Starting /dee2/code/volunteer_pipeline.sh SRR11389846 current disk space = 1544528719872 free memory = 1601209108 SRR11389846 SRAfilesize 8786fa577f6d8d0da7e809728feb5c6a SRR11389846.sra SRR11389846.sra file validated SRR11389846 is paired end SRR11389846 is conventional basespace SRR11389846 read1 length is 56-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 56-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07825 32.0 32.0 32.0 32.0 32.0 2 30.97925 32.0 32.0 32.0 32.0 32.0 3 31.067 32.0 32.0 32.0 32.0 32.0 4 31.161 32.0 32.0 32.0 32.0 32.0 5 31.07925 32.0 32.0 32.0 32.0 32.0 6 33.95775 36.0 36.0 36.0 32.0 36.0 7 33.92975 36.0 36.0 36.0 32.0 36.0 8 34.0705 36.0 36.0 36.0 32.0 36.0 9 33.99 36.0 36.0 36.0 32.0 36.0 10-11 33.963499999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.12775 36.0 36.0 36.0 32.0 36.0 14-15 33.962625 36.0 36.0 36.0 32.0 36.0 16-17 33.9575 36.0 36.0 36.0 32.0 36.0 18-19 33.90225 36.0 36.0 36.0 32.0 36.0 20-21 33.9025 36.0 36.0 36.0 32.0 36.0 22-23 33.710625 36.0 36.0 36.0 29.5 36.0 24-25 33.48725 36.0 36.0 36.0 27.0 36.0 26-27 33.365625 36.0 36.0 36.0 21.0 36.0 28-29 33.332499999999996 36.0 36.0 36.0 21.0 36.0 30-31 33.257 36.0 36.0 36.0 21.0 36.0 32-33 33.330875 36.0 36.0 36.0 21.0 36.0 34-35 33.171625000000006 36.0 36.0 36.0 17.5 36.0 36-37 33.192375 36.0 36.0 36.0 21.0 36.0 38-39 33.113375000000005 36.0 36.0 36.0 14.0 36.0 40-41 33.138374999999996 36.0 36.0 36.0 17.5 36.0 42-43 32.914500000000004 36.0 36.0 36.0 14.0 36.0 44-45 32.950125 36.0 36.0 36.0 14.0 36.0 46-47 32.51275 36.0 32.0 36.0 14.0 36.0 48-49 32.67075 36.0 32.0 36.0 14.0 36.0 50-51 32.388999999999996 36.0 32.0 36.0 14.0 36.0 52-53 32.31125 36.0 32.0 36.0 14.0 36.0 54-55 32.28325 36.0 32.0 36.0 14.0 36.0 56-57 32.00737865716429 36.0 32.0 36.0 14.0 36.0 58-59 31.877594398599648 36.0 32.0 36.0 14.0 36.0 60-61 32.04113528382096 36.0 32.0 36.0 14.0 36.0 62-63 31.879094773693424 36.0 32.0 36.0 14.0 36.0 64-65 31.80770192548137 36.0 32.0 36.0 14.0 36.0 66-67 31.514753688422104 36.0 32.0 36.0 14.0 36.0 68-69 31.668917229307326 36.0 32.0 36.0 14.0 36.0 70-71 31.70582938454153 36.0 32.0 36.0 14.0 36.0 72-73 31.58740546419472 36.0 32.0 36.0 14.0 36.0 74-75 31.581888930837923 36.0 32.0 36.0 14.0 36.0 76 29.719367588932805 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 6.0 23 9.0 24 20.0 25 27.0 26 69.0 27 107.0 28 143.0 29 205.0 30 283.0 31 369.0 32 458.0 33 694.0 34 940.0 35 666.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.6 9.0 15.7 30.7 2 30.375000000000004 11.225 26.650000000000002 31.75 3 28.825 15.45 21.05 34.675 4 30.825000000000003 24.7 18.65 25.825 5 29.425 26.700000000000003 22.425 21.45 6 24.6 30.8 24.3 20.3 7 18.825 24.875 35.175 21.125 8 20.599999999999998 23.775 30.625000000000004 25.0 9 19.675 21.65 33.5 25.174999999999997 10-11 23.95 28.962500000000002 23.9 23.1875 12-13 24.775 23.799999999999997 25.362499999999997 26.0625 14-15 23.7125 25.575 25.662499999999998 25.05 16-17 23.45 24.962500000000002 26.0375 25.55 18-19 23.4125 25.874999999999996 25.424999999999997 25.2875 20-21 24.45 25.7 24.5125 25.337500000000002 22-23 24.175 24.7 25.5 25.624999999999996 24-25 23.8625 25.2 25.937500000000004 25.0 26-27 23.425 25.662499999999998 25.412499999999998 25.5 28-29 24.6875 24.925 24.6875 25.7 30-31 24.175 25.162499999999998 24.925 25.7375 32-33 24.05 24.575 25.45 25.924999999999997 34-35 23.5375 24.6125 26.174999999999997 25.674999999999997 36-37 24.3875 24.349999999999998 25.0125 26.25 38-39 24.349999999999998 24.1875 25.7 25.7625 40-41 22.8625 25.2375 25.874999999999996 26.025 42-43 24.125 24.0375 25.4875 26.35 44-45 23.65 24.875 25.05 26.424999999999997 46-47 23.8875 24.962500000000002 24.95 26.200000000000003 48-49 24.2 24.575 25.362499999999997 25.8625 50-51 24.0125 24.9125 25.387500000000003 25.687500000000004 52-53 24.5625 24.3875 24.5125 26.5375 54-55 24.9 24.462500000000002 24.1875 26.450000000000003 56-57 24.62807850981373 24.265533191648956 25.165645705713214 25.9407425928241 58-59 24.256064016004 24.918729682420604 24.731182795698924 26.094023505876468 60-61 24.081020255063766 25.49387346836709 24.15603900975244 26.269067266816705 62-63 25.056264066016503 23.34333583395849 25.218804701175294 26.38159539884971 64-65 24.5311327831958 23.768442110527634 25.143785946486624 26.556639159789945 66-67 24.756189047261813 23.893473368342086 24.956239059764943 26.39409852463116 68-69 24.968742185546386 24.006001500375092 24.981245311327832 26.04401100275069 70-71 25.200100050025014 24.16208104052026 24.862431215607803 25.775387693846923 72-73 24.97491219267436 24.360260913196186 25.0 25.664826894129455 74-75 23.855865334034718 21.225670699631774 25.986322987901104 28.932140978432404 76 27.7398490837226 0.0 36.36363636363637 35.89651455264104 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 7.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 3.0 19 4.5 20 5.5 21 8.5 22 7.5 23 5.5 24 6.0 25 7.0 26 10.5 27 16.5 28 14.5 29 11.0 30 16.5 31 21.5 32 26.0 33 33.0 34 41.0 35 55.5 36 71.5 37 84.5 38 110.0 39 141.5 40 166.5 41 183.0 42 183.0 43 202.5 44 225.0 45 218.0 46 212.5 47 205.5 48 190.5 49 168.0 50 151.0 51 144.0 52 146.5 53 133.0 54 114.0 55 131.0 56 136.0 57 128.0 58 134.0 59 135.0 60 136.0 61 127.5 62 114.5 63 103.0 64 89.5 65 82.5 66 71.5 67 62.5 68 61.5 69 58.0 70 54.0 71 51.0 72 41.5 73 31.5 74 30.5 75 34.0 76 32.5 77 22.0 78 13.5 79 13.5 80 10.5 81 6.0 82 4.5 83 3.5 84 3.0 85 1.5 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 5.0 72 12.0 73 58.0 74 240.0 75 899.0 76 2783.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.75657555440948 94.77499999999999 2 1.8308406395048993 3.55 3 0.23207839092315627 0.675 4 0.1031459515214028 0.4 5 0.0 0.0 6 0.0515729757607014 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0257864878803507 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit GGGAGCTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTCCAGGCAAGGAACCCACTTGGAGCGGATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389846 read2 length is 56-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 56-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.47375 32.0 32.0 32.0 21.0 32.0 2 28.72975 32.0 32.0 32.0 14.0 32.0 3 28.521 32.0 32.0 32.0 14.0 32.0 4 28.5745 32.0 32.0 32.0 14.0 32.0 5 28.4765 32.0 32.0 32.0 14.0 32.0 6 30.78175 36.0 32.0 36.0 14.0 36.0 7 31.1935 36.0 32.0 36.0 14.0 36.0 8 31.279 36.0 32.0 36.0 14.0 36.0 9 31.213 36.0 32.0 36.0 14.0 36.0 10-11 30.898249999999997 36.0 32.0 36.0 14.0 36.0 12-13 31.201875 36.0 32.0 36.0 14.0 36.0 14-15 30.615625 36.0 32.0 36.0 14.0 36.0 16-17 30.770625 36.0 32.0 36.0 14.0 36.0 18-19 30.841 36.0 32.0 36.0 14.0 36.0 20-21 30.657 36.0 32.0 36.0 14.0 36.0 22-23 30.69325 36.0 32.0 36.0 14.0 36.0 24-25 30.55775 36.0 32.0 36.0 14.0 36.0 26-27 30.153375 36.0 24.0 36.0 14.0 36.0 28-29 30.16675 36.0 27.0 36.0 14.0 36.0 30-31 30.39575 36.0 32.0 36.0 14.0 36.0 32-33 30.259875 36.0 27.0 36.0 14.0 36.0 34-35 30.131125 36.0 27.0 36.0 14.0 36.0 36-37 30.00725 36.0 24.0 36.0 14.0 36.0 38-39 29.784625 36.0 21.0 36.0 14.0 36.0 40-41 29.609125 36.0 17.5 36.0 14.0 36.0 42-43 29.637375 36.0 24.0 36.0 14.0 36.0 44-45 29.54475 36.0 21.0 36.0 14.0 36.0 46-47 29.50025 36.0 17.5 36.0 14.0 36.0 48-49 29.596249999999998 36.0 21.0 36.0 14.0 36.0 50-51 29.310875 36.0 17.5 36.0 14.0 36.0 52-53 29.171 36.0 17.5 36.0 14.0 36.0 54-55 29.036749999999998 36.0 17.5 36.0 14.0 36.0 56-57 28.782706645411352 36.0 14.0 36.0 14.0 36.0 58-59 28.994998749687422 36.0 14.0 36.0 14.0 36.0 60-61 28.693548387096776 36.0 14.0 36.0 14.0 36.0 62-63 28.535133783445865 34.0 14.0 36.0 14.0 36.0 64-65 28.404226056514126 32.0 14.0 36.0 14.0 36.0 66-67 28.60527631907977 36.0 14.0 36.0 14.0 36.0 68-69 28.705801450362593 34.0 14.0 36.0 14.0 36.0 70-71 28.12563368114756 32.0 14.0 36.0 14.0 36.0 72-73 28.142549964143498 32.0 14.0 36.0 14.0 36.0 74-75 28.22557880351011 32.0 14.0 36.0 14.0 36.0 76 26.947443181818183 32.0 14.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 6.0 16 10.0 17 11.0 18 13.0 19 14.0 20 19.0 21 28.0 22 32.0 23 75.0 24 126.0 25 195.0 26 262.0 27 334.0 28 388.0 29 430.0 30 521.0 31 493.0 32 466.0 33 345.0 34 189.0 35 43.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.418209104552275 15.582791395697848 13.1815907953977 34.817408704352175 2 30.890445222611305 24.16208104052026 23.06153076538269 21.885942971485743 3 29.75 27.125 18.925 24.2 4 32.125 30.65 16.725 20.5 5 29.83245811452863 32.38309577394349 18.97974493623406 18.804701175293822 6 24.85621405351338 33.683420855213804 20.605151287821954 20.855213803450862 7 23.875 18.224999999999998 31.35 26.55 8 25.7 21.45 24.5 28.349999999999998 9 23.9 23.05 26.650000000000002 26.400000000000002 10-11 28.775000000000002 27.3625 19.7375 24.125 12-13 28.7375 22.55 23.0625 25.650000000000002 14-15 26.450000000000003 24.525 24.525 24.5 16-17 28.15 23.4875 22.662499999999998 25.7 18-19 27.625 23.3125 22.662499999999998 26.400000000000002 20-21 27.6625 24.575 23.2875 24.474999999999998 22-23 28.075 24.6625 21.8625 25.4 24-25 27.69096137017127 24.190523815476936 23.665458182272783 24.453056632079008 26-27 26.974999999999998 25.7375 22.3125 24.975 28-29 27.250000000000004 24.0125 22.925 25.8125 30-31 27.075 24.525 22.85 25.55 32-33 27.6125 25.362499999999997 23.4125 23.6125 34-35 28.599999999999998 24.0125 22.412499999999998 24.975 36-37 27.987499999999997 24.375 22.7125 24.925 38-39 27.6 24.837500000000002 21.587500000000002 25.974999999999998 40-41 27.9125 23.400000000000002 22.675 26.0125 42-43 27.5875 24.175 23.150000000000002 25.087500000000002 44-45 27.712500000000002 23.825 22.5125 25.95 46-47 28.425 23.974999999999998 22.3125 25.2875 48-49 27.237499999999997 24.2625 22.9875 25.5125 50-51 27.962500000000002 23.9 22.787499999999998 25.35 52-53 27.625 24.099999999999998 22.725 25.55 54-55 28.3125 23.9125 22.575 25.2 56-57 27.753469183647955 25.040630078759847 22.26528316039505 24.94061757719715 58-59 28.419604901225306 23.718429607401852 22.443110777694425 25.418854713678417 60-61 27.85696424106027 23.968492123030757 23.3183295823956 24.85621405351338 62-63 27.53188297074269 23.88097024256064 23.15578894723681 25.431357839459867 64-65 27.981995498874717 24.23105776444111 22.2430607651913 25.543885971492873 66-67 27.24431107776944 23.78094523630908 23.468367091772944 25.506376594148538 68-69 27.769442360590148 24.756189047261813 22.493123280820203 24.981245311327832 70-71 27.652652652652655 23.74874874874875 21.996996996996998 26.601601601601605 72-73 27.48427672955975 23.32075471698113 23.88679245283019 25.30817610062893 74-75 28.286056731921693 21.467572246637367 23.85137834598482 26.39499267545612 76 30.479573712255775 0.0 31.047957371225575 38.47246891651865 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 4.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 1.0 19 2.5 20 2.5 21 2.5 22 2.0 23 0.5 24 1.0 25 5.0 26 7.0 27 9.0 28 11.5 29 12.0 30 17.5 31 19.0 32 18.5 33 27.0 34 39.5 35 54.5 36 71.0 37 80.5 38 92.0 39 111.0 40 124.0 41 138.5 42 158.5 43 178.5 44 197.5 45 183.0 46 167.0 47 167.5 48 150.0 49 151.0 50 155.5 51 137.5 52 124.0 53 142.0 54 160.5 55 146.5 56 142.0 57 143.0 58 135.5 59 147.5 60 154.0 61 146.5 62 134.5 63 110.0 64 108.0 65 114.5 66 95.5 67 74.0 68 73.5 69 74.0 70 63.0 71 59.0 72 55.0 73 52.5 74 50.5 75 43.0 76 35.5 77 25.0 78 24.0 79 29.5 80 23.0 81 14.5 82 10.0 83 7.5 84 5.5 85 3.5 86 3.5 87 3.0 88 2.5 89 2.0 90 1.5 91 0.5 92 0.0 93 1.0 94 2.5 95 3.0 96 3.0 97 2.0 98 3.0 99 7.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.0 4 0.0 5 0.025 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.03551136363636364 >>END_MODULE >>Sequence Length Distribution warn #Length Count 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 6.0 71 6.0 72 24.0 73 74.0 74 269.0 75 804.0 76 2816.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7290289781393 97.1 2 1.0930350788002035 2.15 3 0.12709710218607015 0.375 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662271 spots for SRR11389846.sra Written 662271 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra Read 662252 spots for SRR11389846.sra Written 662252 spots for SRR11389846.sra SRR ids: ['SRR11389846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r3xx12cv SRR11389846.sra spots: 13245059 blocks: [[1, 662252], [662253, 1324504], [1324505, 1986756], [1986757, 2649008], [2649009, 3311260], [3311261, 3973512], [3973513, 4635764], [4635765, 5298016], [5298017, 5960268], [5960269, 6622520], [6622521, 7284772], [7284773, 7947024], [7947025, 8609276], [8609277, 9271528], [9271529, 9933780], [9933781, 10596032], [10596033, 11258284], [11258285, 11920536], [11920537, 12582788], [12582789, 13245059]] SRR11389846 file size 2514729 SRR11389846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389846 SRR11389846_1.fastq SRR11389846_2.fastq Input file: SRR11389846_1.fastq Paired file: SRR11389846_2.fastq trimmed: SRR11389846-trimmed-pair1.fastq, SRR11389846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:02:57 2024 >> started Sat Dec 7 08:03:09 2024 >> done (11.484s) 13245059 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 15472 ( 0.12%) empty read pairs filtered out after trimming by size control 13229586 (99.88%) read pairs available; of these: 14196 ( 0.11%) trimmed read pairs available after processing 13215390 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 91 0.00% 36 94 0.00% 37 126 0.00% 38 127 0.00% 39 150 0.00% 40 201 0.00% 41 226 0.00% 42 252 0.00% 43 299 0.00% 44 329 0.00% 45 355 0.00% 46 353 0.00% 47 394 0.00% 48 466 0.00% 49 485 0.00% 50 525 0.00% 51 587 0.00% 52 690 0.01% 53 721 0.01% 54 750 0.01% 55 838 0.01% 56 960 0.01% 57 1099 0.01% 58 1242 0.01% 59 1282 0.01% 60 1373 0.01% 61 1357 0.01% 62 1495 0.01% 63 1586 0.01% 64 1679 0.01% 65 1867 0.01% 66 2002 0.02% 67 2192 0.02% 68 2319 0.02% 69 2534 0.02% 70 2901 0.02% 71 3833 0.03% 72 12983 0.10% 73 103369 0.78% 74 855361 6.47% 75 5598546 42.32% 76 6621535 50.05% 13229586 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=15 prefix-density=0.97 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=50.72 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=8.9 sequence=AAAAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=14 prefix-density=0.72 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=32.25 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389846 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:03:35 Started mapping on | Dec 07 08:03:35 Finished on | Dec 07 08:05:02 Mapping speed, Million of reads per hour | 547.43 Number of input reads | 13229586 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11026108 Uniquely mapped reads % | 83.34% Average mapped length | 149.81 Number of splices: Total | 4943582 Number of splices: Annotated (sjdb) | 4747976 Number of splices: GT/AG | 4880916 Number of splices: GC/AG | 55889 Number of splices: AT/AC | 1400 Number of splices: Non-canonical | 5377 Mismatch rate per base, % | 1.36% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1199997 % of reads mapped to multiple loci | 9.07% Number of reads mapped to too many loci | 10546 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.99% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1003481 1003481 1003481 N_multimapping 1199997 1199997 1199997 N_noFeature 289789 10765692 361786 N_ambiguous 282069 1076 101200 UnstrandedReadsAssigned:10454250 PositiveStrandReadsAssigned:259340 NegativeStrandReadsAssigned:10563122 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389846-trimmed-pair1.fastq SRR11389846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,229,586 reads, 11,969,449 reads pseudoaligned [quant] estimated average fragment length: 226.789 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR11389846.ke.tsv 35125 SRR11389846.se.tsv 88098 total ==> SRR11389846.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 710.457 2.40138 0.368331 PNS24247 1044 818.211 8.63622 1.1502 PNS24249 1928 1702.21 50.0052 3.20123 PNS24246 1044 818.211 8.63622 1.1502 PNS24248 1044 818.211 8.63622 1.1502 PNS24244 1471 1245.21 19.6847 1.72267 PNS24243 293 92.9335 0 0 KQK14069 1603 1377.21 61.1743 4.84043 KQK14071 474 251.566 5.82568 2.52353 ==> SRR11389846.se.tsv <== BRADI_1g14170v3 64 BRADI_1g53295v3 3 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 143 BRADI_1g74790v3 164 BRADI_1g09890v3 0 BRADI_1g77505v3 84 BRADI_1g48960v3 0 SRR11389846 completed mapping pipeline successfully