Starting /dee2/code/volunteer_pipeline.sh SRR11389848 current disk space = 1544511741952 free memory = 1601764956 SRR11389848 SRAfilesize fbbf66ed042ef8e8ab57256ca3fae097 SRR11389848.sra SRR11389848.sra file validated SRR11389848 is paired end SRR11389848 is conventional basespace SRR11389848 read1 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1085 32.0 32.0 32.0 32.0 32.0 2 31.0325 32.0 32.0 32.0 32.0 32.0 3 31.02025 32.0 32.0 32.0 32.0 32.0 4 31.18375 32.0 32.0 32.0 32.0 32.0 5 31.0405 32.0 32.0 32.0 32.0 32.0 6 33.91025 36.0 36.0 36.0 32.0 36.0 7 33.79775 36.0 36.0 36.0 32.0 36.0 8 33.86075 36.0 36.0 36.0 32.0 36.0 9 34.01875 36.0 36.0 36.0 32.0 36.0 10-11 33.893875 36.0 36.0 36.0 32.0 36.0 12-13 33.93775 36.0 36.0 36.0 32.0 36.0 14-15 33.937625 36.0 36.0 36.0 32.0 36.0 16-17 33.981750000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.834625 36.0 36.0 36.0 32.0 36.0 20-21 33.6905 36.0 36.0 36.0 29.5 36.0 22-23 33.632000000000005 36.0 36.0 36.0 27.0 36.0 24-25 33.668375 36.0 36.0 36.0 29.5 36.0 26-27 33.310874999999996 36.0 36.0 36.0 20.5 36.0 28-29 33.3125 36.0 36.0 36.0 21.0 36.0 30-31 33.218625 36.0 36.0 36.0 21.0 36.0 32-33 33.20975 36.0 36.0 36.0 17.5 36.0 34-35 33.116 36.0 36.0 36.0 14.0 36.0 36-37 33.08075 36.0 36.0 36.0 17.5 36.0 38-39 33.120905226306576 36.0 36.0 36.0 14.0 36.0 40-41 33.18179544886222 36.0 36.0 36.0 17.5 36.0 42-43 32.84796199049762 36.0 36.0 36.0 14.0 36.0 44-45 32.9739934983746 36.0 36.0 36.0 14.0 36.0 46-47 32.618154538634656 36.0 32.0 36.0 14.0 36.0 48-49 32.61127781945486 36.0 32.0 36.0 14.0 36.0 50-51 32.3070767691923 36.0 32.0 36.0 14.0 36.0 52-53 32.20660330165082 36.0 32.0 36.0 14.0 36.0 54-55 32.05727863931966 36.0 32.0 36.0 14.0 36.0 56-57 31.99787393696848 36.0 32.0 36.0 14.0 36.0 58-59 31.909432074055545 36.0 32.0 36.0 14.0 36.0 60-61 32.09344508381286 36.0 32.0 36.0 14.0 36.0 62-63 31.802727045283966 36.0 32.0 36.0 14.0 36.0 64-65 31.71121121121121 36.0 32.0 36.0 14.0 36.0 66-67 31.662828535669586 36.0 32.0 36.0 14.0 36.0 68-69 31.59549436795995 36.0 32.0 36.0 14.0 36.0 70-71 31.638240339232254 36.0 32.0 36.0 14.0 36.0 72-73 31.7038116596303 36.0 32.0 36.0 14.0 36.0 74-75 31.52190559242034 36.0 32.0 36.0 14.0 36.0 76 29.935426328933286 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 3.0 22 5.0 23 9.0 24 21.0 25 25.0 26 69.0 27 92.0 28 171.0 29 210.0 30 279.0 31 376.0 32 513.0 33 643.0 34 937.0 35 646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.625 8.525 14.499999999999998 30.349999999999998 2 29.299999999999997 11.725 25.6 33.375 3 27.800000000000004 15.975 20.375 35.85 4 32.35 23.674999999999997 18.375 25.6 5 31.324999999999996 27.025 21.725 19.925 6 25.1 31.624999999999996 22.475 20.8 7 19.2 26.3 33.475 21.025 8 20.3 25.900000000000002 28.375 25.424999999999997 9 19.325 20.75 32.45 27.474999999999998 10-11 24.462500000000002 29.15 22.6 23.7875 12-13 25.387500000000003 24.2875 24.637500000000003 25.687500000000004 14-15 24.349999999999998 24.6625 24.9 26.087500000000002 16-17 24.637500000000003 24.4375 24.3125 26.6125 18-19 25.650000000000002 24.9875 24.5 24.8625 20-21 26.275 24.55 23.7125 25.4625 22-23 24.325 25.275 24.3 26.1 24-25 25.4 24.25 24.75 25.6 26-27 24.837500000000002 24.2625 23.9125 26.987499999999997 28-29 25.05 24.15 24.3625 26.437500000000004 30-31 24.55 25.2625 23.8375 26.35 32-33 25.4 23.674999999999997 24.625 26.3 34-35 24.775 23.9875 25.5125 25.724999999999998 36-37 25.174999999999997 23.6125 24.25 26.9625 38-39 25.36884221055264 23.868467116779193 24.893723430857715 25.868967241810452 40-41 26.36909227306827 24.306076519129782 23.443360840210055 25.881470367591895 42-43 24.668667166791696 25.018754688672168 24.60615153788447 25.70642660665166 44-45 24.831207801950487 24.18104526131533 24.60615153788447 26.38159539884971 46-47 25.30632658164541 24.731182795698924 24.36859214803701 25.593898474618655 48-49 25.218804701175294 24.33108277069267 23.74343585896474 26.70667666916729 50-51 25.03125781445361 23.468367091772944 24.293573393348336 27.206801700425103 52-53 25.50025012506253 24.212106053026513 22.67383691845923 27.613806903451728 54-55 25.050025012506254 24.16208104052026 23.84942471235618 26.93846923461731 56-57 25.275137568784395 24.499749874937468 23.386693346673336 26.8384192096048 58-59 24.981235926945207 23.992994746059544 23.792844633475106 27.23292469352014 60-61 25.168876657493122 24.768576432324245 23.329997498123593 26.732549412059043 62-63 25.881911433575183 24.355766825118838 23.755316487365523 26.007005253940456 64-65 24.486986986986985 24.16166166166166 25.100100100100097 26.25125125125125 66-67 24.943679599499376 22.941176470588236 25.519399249061326 26.595744680851062 68-69 25.106382978723403 23.329161451814766 24.680851063829788 26.883604505632043 70-71 24.809112529728377 23.60746025785455 24.583802728752033 26.99962448366504 72-73 25.652282990466635 23.381836427496236 24.397892624184646 26.567987957852484 74-75 26.05252738550878 20.205886234657516 24.917513527781445 28.82407285205226 76 28.219764537995008 0.0 32.85765251516233 38.922582946842674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.0 17 1.5 18 2.5 19 2.5 20 4.0 21 6.0 22 3.5 23 3.0 24 5.5 25 7.0 26 8.5 27 12.5 28 16.5 29 18.0 30 19.0 31 20.5 32 25.5 33 31.5 34 41.0 35 57.5 36 79.0 37 87.0 38 94.0 39 123.5 40 129.5 41 143.5 42 174.5 43 188.0 44 206.5 45 206.5 46 200.0 47 196.0 48 174.0 49 167.0 50 166.5 51 150.0 52 138.5 53 135.0 54 134.5 55 129.5 56 116.5 57 116.5 58 126.5 59 123.5 60 126.5 61 125.0 62 109.0 63 116.0 64 121.5 65 114.0 66 103.5 67 93.5 68 87.5 69 72.5 70 65.0 71 64.0 72 58.5 73 49.5 74 34.0 75 25.5 76 28.0 77 26.0 78 20.0 79 13.5 80 11.0 81 9.0 82 5.5 83 3.5 84 3.0 85 1.5 86 0.0 87 0.0 88 1.0 89 1.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 3.0 72 10.0 73 65.0 74 255.0 75 858.0 76 2803.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10305049987183 95.675 2 1.4611638041527815 2.85 3 0.2819789797487824 0.8250000000000001 4 0.10253781081773904 0.4 5 0.05126890540886952 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 5 0.125 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389848 read2 length is 37-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44575 32.0 32.0 32.0 21.0 32.0 2 30.0585 32.0 32.0 32.0 21.0 32.0 3 29.95375 32.0 32.0 32.0 21.0 32.0 4 30.195 32.0 32.0 32.0 21.0 32.0 5 30.042 32.0 32.0 32.0 21.0 32.0 6 32.967 36.0 36.0 36.0 21.0 36.0 7 33.36225 36.0 36.0 36.0 21.0 36.0 8 33.0715 36.0 36.0 36.0 21.0 36.0 9 33.20375 36.0 36.0 36.0 21.0 36.0 10-11 32.93625 36.0 36.0 36.0 17.5 36.0 12-13 32.817625 36.0 36.0 36.0 14.0 36.0 14-15 33.011375 36.0 36.0 36.0 17.5 36.0 16-17 32.987125000000006 36.0 36.0 36.0 21.0 36.0 18-19 32.926125 36.0 36.0 36.0 17.5 36.0 20-21 32.64625 36.0 36.0 36.0 14.0 36.0 22-23 32.76775 36.0 36.0 36.0 17.5 36.0 24-25 32.777875 36.0 36.0 36.0 14.0 36.0 26-27 32.453375 36.0 34.0 36.0 14.0 36.0 28-29 32.415125 36.0 36.0 36.0 14.0 36.0 30-31 32.334875 36.0 32.0 36.0 14.0 36.0 32-33 32.354124999999996 36.0 34.0 36.0 14.0 36.0 34-35 32.235125 36.0 32.0 36.0 14.0 36.0 36-37 32.304249999999996 36.0 32.0 36.0 14.0 36.0 38-39 32.140035008752186 36.0 32.0 36.0 14.0 36.0 40-41 31.96736684171043 36.0 32.0 36.0 14.0 36.0 42-43 31.786821705426355 36.0 32.0 36.0 14.0 36.0 44-45 31.88659664916229 36.0 32.0 36.0 14.0 36.0 46-47 31.752688172043012 36.0 32.0 36.0 14.0 36.0 48-49 31.75818954738685 36.0 32.0 36.0 14.0 36.0 50-51 31.611527881970492 36.0 32.0 36.0 14.0 36.0 52-53 31.501500750375186 36.0 32.0 36.0 14.0 36.0 54-55 31.24574787393697 36.0 32.0 36.0 14.0 36.0 56-57 30.79639819909955 36.0 27.0 36.0 14.0 36.0 58-59 31.012009006755065 36.0 32.0 36.0 14.0 36.0 60-61 30.967600700525395 36.0 32.0 36.0 14.0 36.0 62-63 30.926194645984488 36.0 32.0 36.0 14.0 36.0 64-65 30.684684684684683 36.0 27.0 36.0 14.0 36.0 66-67 30.790849666239033 36.0 29.5 36.0 14.0 36.0 68-69 30.66662493740611 36.0 27.0 36.0 14.0 36.0 70-71 30.622669109533007 36.0 27.0 36.0 14.0 36.0 72-73 30.530997667744366 36.0 27.0 36.0 14.0 36.0 74-75 30.352869966497316 36.0 27.0 36.0 14.0 36.0 76 28.932779183230934 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 9.0 16 12.0 17 8.0 18 5.0 19 11.0 20 7.0 21 11.0 22 18.0 23 21.0 24 47.0 25 82.0 26 125.0 27 160.0 28 185.0 29 273.0 30 321.0 31 391.0 32 459.0 33 645.0 34 784.0 35 423.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.9584896224056 15.753938484621155 12.85321330332583 37.43435858964741 2 30.407601900475118 23.305826456614152 23.13078269567392 23.15578894723681 3 29.099999999999998 27.1 18.925 24.875 4 30.725 29.099999999999998 17.5 22.675 5 29.48237059264816 30.307576894223555 19.854963740935233 20.355088772193046 6 23.724999999999998 34.150000000000006 18.9 23.225 7 23.425 17.175 32.375 27.025 8 26.325 22.425 22.15 29.099999999999998 9 23.799999999999997 21.625 26.6 27.975 10-11 27.1 26.8 19.875 26.224999999999998 12-13 28.1 21.1375 22.425 28.3375 14-15 26.7625 23.7625 23.0875 26.387500000000003 16-17 27.487499999999997 23.150000000000002 22.6875 26.674999999999997 18-19 26.937499999999996 23.5 22.8125 26.75 20-21 26.737499999999997 24.275 23.0125 25.974999999999998 22-23 27.85 23.5 21.837500000000002 26.8125 24-25 26.737499999999997 24.65 22.7 25.912499999999998 26-27 27.1125 24.9 22.4875 25.5 28-29 27.55 24.4875 21.5375 26.424999999999997 30-31 27.474999999999998 24.675 21.325 26.525 32-33 26.6125 24.825 22.8875 25.674999999999997 34-35 26.325 25.025 21.762500000000003 26.887499999999996 36-37 26.625 24.575 21.95 26.85 38-39 27.144286071517882 24.706176544136035 22.143035758939735 26.006501625406354 40-41 26.981745436359088 23.893473368342086 22.630657664416105 26.494123530882717 42-43 27.094273568392097 24.01850462615654 22.53063265816454 26.356589147286826 44-45 26.79419854963741 24.431107776944234 22.693173293323333 26.081520380095025 46-47 27.419354838709676 23.680920230057513 22.18054513628407 26.71917979494874 48-49 27.956989247311824 23.168292073018254 21.892973243310827 26.981745436359088 50-51 26.93173293323331 24.118529632408105 22.31807951987997 26.63165791447862 52-53 27.41370685342671 23.936968484242122 22.136068034017008 26.513256628314156 54-55 27.938969484742373 24.137068534267133 21.53576788394197 26.388194097048522 56-57 27.288644322161083 24.424712356178087 22.373686843421712 25.912956478239117 58-59 27.383037277958465 24.243182386790092 22.54190642982237 25.83187390542907 60-61 26.194645984488368 23.44258193645234 23.417563172379285 26.945208906680012 62-63 27.995996997748314 24.030522892169127 22.191643732799598 25.781836377282964 64-65 28.128128128128125 24.06156156156156 21.77177177177177 26.038538538538536 66-67 27.22493428464138 23.532356990862436 22.49342846413819 26.749280260357995 68-69 26.377065598397596 23.73560340510766 23.222333500250375 26.664997496244368 70-71 27.74436090225564 23.44611528822055 22.531328320802004 26.278195488721806 72-73 26.615539351269803 23.346743776716117 22.25295448830777 27.784762383706312 74-75 27.93126239259749 21.520158625247852 22.709847984137475 27.838730998017187 76 29.201301048066497 0.0 32.092518973617636 38.706179978315866 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 2.5 21 3.0 22 4.0 23 5.5 24 5.5 25 4.0 26 5.0 27 7.5 28 8.5 29 10.0 30 13.5 31 18.5 32 23.5 33 26.5 34 38.5 35 64.5 36 77.0 37 74.0 38 79.0 39 102.0 40 130.0 41 136.0 42 144.5 43 154.5 44 158.5 45 157.0 46 148.0 47 150.0 48 152.5 49 160.0 50 161.0 51 151.0 52 136.0 53 127.0 54 135.0 55 125.5 56 133.0 57 144.5 58 137.0 59 144.0 60 154.0 61 161.5 62 150.5 63 134.0 64 119.5 65 116.0 66 109.5 67 95.0 68 102.0 69 110.0 70 91.5 71 76.0 72 75.5 73 60.5 74 49.0 75 46.0 76 37.5 77 27.5 78 18.0 79 13.0 80 9.5 81 7.0 82 9.0 83 11.0 84 7.0 85 3.0 86 3.5 87 4.0 88 4.0 89 3.5 90 2.0 91 0.5 92 0.0 93 0.0 94 0.0 95 1.5 96 3.0 97 2.0 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 2.0 70 4.0 71 2.0 72 18.0 73 57.0 74 257.0 75 887.0 76 2767.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.419173890872 96.5 2 1.249362570117287 2.45 3 0.28046914839367665 0.8250000000000001 4 0.025497195308516064 0.1 5 0.025497195308516064 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra Read 491599 spots for SRR11389848.sra Written 491599 spots for SRR11389848.sra Read 491593 spots for SRR11389848.sra Written 491593 spots for SRR11389848.sra SRR ids: ['SRR11389848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_svxpzfcp SRR11389848.sra spots: 9831866 blocks: [[1, 491593], [491594, 983186], [983187, 1474779], [1474780, 1966372], [1966373, 2457965], [2457966, 2949558], [2949559, 3441151], [3441152, 3932744], [3932745, 4424337], [4424338, 4915930], [4915931, 5407523], [5407524, 5899116], [5899117, 6390709], [6390710, 6882302], [6882303, 7373895], [7373896, 7865488], [7865489, 8357081], [8357082, 8848674], [8848675, 9340267], [9340268, 9831866]] SRR11389848 file size 1861311 SRR11389848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389848 SRR11389848_1.fastq SRR11389848_2.fastq Input file: SRR11389848_1.fastq Paired file: SRR11389848_2.fastq trimmed: SRR11389848-trimmed-pair1.fastq, SRR11389848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:04:03 2024 >> started Sat Dec 7 08:04:11 2024 >> done (8.472s) 9831866 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 14891 ( 0.15%) empty read pairs filtered out after trimming by size control 9816974 (99.85%) read pairs available; of these: 10256 ( 0.10%) trimmed read pairs available after processing 9806718 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 96 0.00% 36 108 0.00% 37 129 0.00% 38 130 0.00% 39 184 0.00% 40 212 0.00% 41 264 0.00% 42 271 0.00% 43 327 0.00% 44 314 0.00% 45 328 0.00% 46 350 0.00% 47 432 0.00% 48 453 0.00% 49 462 0.00% 50 566 0.01% 51 626 0.01% 52 614 0.01% 53 729 0.01% 54 781 0.01% 55 856 0.01% 56 902 0.01% 57 1019 0.01% 58 1082 0.01% 59 1188 0.01% 60 1250 0.01% 61 1194 0.01% 62 1325 0.01% 63 1476 0.02% 64 1565 0.02% 65 1618 0.02% 66 1771 0.02% 67 1900 0.02% 68 1958 0.02% 69 2037 0.02% 70 2480 0.03% 71 3283 0.03% 72 9734 0.10% 73 77600 0.79% 74 640027 6.52% 75 4193917 42.72% 76 4861408 49.52% 9816974 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=21 prefix-density=0.67 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=15.74 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.5 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.1 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.20 sequence-density-rank=19 fanout-score=81.89 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=15.8 sequence=GCCGCCGCCACCCT SRR11389848 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:05:04 Started mapping on | Dec 07 08:05:04 Finished on | Dec 07 08:05:53 Mapping speed, Million of reads per hour | 721.25 Number of input reads | 9816974 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 8291827 Uniquely mapped reads % | 84.46% Average mapped length | 150.05 Number of splices: Total | 3547410 Number of splices: Annotated (sjdb) | 3411079 Number of splices: GT/AG | 3502375 Number of splices: GC/AG | 39470 Number of splices: AT/AC | 1132 Number of splices: Non-canonical | 4433 Mismatch rate per base, % | 1.00% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 722870 % of reads mapped to multiple loci | 7.36% Number of reads mapped to too many loci | 17326 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.16% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802278 802278 802278 N_multimapping 722870 722870 722870 N_noFeature 232750 8091857 287179 N_ambiguous 202945 821 61136 UnstrandedReadsAssigned:7856132 PositiveStrandReadsAssigned:199149 NegativeStrandReadsAssigned:7943512 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389848-trimmed-pair1.fastq SRR11389848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,816,974 reads, 8,721,162 reads pseudoaligned [quant] estimated average fragment length: 240.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR11389848.ke.tsv 35125 SRR11389848.se.tsv 88098 total ==> SRR11389848.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.41 0 0 PNS24247 1044 804.171 11.1555 1.98547 PNS24249 1928 1688.17 52.5352 4.45406 PNS24246 1044 804.171 11.1555 1.98547 PNS24248 1044 804.171 11.1555 1.98547 PNS24244 1471 1231.17 2.99832 0.348563 PNS24243 293 84.1518 0 0 KQK14069 1603 1363.17 259.9 27.2884 KQK14071 474 237.663 16.7467 10.0853 ==> SRR11389848.se.tsv <== BRADI_1g14170v3 307 BRADI_1g53295v3 5 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 78 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 91 BRADI_1g48960v3 0 SRR11389848 completed mapping pipeline successfully