Starting /dee2/code/volunteer_pipeline.sh SRR11389847 current disk space = 1544516751360 free memory = 1600931572 SRR11389847 SRAfilesize cb0906b437587914b4df7e5f0da60d99 SRR11389847.sra SRR11389847.sra file validated SRR11389847 is paired end SRR11389847 is conventional basespace SRR11389847 read1 length is 42-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13075 32.0 32.0 32.0 32.0 32.0 2 31.0765 32.0 32.0 32.0 32.0 32.0 3 31.034 32.0 32.0 32.0 32.0 32.0 4 31.1565 32.0 32.0 32.0 32.0 32.0 5 31.22925 32.0 32.0 32.0 32.0 32.0 6 34.08075 36.0 36.0 36.0 32.0 36.0 7 33.9665 36.0 36.0 36.0 32.0 36.0 8 33.98575 36.0 36.0 36.0 32.0 36.0 9 33.86025 36.0 36.0 36.0 32.0 36.0 10-11 33.973124999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.101 36.0 36.0 36.0 32.0 36.0 14-15 34.049 36.0 36.0 36.0 32.0 36.0 16-17 33.887625 36.0 36.0 36.0 32.0 36.0 18-19 33.844375 36.0 36.0 36.0 32.0 36.0 20-21 33.785125 36.0 36.0 36.0 32.0 36.0 22-23 33.7355 36.0 36.0 36.0 29.5 36.0 24-25 33.45025 36.0 36.0 36.0 27.0 36.0 26-27 33.43275 36.0 36.0 36.0 24.0 36.0 28-29 33.456375 36.0 36.0 36.0 24.0 36.0 30-31 33.306875 36.0 36.0 36.0 21.0 36.0 32-33 33.2625 36.0 36.0 36.0 17.5 36.0 34-35 33.178 36.0 36.0 36.0 17.5 36.0 36-37 33.068124999999995 36.0 36.0 36.0 17.5 36.0 38-39 33.28825 36.0 36.0 36.0 21.0 36.0 40-41 32.997875 36.0 36.0 36.0 14.0 36.0 42-43 32.92099449862466 36.0 36.0 36.0 14.0 36.0 44-45 33.06814203550888 36.0 36.0 36.0 14.0 36.0 46-47 32.62465616404101 36.0 34.0 36.0 14.0 36.0 48-49 32.51112778194549 36.0 32.0 36.0 14.0 36.0 50-51 32.30957739434859 36.0 32.0 36.0 14.0 36.0 52-53 32.30820205051263 36.0 32.0 36.0 14.0 36.0 54-55 32.28832208052013 36.0 32.0 36.0 14.0 36.0 56-57 32.10655327663832 36.0 32.0 36.0 14.0 36.0 58-59 31.987868934467233 36.0 32.0 36.0 14.0 36.0 60-61 32.075931948961724 36.0 32.0 36.0 14.0 36.0 62-63 31.90680510382787 36.0 32.0 36.0 14.0 36.0 64-65 31.749937453089817 36.0 32.0 36.0 14.0 36.0 66-67 31.71283783783784 36.0 32.0 36.0 14.0 36.0 68-69 31.721096096096097 36.0 32.0 36.0 14.0 36.0 70-71 31.62222000083981 36.0 32.0 36.0 14.0 36.0 72-73 31.585100344518136 36.0 32.0 36.0 14.0 36.0 74-75 31.593306464326023 36.0 32.0 36.0 14.0 36.0 76 29.98214936247723 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 4.0 22 6.0 23 8.0 24 25.0 25 36.0 26 55.0 27 95.0 28 162.0 29 201.0 30 290.0 31 346.0 32 461.0 33 690.0 34 914.0 35 706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.925 8.6 14.174999999999999 32.300000000000004 2 30.475 11.05 25.874999999999996 32.6 3 28.050000000000004 15.8 20.3 35.85 4 31.2 22.15 19.825 26.825 5 29.475 25.924999999999997 22.275 22.325 6 24.375 30.599999999999998 25.0 20.025000000000002 7 18.025 25.074999999999996 35.699999999999996 21.2 8 21.3 24.224999999999998 30.125 24.349999999999998 9 19.975 21.725 33.675 24.625 10-11 23.2125 28.95 23.3125 24.525 12-13 23.8125 24.349999999999998 25.137500000000003 26.700000000000003 14-15 24.275 25.7 25.5125 24.5125 16-17 24.275 24.9 24.8625 25.9625 18-19 23.8625 24.587500000000002 25.137500000000003 26.4125 20-21 24.5625 25.15 25.025 25.2625 22-23 23.849999999999998 25.112499999999997 24.6625 26.375 24-25 24.4875 25.1875 24.65 25.674999999999997 26-27 24.099999999999998 25.15 25.087500000000002 25.662499999999998 28-29 25.0625 25.087500000000002 23.925 25.924999999999997 30-31 24.975 24.325 25.0375 25.662499999999998 32-33 24.0625 24.587500000000002 25.525 25.825 34-35 24.625 23.8375 24.712500000000002 26.825 36-37 24.224999999999998 25.025 24.6125 26.137500000000003 38-39 24.3875 25.337500000000002 25.374999999999996 24.9 40-41 24.65 25.4875 24.587500000000002 25.275 42-43 24.315539442430303 24.953119139892486 24.353044130516317 26.378297287160894 44-45 24.731182795698924 25.18129532383096 24.5311327831958 25.55638909727432 46-47 24.093523380845213 24.81870467616904 24.356089022255563 26.731682920730183 48-49 24.056014003500874 23.74343585896474 24.60615153788447 27.59439859964991 50-51 24.01850462615654 24.681170292573142 24.943735933983497 26.356589147286826 52-53 24.268567141785446 24.60615153788447 23.468367091772944 27.656914228557138 54-55 23.918479619904975 24.381095273818453 24.88122030507627 26.819204801200303 56-57 23.88694347173587 25.812906453226613 24.312156078039017 25.987993996998497 58-59 24.874937468734366 24.19959979989995 24.912456228114056 26.013006503251624 60-61 24.243182386790092 24.7935951963973 24.36827620715537 26.594946209657245 62-63 24.530898173630224 24.706029522141606 23.83037277958469 26.932699524643482 64-65 24.655991993995496 24.74355766825119 24.78108581436077 25.819364523392547 66-67 25.05005005005005 24.36186186186186 24.124124124124123 26.463963963963966 68-69 25.262762762762765 23.335835835835837 24.14914914914915 27.25225225225225 70-71 25.046939541870074 23.55739141319314 24.371010138941042 27.024658905995746 72-73 24.852442546778853 25.015697601406504 24.01105111139018 26.12080874042446 74-75 25.023096212221198 22.35713343011746 24.891117856671503 27.72865250098984 76 27.140255009107467 0.0 34.89981785063752 37.959927140255004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 3.0 21 4.0 22 4.5 23 4.5 24 5.0 25 4.0 26 4.0 27 11.0 28 17.5 29 15.5 30 11.5 31 18.0 32 31.5 33 36.5 34 44.0 35 58.0 36 68.5 37 84.0 38 105.0 39 134.5 40 156.5 41 173.5 42 183.0 43 190.5 44 217.5 45 220.0 46 206.5 47 190.5 48 178.0 49 183.0 50 183.5 51 172.0 52 147.5 53 129.0 54 121.0 55 116.0 56 112.0 57 116.5 58 127.5 59 149.5 60 144.5 61 114.5 62 109.0 63 102.0 64 87.5 65 82.0 66 80.0 67 75.5 68 69.5 69 57.0 70 49.0 71 44.5 72 44.5 73 46.0 74 36.5 75 29.0 76 26.0 77 18.0 78 12.5 79 11.5 80 9.0 81 5.5 82 4.5 83 5.0 84 3.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 5.0 72 15.0 73 57.0 74 257.0 75 915.0 76 2745.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10207745575788 95.625 2 1.4875609130546295 2.9000000000000004 3 0.28212362144139524 0.8250000000000001 4 0.05129520389843549 0.2 5 0.025647601949217745 0.125 6 0.025647601949217745 0.15 7 0.025647601949217745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit GCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACC 6 0.15 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389847 read2 length is 42-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52725 32.0 32.0 32.0 27.0 32.0 2 30.06475 32.0 32.0 32.0 21.0 32.0 3 29.951 32.0 32.0 32.0 21.0 32.0 4 30.0105 32.0 32.0 32.0 21.0 32.0 5 30.0905 32.0 32.0 32.0 21.0 32.0 6 33.02575 36.0 36.0 36.0 21.0 36.0 7 33.2025 36.0 36.0 36.0 21.0 36.0 8 33.04825 36.0 36.0 36.0 21.0 36.0 9 32.95525 36.0 36.0 36.0 21.0 36.0 10-11 32.899 36.0 36.0 36.0 17.5 36.0 12-13 32.71625 36.0 36.0 36.0 14.0 36.0 14-15 32.646125 36.0 36.0 36.0 14.0 36.0 16-17 32.829375 36.0 36.0 36.0 17.5 36.0 18-19 32.83225 36.0 36.0 36.0 21.0 36.0 20-21 32.610625 36.0 36.0 36.0 14.0 36.0 22-23 32.761250000000004 36.0 36.0 36.0 14.0 36.0 24-25 32.495374999999996 36.0 34.0 36.0 14.0 36.0 26-27 32.1965 36.0 34.0 36.0 14.0 36.0 28-29 32.402625 36.0 34.0 36.0 14.0 36.0 30-31 32.455125 36.0 32.0 36.0 14.0 36.0 32-33 32.3455 36.0 32.0 36.0 14.0 36.0 34-35 32.215875 36.0 32.0 36.0 14.0 36.0 36-37 32.056 36.0 32.0 36.0 14.0 36.0 38-39 31.982374999999998 36.0 32.0 36.0 14.0 36.0 40-41 31.749375 36.0 32.0 36.0 14.0 36.0 42-43 31.613176200300074 36.0 32.0 36.0 14.0 36.0 44-45 31.886971742935735 36.0 32.0 36.0 14.0 36.0 46-47 31.834708677169292 36.0 32.0 36.0 14.0 36.0 48-49 31.510502625656414 36.0 32.0 36.0 14.0 36.0 50-51 31.439984996249063 36.0 32.0 36.0 14.0 36.0 52-53 31.36021505376344 36.0 32.0 36.0 14.0 36.0 54-55 31.150287571892974 36.0 32.0 36.0 14.0 36.0 56-57 30.899849962490624 36.0 32.0 36.0 14.0 36.0 58-59 30.9152288072018 36.0 29.5 36.0 14.0 36.0 60-61 30.78382095523881 36.0 29.5 36.0 14.0 36.0 62-63 30.846086521630408 36.0 29.5 36.0 14.0 36.0 64-65 30.66966741685421 36.0 29.5 36.0 14.0 36.0 66-67 30.566549912434326 36.0 27.0 36.0 14.0 36.0 68-69 30.54916187140355 36.0 27.0 36.0 14.0 36.0 70-71 30.43800336488603 36.0 27.0 36.0 14.0 36.0 72-73 30.437009692042828 36.0 27.0 36.0 14.0 36.0 74-75 30.253582219606304 36.0 27.0 36.0 14.0 36.0 76 28.76340579710145 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 4.0 16 9.0 17 10.0 18 9.0 19 11.0 20 10.0 21 10.0 22 23.0 23 40.0 24 43.0 25 79.0 26 125.0 27 149.0 28 208.0 29 276.0 30 315.0 31 429.0 32 481.0 33 627.0 34 752.0 35 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.00200150112585 15.61170878158619 13.335001250938202 35.05128846634976 2 31.123342506880157 23.567675756817614 22.992244183137352 22.316737553164874 3 26.674999999999997 28.625 19.6 25.1 4 30.599999999999998 29.75 17.349999999999998 22.3 5 29.997498123592692 31.77383037277958 18.839129347010257 19.389542156617463 6 25.519139354515886 34.60095071303478 19.5896922692019 20.290217663247436 7 24.3 18.85 30.9 25.95 8 26.375 22.575 23.175 27.875 9 24.5 22.325 25.424999999999997 27.750000000000004 10-11 28.028503562945367 27.378422302787847 19.6399549943743 24.953119139892486 12-13 27.55 22.2625 22.787499999999998 27.400000000000002 14-15 25.8125 25.087500000000002 23.849999999999998 25.25 16-17 28.449999999999996 23.2625 22.175 26.1125 18-19 26.6 23.4125 23.4375 26.55 20-21 26.487500000000004 25.7375 22.1875 25.587500000000002 22-23 27.5625 24.8125 22.35 25.275 24-25 26.91922980745186 24.55613903475869 22.968242060515127 25.55638909727432 26-27 27.125 25.025 22.900000000000002 24.95 28-29 27.85 24.212500000000002 22.0625 25.874999999999996 30-31 26.55 24.712500000000002 23.0625 25.674999999999997 32-33 26.2625 25.424999999999997 23.0625 25.25 34-35 27.250000000000004 23.599999999999998 22.7625 26.387500000000003 36-37 27.3125 24.474999999999998 22.85 25.362499999999997 38-39 26.450000000000003 24.9875 22.775000000000002 25.7875 40-41 28.325 24.224999999999998 21.5375 25.912499999999998 42-43 27.028378547318415 24.190523815476936 23.0278784848106 25.753219152394045 44-45 27.51937984496124 24.568642160540136 22.643160790197552 25.268817204301076 46-47 26.981745436359088 24.218554638659665 22.930732683170792 25.868967241810452 48-49 25.968992248062015 24.981245311327832 22.343085771442862 26.70667666916729 50-51 27.644411102775695 24.268567141785446 23.13078269567392 24.956239059764943 52-53 27.60690172543136 23.568392098024507 22.768192048012004 26.056514128532132 54-55 27.219304826206553 24.76869217304326 22.968242060515127 25.04376094023506 56-57 27.419354838709676 24.431107776944234 23.40585146286572 24.74368592148037 58-59 27.131782945736433 24.33108277069267 23.393348337084273 25.143785946486624 60-61 27.031757939484873 23.755938984746187 23.543385846461614 25.668917229307326 62-63 27.231807951987996 24.243560890222557 22.680670167541887 25.84396099024756 64-65 27.26931732933233 24.593648412103025 22.31807951987997 25.818954738684667 66-67 26.1195896922692 24.48086064548411 22.729547160370277 26.670002501876404 68-69 26.057042782086565 24.906179634726044 23.367525644233176 25.66925193895422 70-71 26.936069060427876 24.496434380082572 22.694858000750656 25.8726385587389 72-73 26.18209255533199 23.70472837022133 23.377766599597585 26.735412474849095 74-75 26.980956185910244 20.868291383672926 25.649220934878148 26.50153149553869 76 28.706052917723813 0.0 33.70786516853933 37.58608191373686 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 2.5 20 2.0 21 1.5 22 1.5 23 2.0 24 3.5 25 7.5 26 8.0 27 6.0 28 6.5 29 7.5 30 9.0 31 15.0 32 26.0 33 30.5 34 39.5 35 54.0 36 64.0 37 78.5 38 104.5 39 128.5 40 132.0 41 142.0 42 162.5 43 172.5 44 181.0 45 190.5 46 192.0 47 179.5 48 153.0 49 155.0 50 169.0 51 155.0 52 147.5 53 153.0 54 152.0 55 135.0 56 130.0 57 130.0 58 129.0 59 146.5 60 153.5 61 137.0 62 124.5 63 117.0 64 107.5 65 109.0 66 100.0 67 87.5 68 80.5 69 75.0 70 65.5 71 51.0 72 53.5 73 55.0 74 48.0 75 43.5 76 35.5 77 21.0 78 15.5 79 18.0 80 15.5 81 11.5 82 6.0 83 3.0 84 4.5 85 5.5 86 3.5 87 2.0 88 3.0 89 2.0 90 1.0 91 1.5 92 1.0 93 0.5 94 1.0 95 1.0 96 0.0 97 0.5 98 2.0 99 5.5 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.0 4 0.0 5 0.075 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.036231884057971016 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 8.0 72 24.0 73 62.0 74 295.0 75 847.0 76 2760.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44546381243629 96.575 2 1.401630988786952 2.75 3 0.10193679918450561 0.3 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629907 spots for SRR11389847.sra Written 629907 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra Read 629903 spots for SRR11389847.sra Written 629903 spots for SRR11389847.sra SRR ids: ['SRR11389847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ulicc3sz SRR11389847.sra spots: 12598064 blocks: [[1, 629903], [629904, 1259806], [1259807, 1889709], [1889710, 2519612], [2519613, 3149515], [3149516, 3779418], [3779419, 4409321], [4409322, 5039224], [5039225, 5669127], [5669128, 6299030], [6299031, 6928933], [6928934, 7558836], [7558837, 8188739], [8188740, 8818642], [8818643, 9448545], [9448546, 10078448], [10078449, 10708351], [10708352, 11338254], [11338255, 11968157], [11968158, 12598064]] SRR11389847 file size 2390833 SRR11389847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389847 SRR11389847_1.fastq SRR11389847_2.fastq Input file: SRR11389847_1.fastq Paired file: SRR11389847_2.fastq trimmed: SRR11389847-trimmed-pair1.fastq, SRR11389847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:04:21 2024 >> started Sat Dec 7 08:04:33 2024 >> done (11.782s) 12598064 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 9642 ( 0.08%) empty read pairs filtered out after trimming by size control 12588415 (99.92%) read pairs available; of these: 13368 ( 0.11%) trimmed read pairs available after processing 12575047 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 6 0.00% 32 0 0.00% 33 5 0.00% 34 2 0.00% 35 71 0.00% 36 93 0.00% 37 98 0.00% 38 108 0.00% 39 146 0.00% 40 189 0.00% 41 213 0.00% 42 212 0.00% 43 287 0.00% 44 310 0.00% 45 328 0.00% 46 334 0.00% 47 421 0.00% 48 404 0.00% 49 486 0.00% 50 531 0.00% 51 590 0.00% 52 649 0.01% 53 718 0.01% 54 750 0.01% 55 887 0.01% 56 933 0.01% 57 1126 0.01% 58 1213 0.01% 59 1200 0.01% 60 1321 0.01% 61 1341 0.01% 62 1441 0.01% 63 1532 0.01% 64 1676 0.01% 65 1796 0.01% 66 2015 0.02% 67 2317 0.02% 68 2322 0.02% 69 2579 0.02% 70 3070 0.02% 71 4130 0.03% 72 12816 0.10% 73 100836 0.80% 74 836615 6.65% 75 5450743 43.30% 76 6149534 48.85% 12588415 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=18 prefix-density=0.90 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=37.91 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.0 sequence=TCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=14 prefix-density=0.70 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=6.68 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.0 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389847 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:05:15 Started mapping on | Dec 07 08:05:16 Finished on | Dec 07 08:06:27 Mapping speed, Million of reads per hour | 638.29 Number of input reads | 12588415 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 10803040 Uniquely mapped reads % | 85.82% Average mapped length | 150.08 Number of splices: Total | 4814665 Number of splices: Annotated (sjdb) | 4625173 Number of splices: GT/AG | 4751932 Number of splices: GC/AG | 55551 Number of splices: AT/AC | 1603 Number of splices: Non-canonical | 5579 Mismatch rate per base, % | 0.98% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.00% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 990120 % of reads mapped to multiple loci | 7.87% Number of reads mapped to too many loci | 14680 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.66% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 795255 795255 795255 N_multimapping 990120 990120 990120 N_noFeature 282206 10545833 359396 N_ambiguous 251610 992 76745 UnstrandedReadsAssigned:10269224 PositiveStrandReadsAssigned:256215 NegativeStrandReadsAssigned:10366899 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389847-trimmed-pair1.fastq SRR11389847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,588,415 reads, 11,451,254 reads pseudoaligned [quant] estimated average fragment length: 220.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52973 SRR11389847.ke.tsv 35125 SRR11389847.se.tsv 88098 total ==> SRR11389847.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.136 0 0 PNS24247 1044 824.94 8.4269 1.16415 PNS24249 1928 1708.94 67.8675 4.52582 PNS24246 1044 824.94 8.4269 1.16415 PNS24248 1044 824.94 8.4269 1.16415 PNS24244 1471 1251.94 16.8518 1.534 PNS24243 293 98.1981 0 0 KQK14069 1603 1383.94 24.6443 2.02937 KQK14071 474 258.026 2.35572 1.04045 ==> SRR11389847.se.tsv <== BRADI_1g14170v3 27 BRADI_1g53295v3 10 BRADI_1g59795v3 142 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 114 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 79 BRADI_1g48960v3 0 SRR11389847 completed mapping pipeline successfully