Starting /dee2/code/volunteer_pipeline.sh SRR11389850 current disk space = 1544515149824 free memory = 1601248752 SRR11389850 SRAfilesize 9eeb33a860663665d3777ba016debfba SRR11389850.sra SRR11389850.sra file validated SRR11389850 is paired end SRR11389850 is conventional basespace SRR11389850 read1 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.06775 32.0 32.0 32.0 32.0 32.0 2 31.06 32.0 32.0 32.0 32.0 32.0 3 31.0565 32.0 32.0 32.0 32.0 32.0 4 31.203 32.0 32.0 32.0 32.0 32.0 5 31.12775 32.0 32.0 32.0 32.0 32.0 6 33.98525 36.0 36.0 36.0 32.0 36.0 7 33.926 36.0 36.0 36.0 32.0 36.0 8 33.9785 36.0 36.0 36.0 32.0 36.0 9 33.8415 36.0 36.0 36.0 32.0 36.0 10-11 33.78675 36.0 36.0 36.0 32.0 36.0 12-13 33.994125 36.0 36.0 36.0 32.0 36.0 14-15 33.995875 36.0 36.0 36.0 32.0 36.0 16-17 33.874375 36.0 36.0 36.0 32.0 36.0 18-19 33.777249999999995 36.0 36.0 36.0 29.5 36.0 20-21 33.71575 36.0 36.0 36.0 32.0 36.0 22-23 33.643125 36.0 36.0 36.0 27.0 36.0 24-25 33.441 36.0 36.0 36.0 27.0 36.0 26-27 33.4375 36.0 36.0 36.0 24.0 36.0 28-29 33.28275 36.0 36.0 36.0 21.0 36.0 30-31 33.255375 36.0 36.0 36.0 17.5 36.0 32-33 33.178250000000006 36.0 36.0 36.0 17.5 36.0 34-35 33.192625 36.0 36.0 36.0 17.5 36.0 36-37 33.209125 36.0 36.0 36.0 21.0 36.0 38-39 33.203875 36.0 36.0 36.0 21.0 36.0 40-41 33.064875 36.0 36.0 36.0 17.5 36.0 42-43 32.80095023755939 36.0 36.0 36.0 14.0 36.0 44-45 32.969367341835465 36.0 36.0 36.0 14.0 36.0 46-47 32.60527631907977 36.0 32.0 36.0 14.0 36.0 48-49 32.625156289072265 36.0 32.0 36.0 14.0 36.0 50-51 32.30707676919229 36.0 32.0 36.0 14.0 36.0 52-53 32.290947736934235 36.0 32.0 36.0 14.0 36.0 54-55 32.19904976244061 36.0 32.0 36.0 14.0 36.0 56-57 31.99749243213755 36.0 32.0 36.0 14.0 36.0 58-59 31.875062531265634 36.0 32.0 36.0 14.0 36.0 60-61 32.0564032016008 36.0 32.0 36.0 14.0 36.0 62-63 31.915957978989496 36.0 32.0 36.0 14.0 36.0 64-65 31.72336168084042 36.0 32.0 36.0 14.0 36.0 66-67 31.81066146919326 36.0 32.0 36.0 14.0 36.0 68-69 31.640961442163245 36.0 32.0 36.0 14.0 36.0 70-71 31.64885923137325 36.0 32.0 36.0 14.0 36.0 72-73 31.503036494165457 36.0 32.0 36.0 14.0 36.0 74-75 31.39987666137604 36.0 32.0 36.0 14.0 36.0 76 29.832241630276563 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 5.0 22 3.0 23 9.0 24 33.0 25 41.0 26 64.0 27 97.0 28 166.0 29 223.0 30 263.0 31 376.0 32 424.0 33 636.0 34 960.0 35 699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.5 8.75 14.524999999999999 31.225 2 30.7 11.3 26.025 31.974999999999998 3 27.1 16.0 21.025 35.875 4 34.125 21.45 19.175 25.25 5 29.475 26.025 22.225 22.275 6 24.2 28.525 24.875 22.400000000000002 7 17.825 26.575 35.25 20.349999999999998 8 20.974999999999998 23.375 30.225 25.424999999999997 9 19.875 20.525 32.125 27.474999999999998 10-11 23.3625 30.4875 22.6125 23.5375 12-13 24.212500000000002 24.6125 25.15 26.025 14-15 24.349999999999998 24.65 25.35 25.650000000000002 16-17 24.7875 24.637500000000003 25.412499999999998 25.162499999999998 18-19 23.9 24.3 25.55 26.25 20-21 24.7375 25.424999999999997 25.087500000000002 24.75 22-23 25.7375 23.9875 24.474999999999998 25.8 24-25 22.9625 25.4 25.974999999999998 25.662499999999998 26-27 23.8875 24.9375 25.374999999999996 25.8 28-29 25.162499999999998 24.5375 24.6125 25.687500000000004 30-31 24.5625 25.2125 24.7875 25.4375 32-33 24.224999999999998 24.675 25.4 25.7 34-35 24.55 24.75 25.374999999999996 25.324999999999996 36-37 23.9875 25.5375 24.55 25.924999999999997 38-39 24.4 24.637500000000003 25.2 25.7625 40-41 24.7875 24.875 25.6 24.7375 42-43 24.618654663665918 24.431107776944234 24.793698424606152 26.156539134783696 44-45 24.006001500375092 24.90622655663916 24.33108277069267 26.756689172293076 46-47 24.793698424606152 25.456364091022753 23.705926481620406 26.04401100275069 48-49 24.243560890222557 25.03125781445361 24.243560890222557 26.481620405101275 50-51 24.218554638659665 24.5311327831958 24.281070267566893 26.969242310577645 52-53 24.8062015503876 24.593648412103025 24.431107776944234 26.16904226056514 54-55 24.031007751937985 24.69367341835459 25.331332833208304 25.943985996499126 56-57 24.371639364761783 24.821808178066775 24.471676878829562 26.334875578341876 58-59 24.362181090545274 23.84942471235618 24.72486243121561 27.063531765882942 60-61 24.899949974987493 24.16208104052026 24.64982491245623 26.28814407203602 62-63 25.03751875937969 24.749874937468736 24.637318659329665 25.57528764382191 64-65 25.3751875937969 24.72486243121561 24.399699849924964 25.50025012506253 66-67 24.174174174174173 24.236736736736734 24.824824824824827 26.764264264264266 68-69 24.949924887330997 22.483725588382576 25.325488232348526 27.240861291937907 70-71 25.3727603057261 23.831600050119032 24.144844004510713 26.650795639644155 72-73 24.270623742454728 24.408953722334005 24.93712273641851 26.38329979879276 74-75 24.741721854304636 20.741721854304636 26.64900662251656 27.86754966887417 76 27.983988355167394 0.0 34.024745269286754 37.99126637554585 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.5 2 1.5 3 2.0 4 3.0 5 1.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 2.0 18 5.5 19 7.0 20 5.0 21 5.0 22 7.0 23 6.0 24 5.0 25 5.5 26 5.5 27 7.5 28 11.5 29 13.5 30 16.5 31 25.0 32 36.5 33 40.5 34 40.5 35 59.0 36 81.0 37 83.0 38 97.0 39 138.0 40 156.5 41 168.5 42 182.0 43 197.5 44 231.0 45 226.5 46 210.5 47 210.5 48 200.0 49 172.5 50 149.5 51 154.5 52 144.5 53 131.5 54 133.5 55 130.0 56 123.0 57 121.5 58 126.0 59 121.0 60 118.5 61 112.5 62 104.0 63 108.0 64 99.0 65 86.5 66 81.5 67 73.5 68 63.0 69 56.5 70 50.0 71 43.5 72 45.0 73 39.0 74 31.5 75 31.0 76 30.5 77 24.0 78 14.0 79 9.5 80 12.5 81 11.5 82 9.0 83 9.0 84 6.0 85 4.0 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 1.0 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 2.0 67 1.0 68 0.0 69 2.0 70 3.0 71 6.0 72 14.0 73 65.0 74 258.0 75 898.0 76 2748.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34099030117407 96.325 2 1.403777437468096 2.75 3 0.1531393568147014 0.44999999999999996 4 0.05104645227156713 0.2 5 0.025523226135783564 0.125 6 0.025523226135783564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389850 read2 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.619 32.0 32.0 32.0 32.0 32.0 2 30.23375 32.0 32.0 32.0 21.0 32.0 3 30.242 32.0 32.0 32.0 21.0 32.0 4 30.1585 32.0 32.0 32.0 21.0 32.0 5 30.3375 32.0 32.0 32.0 21.0 32.0 6 33.3815 36.0 36.0 36.0 21.0 36.0 7 33.265 36.0 36.0 36.0 21.0 36.0 8 33.2275 36.0 36.0 36.0 21.0 36.0 9 33.268 36.0 36.0 36.0 21.0 36.0 10-11 33.0165 36.0 36.0 36.0 17.5 36.0 12-13 33.140375000000006 36.0 36.0 36.0 21.0 36.0 14-15 33.027625 36.0 36.0 36.0 14.0 36.0 16-17 33.12325 36.0 36.0 36.0 21.0 36.0 18-19 33.125 36.0 36.0 36.0 21.0 36.0 20-21 32.90837500000001 36.0 36.0 36.0 14.0 36.0 22-23 32.940875 36.0 36.0 36.0 17.5 36.0 24-25 32.9005 36.0 36.0 36.0 14.0 36.0 26-27 32.68025 36.0 36.0 36.0 14.0 36.0 28-29 32.70325 36.0 36.0 36.0 14.0 36.0 30-31 32.57725 36.0 36.0 36.0 14.0 36.0 32-33 32.578 36.0 36.0 36.0 14.0 36.0 34-35 32.431875000000005 36.0 36.0 36.0 14.0 36.0 36-37 32.266999999999996 36.0 34.0 36.0 14.0 36.0 38-39 32.309375 36.0 34.0 36.0 14.0 36.0 40-41 31.99275 36.0 32.0 36.0 14.0 36.0 42-43 31.934483620905226 36.0 32.0 36.0 14.0 36.0 44-45 31.963490872718182 36.0 32.0 36.0 14.0 36.0 46-47 31.93198299574894 36.0 32.0 36.0 14.0 36.0 48-49 31.95173793448362 36.0 32.0 36.0 14.0 36.0 50-51 31.743560890222554 36.0 32.0 36.0 14.0 36.0 52-53 31.55401350337584 36.0 32.0 36.0 14.0 36.0 54-55 31.44586146536634 36.0 32.0 36.0 14.0 36.0 56-57 31.1913239065144 36.0 32.0 36.0 14.0 36.0 58-59 31.415332666333168 36.0 32.0 36.0 14.0 36.0 60-61 31.00175087543772 36.0 32.0 36.0 14.0 36.0 62-63 31.08228645220784 36.0 32.0 36.0 14.0 36.0 64-65 31.07117838378784 36.0 32.0 36.0 14.0 36.0 66-67 30.914001570423704 36.0 32.0 36.0 14.0 36.0 68-69 30.904833458552467 36.0 29.5 36.0 14.0 36.0 70-71 30.725986780185206 36.0 29.5 36.0 14.0 36.0 72-73 30.946086622696512 36.0 32.0 36.0 14.0 36.0 74-75 30.708314343933903 36.0 27.0 36.0 14.0 36.0 76 29.048907002593552 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 6.0 16 11.0 17 6.0 18 9.0 19 11.0 20 9.0 21 14.0 22 11.0 23 27.0 24 55.0 25 87.0 26 103.0 27 148.0 28 169.0 29 245.0 30 303.0 31 345.0 32 460.0 33 594.0 34 872.0 35 511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.33358339584896 17.00425106276569 14.678669667416855 33.983495873968494 2 31.007751937984494 24.15603900975244 21.655413853463365 23.1807951987997 3 27.075 28.075 20.424999999999997 24.425 4 30.075000000000003 30.9 17.299999999999997 21.725 5 30.282570642660666 31.257814453613403 19.454863715928983 19.004751187796952 6 24.575 34.0 21.075 20.349999999999998 7 21.9 17.45 34.65 26.0 8 26.875 22.125 23.1 27.900000000000002 9 24.15 22.1 27.325 26.424999999999997 10-11 27.075 27.6 19.7 25.624999999999996 12-13 26.8125 22.0125 23.7 27.474999999999998 14-15 25.3 25.2625 24.962500000000002 24.474999999999998 16-17 27.825 22.6375 22.55 26.987499999999997 18-19 26.200000000000003 24.675 23.0875 26.0375 20-21 27.187499999999996 25.0 22.95 24.8625 22-23 26.700000000000003 24.85 23.0375 25.412499999999998 24-25 25.974999999999998 25.15 23.5375 25.337500000000002 26-27 26.724999999999998 25.2125 23.0375 25.025 28-29 26.5625 25.074999999999996 22.625 25.7375 30-31 25.687500000000004 25.0 23.35 25.9625 32-33 25.8 25.75 23.674999999999997 24.775 34-35 25.575 25.0 23.4375 25.9875 36-37 25.837500000000002 24.762500000000003 24.05 25.35 38-39 28.012500000000003 24.1625 23.125 24.7 40-41 27.962500000000002 24.375 22.275 25.387500000000003 42-43 26.331582895723933 24.968742185546386 23.243310827706924 25.456364091022753 44-45 26.231557889472366 25.343835958989747 22.768192048012004 25.656414103525883 46-47 26.881720430107524 24.868717179294826 22.380595148787197 25.868967241810452 48-49 26.269067266816705 24.50612653163291 23.193298324581146 26.03150787696924 50-51 26.481620405101275 24.868717179294826 23.23080770192548 25.418854713678417 52-53 27.59439859964991 24.76869217304326 21.680420105026258 25.95648912228057 54-55 26.406601650412604 25.331332833208304 23.005751437859466 25.256314078519633 56-57 26.53495060647743 25.23446292359635 22.983618857071402 25.24696761285482 58-59 26.23811905952976 24.912456228114056 23.04902451225613 25.80040020010005 60-61 25.52526263131566 24.68734367183592 23.24912456228114 26.538269134567283 62-63 26.416510318949342 24.290181363352094 23.214509068167605 26.07879924953096 64-65 26.79509632224168 23.95546659994996 23.705278959219413 25.544158118588946 66-67 26.83354192740926 24.618272841051315 23.917396745932415 24.63078848560701 68-69 26.183320811419986 25.156523916854496 23.528675181567742 25.131480090157776 70-71 27.10866023311192 24.326356686301544 22.759744328863267 25.805238751723277 72-73 25.708527522357983 25.066129235420075 24.34815467943066 24.877188562791282 74-75 27.616628792942123 21.86873412645368 23.88718085817404 26.62745622243016 76 28.04742497221193 0.0 32.82697295294554 39.12560207484253 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 2.5 22 2.5 23 2.0 24 3.5 25 4.5 26 4.5 27 5.0 28 7.0 29 11.0 30 16.5 31 20.5 32 20.5 33 22.0 34 38.0 35 60.5 36 83.5 37 101.0 38 107.5 39 115.0 40 136.5 41 156.5 42 161.5 43 188.0 44 209.5 45 194.0 46 178.0 47 179.0 48 179.5 49 178.5 50 173.0 51 149.5 52 142.0 53 131.5 54 117.0 55 127.0 56 131.0 57 123.0 58 117.0 59 134.5 60 147.0 61 134.5 62 127.0 63 116.0 64 101.5 65 93.5 66 83.5 67 76.5 68 75.5 69 78.5 70 74.0 71 65.0 72 62.0 73 56.0 74 44.5 75 32.5 76 26.5 77 22.0 78 15.5 79 9.5 80 9.5 81 8.5 82 4.5 83 4.5 84 5.5 85 3.5 86 1.5 87 2.0 88 2.5 89 3.0 90 1.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 1.5 99 3.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 1.0 66 2.0 67 1.0 68 0.0 69 2.0 70 3.0 71 5.0 72 27.0 73 79.0 74 273.0 75 905.0 76 2699.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47133757961784 96.625 2 1.2484076433121019 2.45 3 0.2038216560509554 0.6 4 0.05095541401273885 0.2 5 0.025477707006369425 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATTAAGCCAAAATTGGGATTATCTGCAAAAAATTACGGTAGAGCGTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535061 spots for SRR11389850.sra Written 535061 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra Read 535046 spots for SRR11389850.sra Written 535046 spots for SRR11389850.sra SRR ids: ['SRR11389850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kyga9b9q SRR11389850.sra spots: 10700935 blocks: [[1, 535046], [535047, 1070092], [1070093, 1605138], [1605139, 2140184], [2140185, 2675230], [2675231, 3210276], [3210277, 3745322], [3745323, 4280368], [4280369, 4815414], [4815415, 5350460], [5350461, 5885506], [5885507, 6420552], [6420553, 6955598], [6955599, 7490644], [7490645, 8025690], [8025691, 8560736], [8560737, 9095782], [9095783, 9630828], [9630829, 10165874], [10165875, 10700935]] SRR11389850 file size 2026494 SRR11389850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389850 SRR11389850_1.fastq SRR11389850_2.fastq Input file: SRR11389850_1.fastq Paired file: SRR11389850_2.fastq trimmed: SRR11389850-trimmed-pair1.fastq, SRR11389850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:10:22 2024 >> started Sat Dec 7 08:10:30 2024 >> done (8.438s) 10700935 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 13375 ( 0.12%) empty read pairs filtered out after trimming by size control 10687558 (99.87%) read pairs available; of these: 10986 ( 0.10%) trimmed read pairs available after processing 10676572 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 5 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 141 0.00% 36 151 0.00% 37 177 0.00% 38 228 0.00% 39 237 0.00% 40 309 0.00% 41 390 0.00% 42 427 0.00% 43 466 0.00% 44 541 0.01% 45 584 0.01% 46 691 0.01% 47 784 0.01% 48 837 0.01% 49 865 0.01% 50 919 0.01% 51 1111 0.01% 52 1214 0.01% 53 1286 0.01% 54 1383 0.01% 55 1578 0.01% 56 1753 0.02% 57 2071 0.02% 58 2124 0.02% 59 2250 0.02% 60 2374 0.02% 61 2488 0.02% 62 2608 0.02% 63 2766 0.03% 64 3120 0.03% 65 3342 0.03% 66 3619 0.03% 67 3861 0.04% 68 3952 0.04% 69 4388 0.04% 70 4910 0.05% 71 6077 0.06% 72 13343 0.12% 73 89548 0.84% 74 716899 6.71% 75 4649926 43.51% 76 5151805 48.20% 10687558 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=17 prefix-density=0.89 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=29.41 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=6.9 sequence=AAAAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACC criterion=fanout-score sequence-density=0.18 sequence-density-rank=28 fanout-score=95.78 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=17.8 sequence=GCCGCCGCCACCCT SRR11389850 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:11:00 Started mapping on | Dec 07 08:11:00 Finished on | Dec 07 08:11:56 Mapping speed, Million of reads per hour | 687.06 Number of input reads | 10687558 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9089540 Uniquely mapped reads % | 85.05% Average mapped length | 149.99 Number of splices: Total | 4137618 Number of splices: Annotated (sjdb) | 3970055 Number of splices: GT/AG | 4080398 Number of splices: GC/AG | 50475 Number of splices: AT/AC | 1593 Number of splices: Non-canonical | 5152 Mismatch rate per base, % | 0.92% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 889884 % of reads mapped to multiple loci | 8.33% Number of reads mapped to too many loci | 15225 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.83% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 708134 708134 708134 N_multimapping 889884 889884 889884 N_noFeature 258095 8876425 314233 N_ambiguous 217410 855 64086 UnstrandedReadsAssigned:8614035 PositiveStrandReadsAssigned:212260 NegativeStrandReadsAssigned:8711221 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389850-trimmed-pair1.fastq SRR11389850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,687,558 reads, 9,656,335 reads pseudoaligned [quant] estimated average fragment length: 209.52 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52973 SRR11389850.ke.tsv 35125 SRR11389850.se.tsv 88098 total ==> SRR11389850.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.647 0 0 PNS24247 1044 835.48 6.95693 1.14371 PNS24249 1928 1719.48 57.5064 4.59361 PNS24246 1044 835.48 6.95693 1.14371 PNS24248 1044 835.48 6.95693 1.14371 PNS24244 1471 1262.48 21.6228 2.35247 PNS24243 293 106.323 0 0 KQK14069 1603 1394.48 214.789 21.1561 KQK14071 474 268.09 12.3266 6.31539 ==> SRR11389850.se.tsv <== BRADI_1g14170v3 233 BRADI_1g53295v3 6 BRADI_1g59795v3 93 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 82 BRADI_1g74790v3 97 BRADI_1g09890v3 0 BRADI_1g77505v3 96 BRADI_1g48960v3 0 SRR11389850 completed mapping pipeline successfully