Starting /dee2/code/volunteer_pipeline.sh SRR11389849 current disk space = 1544507654144 free memory = 1603389352 SRR11389849 SRAfilesize a02b2d87c835523c442559b2112f0ef5 SRR11389849.sra SRR11389849.sra file validated SRR11389849 is paired end SRR11389849 is conventional basespace SRR11389849 read1 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.00175 32.0 32.0 32.0 32.0 32.0 2 31.02875 32.0 32.0 32.0 32.0 32.0 3 31.0455 32.0 32.0 32.0 32.0 32.0 4 31.1125 32.0 32.0 32.0 32.0 32.0 5 31.0985 32.0 32.0 32.0 32.0 32.0 6 33.807 36.0 36.0 36.0 32.0 36.0 7 33.8085 36.0 36.0 36.0 32.0 36.0 8 34.0625 36.0 36.0 36.0 32.0 36.0 9 33.6165 36.0 36.0 36.0 32.0 36.0 10-11 33.727374999999995 36.0 36.0 36.0 32.0 36.0 12-13 33.89975 36.0 36.0 36.0 32.0 36.0 14-15 33.769 36.0 36.0 36.0 32.0 36.0 16-17 33.835125000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.745625000000004 36.0 36.0 36.0 29.5 36.0 20-21 33.709875 36.0 36.0 36.0 29.5 36.0 22-23 33.637375 36.0 36.0 36.0 27.0 36.0 24-25 33.354 36.0 36.0 36.0 24.0 36.0 26-27 33.29025 36.0 36.0 36.0 21.0 36.0 28-29 33.227125 36.0 36.0 36.0 17.5 36.0 30-31 33.273375 36.0 36.0 36.0 21.0 36.0 32-33 33.221625 36.0 36.0 36.0 20.5 36.0 34-35 32.961124999999996 36.0 36.0 36.0 14.0 36.0 36-37 32.991 36.0 36.0 36.0 14.0 36.0 38-39 33.024625 36.0 36.0 36.0 14.0 36.0 40-41 32.920874999999995 36.0 36.0 36.0 14.0 36.0 42-43 32.7975 36.0 36.0 36.0 14.0 36.0 44-45 32.884 36.0 36.0 36.0 14.0 36.0 46-47 32.433 36.0 32.0 36.0 14.0 36.0 48-49 32.45625 36.0 32.0 36.0 14.0 36.0 50-51 32.287375 36.0 32.0 36.0 14.0 36.0 52-53 32.065875000000005 36.0 32.0 36.0 14.0 36.0 54-55 31.944597586896723 36.0 32.0 36.0 14.0 36.0 56-57 31.904101025256317 36.0 32.0 36.0 14.0 36.0 58-59 31.68934467233617 36.0 32.0 36.0 14.0 36.0 60-61 31.949099549774886 36.0 32.0 36.0 14.0 36.0 62-63 31.745809357017762 36.0 32.0 36.0 14.0 36.0 64-65 31.764639343086788 36.0 32.0 36.0 14.0 36.0 66-67 31.455444305381725 36.0 32.0 36.0 14.0 36.0 68-69 31.61639549436796 36.0 32.0 36.0 14.0 36.0 70-71 31.51282661742217 36.0 32.0 36.0 14.0 36.0 72-73 31.475594710740676 36.0 32.0 36.0 14.0 36.0 74-75 31.536884094881813 36.0 32.0 36.0 14.0 36.0 76 29.90087145969499 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 7.0 23 5.0 24 20.0 25 37.0 26 70.0 27 111.0 28 137.0 29 226.0 30 308.0 31 427.0 32 492.0 33 647.0 34 884.0 35 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.025 9.049999999999999 14.875 30.049999999999997 2 31.025000000000002 10.825 26.5 31.65 3 27.325 16.3 20.974999999999998 35.4 4 32.324999999999996 23.425 18.875 25.374999999999996 5 28.325 27.075 21.0 23.599999999999998 6 24.4 29.799999999999997 23.724999999999998 22.075 7 18.475 25.7 34.25 21.575 8 20.95 23.45 31.0 24.6 9 21.2 20.325 31.5 26.974999999999998 10-11 24.4875 28.8875 23.1625 23.4625 12-13 24.425 24.4375 24.5375 26.6 14-15 23.75 25.75 25.074999999999996 25.424999999999997 16-17 24.425 25.45 24.349999999999998 25.775 18-19 24.3625 24.712500000000002 24.4125 26.5125 20-21 24.837500000000002 24.875 24.9875 25.3 22-23 24.65 24.5625 25.45 25.337500000000002 24-25 23.825 24.8125 24.825 26.5375 26-27 24.1125 25.637500000000003 24.7 25.55 28-29 26.174999999999997 24.45 23.549999999999997 25.825 30-31 25.074999999999996 25.5 24.2375 25.1875 32-33 24.675 24.125 25.1 26.1 34-35 24.3875 24.3125 24.4375 26.8625 36-37 24.6 24.725 24.875 25.8 38-39 23.9375 24.9875 24.6125 26.4625 40-41 25.1 25.05 23.2375 26.6125 42-43 24.6125 24.8 24.087500000000002 26.5 44-45 23.9125 24.8625 24.625 26.6 46-47 25.650000000000002 25.05 23.7375 25.5625 48-49 24.775 25.025 23.35 26.85 50-51 24.349999999999998 24.3625 24.762500000000003 26.525 52-53 24.525 24.762500000000003 24.0375 26.674999999999997 54-55 24.515564445555693 24.065508188523566 24.90311288911114 26.515814476809602 56-57 23.99349837459365 24.60615153788447 25.243810952738183 26.156539134783696 58-59 24.449724862431214 24.374687343671837 23.74937468734367 27.426213106553277 60-61 25.337668834417208 24.012006003001503 23.84942471235618 26.80090045022511 62-63 25.65674255691769 24.668501376032022 24.1556167125344 25.519139354515886 64-65 25.125125125125123 23.936436436436438 24.06156156156156 26.876876876876878 66-67 25.15644555694618 23.14142678347935 24.618272841051315 27.083854818523157 68-69 26.207759699624532 23.429286608260323 24.155193992490613 26.207759699624532 70-71 24.946775203506576 24.107701941139638 24.132748904195367 26.81277395115842 72-73 26.16118503640472 23.123273914135073 24.102435350238512 26.61310569922169 74-75 24.9406802003691 20.47192196150804 26.37753756920643 28.209860268916426 76 27.959331880900507 0.0 36.02033405954975 36.02033405954975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 3.5 19 4.0 20 5.5 21 8.0 22 6.0 23 4.0 24 3.0 25 3.5 26 4.0 27 8.5 28 13.0 29 11.0 30 12.0 31 17.0 32 26.5 33 37.0 34 40.0 35 48.0 36 72.0 37 95.0 38 110.5 39 135.5 40 163.0 41 174.5 42 186.5 43 201.5 44 209.0 45 203.5 46 192.5 47 187.0 48 179.0 49 187.5 50 194.5 51 165.5 52 151.0 53 136.5 54 112.0 55 116.5 56 120.0 57 119.5 58 123.5 59 126.5 60 127.0 61 124.0 62 120.5 63 110.5 64 95.5 65 95.5 66 87.0 67 64.0 68 57.5 69 63.0 70 61.0 71 54.5 72 50.5 73 43.0 74 37.5 75 34.5 76 24.5 77 21.0 78 20.5 79 16.5 80 15.5 81 9.0 82 3.5 83 1.5 84 1.5 85 2.5 86 1.5 87 0.0 88 0.0 89 1.0 90 2.0 91 1.5 92 1.0 93 1.5 94 1.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.0 69 2.0 70 1.0 71 1.0 72 16.0 73 55.0 74 254.0 75 912.0 76 2754.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02816901408451 95.7 2 1.6389244558258642 3.2 3 0.28169014084507044 0.8250000000000001 4 0.0 0.0 5 0.02560819462227913 0.125 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 6 0.15 No Hit GCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389849 read2 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4465 32.0 32.0 32.0 21.0 32.0 2 29.79825 32.0 32.0 32.0 14.0 32.0 3 29.8095 32.0 32.0 32.0 21.0 32.0 4 29.7175 32.0 32.0 32.0 21.0 32.0 5 29.78525 32.0 32.0 32.0 21.0 32.0 6 32.39775 36.0 32.0 36.0 14.0 36.0 7 32.72325 36.0 32.0 36.0 21.0 36.0 8 32.727 36.0 36.0 36.0 21.0 36.0 9 32.644 36.0 32.0 36.0 14.0 36.0 10-11 32.572874999999996 36.0 32.0 36.0 17.5 36.0 12-13 32.377375 36.0 32.0 36.0 14.0 36.0 14-15 32.3535 36.0 34.0 36.0 14.0 36.0 16-17 32.383625 36.0 32.0 36.0 14.0 36.0 18-19 32.452 36.0 32.0 36.0 14.0 36.0 20-21 32.105625 36.0 32.0 36.0 14.0 36.0 22-23 32.376 36.0 32.0 36.0 14.0 36.0 24-25 32.168375 36.0 32.0 36.0 14.0 36.0 26-27 31.861125 36.0 32.0 36.0 14.0 36.0 28-29 31.9095 36.0 32.0 36.0 14.0 36.0 30-31 31.782375000000002 36.0 32.0 36.0 14.0 36.0 32-33 31.857 36.0 32.0 36.0 14.0 36.0 34-35 32.001625 36.0 32.0 36.0 14.0 36.0 36-37 31.5955 36.0 32.0 36.0 14.0 36.0 38-39 31.745375 36.0 32.0 36.0 14.0 36.0 40-41 31.26825 36.0 32.0 36.0 14.0 36.0 42-43 31.228 36.0 32.0 36.0 14.0 36.0 44-45 31.232875 36.0 32.0 36.0 14.0 36.0 46-47 31.188625 36.0 32.0 36.0 14.0 36.0 48-49 31.292 36.0 32.0 36.0 14.0 36.0 50-51 31.126875 36.0 32.0 36.0 14.0 36.0 52-53 30.876375 36.0 32.0 36.0 14.0 36.0 54-55 30.713089866216553 36.0 29.5 36.0 14.0 36.0 56-57 30.455113778444613 36.0 27.0 36.0 14.0 36.0 58-59 30.49799899949975 36.0 27.0 36.0 14.0 36.0 60-61 30.33341670835418 36.0 27.0 36.0 14.0 36.0 62-63 30.306354766074556 36.0 27.0 36.0 14.0 36.0 64-65 30.276012578896 36.0 27.0 36.0 14.0 36.0 66-67 30.34005006257822 36.0 27.0 36.0 14.0 36.0 68-69 30.275594493116394 36.0 27.0 36.0 14.0 36.0 70-71 30.00886376390455 36.0 27.0 36.0 14.0 36.0 72-73 29.95272577814741 36.0 27.0 36.0 14.0 36.0 74-75 30.034285704379016 36.0 27.0 36.0 14.0 36.0 76 28.57183908045977 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 7.0 16 8.0 17 10.0 18 9.0 19 12.0 20 10.0 21 13.0 22 25.0 23 42.0 24 58.0 25 83.0 26 137.0 27 176.0 28 245.0 29 311.0 30 379.0 31 447.0 32 565.0 33 583.0 34 627.0 35 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.225 16.625 13.475000000000001 35.675000000000004 2 32.10802700675169 23.655913978494624 22.305576394098527 21.930482620655166 3 28.15 27.500000000000004 18.7 25.650000000000002 4 30.825000000000003 31.075000000000003 17.375 20.724999999999998 5 30.599999999999998 29.599999999999998 18.9 20.9 6 23.275000000000002 34.975 20.200000000000003 21.55 7 22.7 18.825 33.0 25.474999999999998 8 26.35 21.525 23.175 28.95 9 24.7 21.85 25.775 27.675 10-11 28.037499999999998 26.85 19.0625 26.05 12-13 27.437499999999996 22.975 23.325000000000003 26.2625 14-15 26.450000000000003 25.4 22.912499999999998 25.2375 16-17 27.3125 23.275000000000002 22.1875 27.224999999999998 18-19 27.0 24.2375 23.0875 25.674999999999997 20-21 27.6875 24.025 22.912499999999998 25.374999999999996 22-23 27.325 23.3625 23.175 26.137500000000003 24-25 26.375 25.2625 23.3375 25.025 26-27 27.8375 24.45 22.6 25.112499999999997 28-29 26.787499999999998 24.1625 22.25 26.8 30-31 26.8 24.462500000000002 22.775000000000002 25.9625 32-33 27.2625 23.9125 23.400000000000002 25.424999999999997 34-35 27.5125 23.3 23.6375 25.55 36-37 26.137500000000003 24.4875 22.725 26.650000000000002 38-39 27.6875 24.637500000000003 22.75 24.925 40-41 28.15 24.0625 22.875 24.9125 42-43 27.725 23.3 23.2875 25.687500000000004 44-45 26.924999999999997 24.587500000000002 22.375 26.1125 46-47 27.450000000000003 23.4625 23.3375 25.75 48-49 27.4125 24.212500000000002 22.85 25.525 50-51 26.937499999999996 23.9375 24.212500000000002 24.9125 52-53 26.55 23.4375 23.0625 26.950000000000003 54-55 26.990873859232405 24.01550193774222 23.365420677584698 25.62820352544068 56-57 26.51912978244561 24.218554638659665 23.13078269567392 26.131532883220803 58-59 28.01400700350175 23.936968484242122 22.22361180590295 25.82541270635318 60-61 26.675837918959477 24.7623811905953 22.661330665332667 25.900450225112557 62-63 27.33299974981236 24.230673004753562 22.66700025018764 25.769326995246434 64-65 27.164664664664667 24.224224224224226 23.073073073073072 25.538038038038035 66-67 27.48435544430538 24.23028785982478 22.428035043804755 25.857321652065078 68-69 26.608260325406757 24.6433041301627 23.028785982478098 25.71964956195244 70-71 27.680360721442888 24.06062124248497 22.44488977955912 25.814128256513026 72-73 26.93471136879254 24.703806402823293 23.065288631207462 25.296193597176707 74-75 27.249767380034562 20.882626611724046 23.979795294430414 27.88781071381098 76 29.74137931034483 0.0 32.866379310344826 37.39224137931034 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.5 20 2.5 21 2.5 22 3.0 23 2.0 24 3.0 25 5.5 26 6.0 27 6.0 28 5.5 29 8.0 30 16.0 31 18.0 32 21.0 33 30.5 34 37.5 35 53.0 36 71.5 37 76.5 38 91.0 39 115.5 40 133.5 41 149.5 42 160.5 43 168.5 44 172.5 45 166.5 46 166.5 47 171.0 48 158.5 49 160.5 50 171.5 51 151.5 52 133.0 53 133.0 54 135.5 55 131.5 56 125.0 57 131.0 58 146.5 59 159.0 60 161.0 61 145.5 62 127.0 63 120.0 64 114.5 65 111.5 66 103.5 67 98.5 68 99.5 69 85.0 70 63.5 71 57.5 72 68.5 73 64.0 74 45.0 75 37.5 76 28.5 77 20.0 78 17.5 79 15.5 80 12.0 81 7.5 82 6.0 83 7.0 84 7.0 85 3.0 86 0.0 87 0.0 88 0.5 89 2.5 90 4.0 91 2.5 92 1.0 93 1.5 94 1.5 95 0.5 96 0.0 97 0.0 98 0.5 99 3.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.0 69 2.0 70 2.0 71 9.0 72 30.0 73 60.0 74 261.0 75 847.0 76 2784.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36859546265613 96.475 2 1.401988274279888 2.75 3 0.15294417537598778 0.44999999999999996 4 0.05098139179199593 0.2 5 0.025490695895997964 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588092 spots for SRR11389849.sra Written 588092 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra Read 588091 spots for SRR11389849.sra Written 588091 spots for SRR11389849.sra SRR ids: ['SRR11389849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jkiba9sx SRR11389849.sra spots: 11761821 blocks: [[1, 588091], [588092, 1176182], [1176183, 1764273], [1764274, 2352364], [2352365, 2940455], [2940456, 3528546], [3528547, 4116637], [4116638, 4704728], [4704729, 5292819], [5292820, 5880910], [5880911, 6469001], [6469002, 7057092], [7057093, 7645183], [7645184, 8233274], [8233275, 8821365], [8821366, 9409456], [9409457, 9997547], [9997548, 10585638], [10585639, 11173729], [11173730, 11761821]] SRR11389849 file size 2230389 SRR11389849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389849 SRR11389849_1.fastq SRR11389849_2.fastq Input file: SRR11389849_1.fastq Paired file: SRR11389849_2.fastq trimmed: SRR11389849-trimmed-pair1.fastq, SRR11389849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:05:04 2024 >> started Sat Dec 7 08:05:15 2024 >> done (11.689s) 11761821 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 12348 ( 0.10%) empty read pairs filtered out after trimming by size control 11749470 (99.89%) read pairs available; of these: 11739 ( 0.10%) trimmed read pairs available after processing 11737731 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 91 0.00% 36 102 0.00% 37 134 0.00% 38 168 0.00% 39 184 0.00% 40 225 0.00% 41 266 0.00% 42 297 0.00% 43 351 0.00% 44 375 0.00% 45 413 0.00% 46 447 0.00% 47 465 0.00% 48 567 0.00% 49 584 0.00% 50 680 0.01% 51 715 0.01% 52 862 0.01% 53 898 0.01% 54 983 0.01% 55 1091 0.01% 56 1195 0.01% 57 1363 0.01% 58 1453 0.01% 59 1625 0.01% 60 1697 0.01% 61 1782 0.02% 62 1907 0.02% 63 1996 0.02% 64 2136 0.02% 65 2335 0.02% 66 2488 0.02% 67 2766 0.02% 68 2809 0.02% 69 3176 0.03% 70 3546 0.03% 71 4642 0.04% 72 12741 0.11% 73 94212 0.80% 74 762999 6.49% 75 5009043 42.63% 76 5823642 49.57% 11749470 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.3 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.19 sequence-density-rank=20 fanout-score=91.97 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=17.1 sequence=GCCGCCGCCACCCT SRR11389849 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:05:43 Started mapping on | Dec 07 08:05:43 Finished on | Dec 07 08:06:45 Mapping speed, Million of reads per hour | 682.23 Number of input reads | 11749470 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 9904201 Uniquely mapped reads % | 84.29% Average mapped length | 150.01 Number of splices: Total | 4191597 Number of splices: Annotated (sjdb) | 4028477 Number of splices: GT/AG | 4137982 Number of splices: GC/AG | 47015 Number of splices: AT/AC | 1303 Number of splices: Non-canonical | 5297 Mismatch rate per base, % | 1.06% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 975110 % of reads mapped to multiple loci | 8.30% Number of reads mapped to too many loci | 18888 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.46% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870159 870159 870159 N_multimapping 975110 975110 975110 N_noFeature 269621 9665484 332081 N_ambiguous 242141 1041 69694 UnstrandedReadsAssigned:9392439 PositiveStrandReadsAssigned:237676 NegativeStrandReadsAssigned:9502426 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389849-trimmed-pair1.fastq SRR11389849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,749,470 reads, 10,547,577 reads pseudoaligned [quant] estimated average fragment length: 226.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52973 SRR11389849.ke.tsv 35125 SRR11389849.se.tsv 88098 total ==> SRR11389849.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.068 0 0 PNS24247 1044 818.965 8.87604 1.30517 PNS24249 1928 1702.96 81.4912 5.76259 PNS24246 1044 818.965 8.87604 1.30517 PNS24248 1044 818.965 8.87604 1.30517 PNS24244 1471 1245.96 7.88066 0.761674 PNS24243 293 95.491 0 0 KQK14069 1603 1377.96 420.284 36.7297 KQK14071 474 252.267 38.08 18.1781 ==> SRR11389849.se.tsv <== BRADI_1g14170v3 475 BRADI_1g53295v3 10 BRADI_1g59795v3 186 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 89 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR11389849 completed mapping pipeline successfully