5 60 143.0 61 124.0 62 111.5 63 109.0 64 95.5 65 83.0 66 86.0 67 85.5 68 78.0 69 69.0 70 63.5 71 63.5 72 63.5 73 55.5 74 42.5 75 36.0 76 35.5 77 29.0 78 20.5 79 20.0 80 18.5 81 10.5 82 5.0 83 3.5 84 4.0 85 6.0 86 5.5 87 4.0 88 2.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 2.5 98 2.5 99 5.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 2.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 3.0 71 5.0 72 18.0 73 76.0 74 245.0 75 889.0 76 2758.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67684478371501 96.95 2 1.1195928753180662 2.1999999999999997 3 0.1272264631043257 0.375 4 0.02544529262086514 0.1 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CGACGCCACACAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650733 spots for SRR11389845.sra Written 650733 spots for SRR11389845.sra Read 650739 spots for SRR11389845.sra Written 650739 spots for SRR11389845.sra SRR ids: ['SRR11389845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6mulmtvu SRR11389845.sra spots: 13014666 blocks: [[1, 650733], [650734, 1301466], [1301467, 1952199], [1952200, 2602932], [2602933, 3253665], [3253666, 3904398], [3904399, 4555131], [4555132, 5205864], [5205865, 5856597], [5856598, 6507330], [6507331, 7158063], [7158064, 7808796], [7808797, 8459529], [8459530, 9110262], [9110263, 9760995], [9760996, 10411728], [10411729, 11062461], [11062462, 11713194], [11713195, 12363927], [12363928, 13014666]] SRR11389845 file size 2470468 SRR11389845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389845 SRR11389845_1.fastq SRR11389845_2.fastq Input file: SRR11389845_1.fastq Paired file: SRR11389845_2.fastq trimmed: SRR11389845-trimmed-pair1.fastq, SRR11389845-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:14:16 2024 >> started Sat Dec 7 08:16:04 2024 >> done (107.959s) 13014666 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 31384 ( 0.24%) empty read pairs filtered out after trimming by size control 12983280 (99.76%) read pairs available; of these: 8296 ( 0.06%) trimmed read pairs available after processing 12974984 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 0 0.00% 25 6 0.00% 26 0 0.00% 27 3 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 6 0.00% 35 91 0.00% 36 103 0.00% 37 118 0.00% 38 141 0.00% 39 170 0.00% 40 184 0.00% 41 230 0.00% 42 238 0.00% 43 273 0.00% 44 315 0.00% 45 325 0.00% 46 345 0.00% 47 396 0.00% 48 424 0.00% 49 485 0.00% 50 515 0.00% 51 534 0.00% 52 659 0.01% 53 645 0.00% 54 729 0.01% 55 809 0.01% 56 940 0.01% 57 968 0.01% 58 1078 0.01% 59 1188 0.01% 60 1188 0.01% 61 1391 0.01% 62 1458 0.01% 63 1610 0.01% 64 1714 0.01% 65 1885 0.01% 66 1970 0.02% 67 2324 0.02% 68 2382 0.02% 69 2573 0.02% 70 3110 0.02% 71 4395 0.03% 72 13031 0.10% 73 106699 0.82% 74 886883 6.83% 75 5745091 44.25% 76 6193632 47.70% 12983280 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=61.22 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=12.1 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=8.11 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389845 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:20:41 Started mapping on | Dec 07 08:20:42 Finished on | Dec 07 08:35:35 Mapping speed, Million of reads per hour | 52.34 Number of input reads | 12983280 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11346986 Uniquely mapped reads % | 87.40% Average mapped length | 150.10 Number of splices: Total | 5169560 Number of splices: Annotated (sjdb) | 4952394 Number of splices: GT/AG | 5101341 Number of splices: GC/AG | 60890 Number of splices: AT/AC | 1388 Number of splices: Non-canonical | 5941 Mismatch rate per base, % | 0.90% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 842742 % of reads mapped to multiple loci | 6.49% Number of reads mapped to too many loci | 13789 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 793552 793552 793552 N_multimapping 842742 842742 842742 N_noFeature 325284 11057858 409276 N_ambiguous 270414 1172 70280 UnstrandedReadsAssigned:10751288 PositiveStrandReadsAssigned:287956 NegativeStrandReadsAssigned:10867430 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389845 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389845-trimmed-pair1.fastq SRR11389845-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,983,280 reads, 11,820,486 reads pseudoaligned [quant] estimated average fragment length: 209.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR11389845.ke.tsv 35125 SRR11389845.se.tsv 88098 total ==> SRR11389845.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.844 0 0 PNS24247 1044 835.678 12.7887 1.71224 PNS24249 1928 1719.68 73.1784 4.76118 PNS24246 1044 835.678 12.7887 1.71224 PNS24248 1044 835.678 12.7887 1.71224 PNS24244 1471 1262.68 28.4556 2.52147 PNS24243 293 105.126 0 0 KQK14069 1603 1394.68 291.783 23.408 KQK14071 474 268.185 10.1354 4.22847 ==> SRR11389845.se.tsv <== BRADI_1g14170v3 297 BRADI_1g53295v3 15 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 91 BRADI_1g74790v3 160 BRADI_1g09890v3 0 BRADI_1g77505v3 122 BRADI_1g48960v3 0 SRR11389845 completed mapping pipeline successfully