Starting /dee2/code/volunteer_pipeline.sh SRR11389851 current disk space = 1544515645440 free memory = 1597769976 SRR11389851 SRAfilesize b46bf7d0e43f3929f68d92eed05bfbe1 SRR11389851.sra SRR11389851.sra file validated SRR11389851 is paired end SRR11389851 is conventional basespace SRR11389851 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07425 32.0 32.0 32.0 32.0 32.0 2 31.097 32.0 32.0 32.0 32.0 32.0 3 31.0115 32.0 32.0 32.0 32.0 32.0 4 31.14275 32.0 32.0 32.0 32.0 32.0 5 31.15725 32.0 32.0 32.0 32.0 32.0 6 34.03875 36.0 36.0 36.0 32.0 36.0 7 34.055 36.0 36.0 36.0 32.0 36.0 8 33.958 36.0 36.0 36.0 32.0 36.0 9 33.96625 36.0 36.0 36.0 32.0 36.0 10-11 33.975375 36.0 36.0 36.0 32.0 36.0 12-13 34.135999999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.03925 36.0 36.0 36.0 32.0 36.0 16-17 33.97925 36.0 36.0 36.0 32.0 36.0 18-19 33.967 36.0 36.0 36.0 32.0 36.0 20-21 33.889375 36.0 36.0 36.0 32.0 36.0 22-23 33.797375 36.0 36.0 36.0 32.0 36.0 24-25 33.563625 36.0 36.0 36.0 27.0 36.0 26-27 33.385125 36.0 36.0 36.0 24.0 36.0 28-29 33.424375 36.0 36.0 36.0 24.0 36.0 30-31 33.503125 36.0 36.0 36.0 27.0 36.0 32-33 33.458124999999995 36.0 36.0 36.0 27.0 36.0 34-35 33.125875 36.0 36.0 36.0 14.0 36.0 36-37 33.301500000000004 36.0 36.0 36.0 24.0 36.0 38-39 33.309875 36.0 36.0 36.0 24.0 36.0 40-41 33.168125 36.0 36.0 36.0 14.0 36.0 42-43 32.905249999999995 36.0 36.0 36.0 14.0 36.0 44-45 33.1305 36.0 36.0 36.0 14.0 36.0 46-47 32.728 36.0 32.0 36.0 17.5 36.0 48-49 32.8895 36.0 34.0 36.0 21.0 36.0 50-51 32.501000000000005 36.0 32.0 36.0 14.0 36.0 52-53 32.435249999999996 36.0 32.0 36.0 14.0 36.0 54-55 32.46028065295464 36.0 32.0 36.0 14.0 36.0 56-57 32.20235117558779 36.0 32.0 36.0 14.0 36.0 58-59 32.09454727363682 36.0 32.0 36.0 14.0 36.0 60-61 32.23367525644233 36.0 32.0 36.0 14.0 36.0 62-63 32.01714214214214 36.0 32.0 36.0 14.0 36.0 64-65 31.94607107107107 36.0 32.0 36.0 14.0 36.0 66-67 31.891255293096844 36.0 32.0 36.0 14.0 36.0 68-69 31.819218241042343 36.0 32.0 36.0 14.0 36.0 70-71 31.71147450601937 36.0 32.0 36.0 14.0 36.0 72-73 31.62682826341597 36.0 32.0 36.0 14.0 36.0 74-75 31.57960329156011 36.0 32.0 36.0 14.0 36.0 76 30.278736687477046 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 6.0 23 2.0 24 24.0 25 29.0 26 65.0 27 97.0 28 136.0 29 203.0 30 279.0 31 353.0 32 459.0 33 650.0 34 942.0 35 754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.25 9.1 14.424999999999999 28.225 2 30.125 9.875 27.250000000000004 32.75 3 27.900000000000002 15.4 21.099999999999998 35.6 4 30.625000000000004 23.05 20.175 26.150000000000002 5 29.599999999999998 25.4 21.7 23.3 6 24.175 29.475 23.225 23.125 7 17.275 26.1 35.85 20.775 8 20.849999999999998 24.625 30.225 24.3 9 21.05 20.025000000000002 32.475 26.450000000000003 10-11 23.6375 29.349999999999998 23.4375 23.575 12-13 24.3875 24.6625 24.875 26.075 14-15 22.925 25.474999999999998 26.1125 25.4875 16-17 24.5125 25.2625 24.625 25.6 18-19 23.5625 25.7375 24.975 25.724999999999998 20-21 23.6125 25.874999999999996 25.025 25.4875 22-23 23.9125 25.387500000000003 25.1 25.6 24-25 23.0625 25.5625 25.324999999999996 26.05 26-27 23.799999999999997 25.324999999999996 24.5125 26.3625 28-29 23.5625 25.587500000000002 24.7 26.150000000000002 30-31 23.75 25.5625 24.349999999999998 26.337500000000002 32-33 23.825 25.35 24.6125 26.2125 34-35 23.0375 26.125 25.4 25.4375 36-37 23.4625 25.85 25.2625 25.424999999999997 38-39 24.462500000000002 25.1 25.85 24.587500000000002 40-41 23.7125 25.5375 25.025 25.724999999999998 42-43 24.087500000000002 25.25 24.1125 26.55 44-45 23.325000000000003 25.5125 25.2875 25.874999999999996 46-47 24.5125 25.3125 24.625 25.55 48-49 24.0 24.575 25.45 25.974999999999998 50-51 24.525 24.675 24.3875 26.4125 52-53 24.3625 24.474999999999998 25.362499999999997 25.8 54-55 23.708890834062775 25.35950981618107 24.684256596223584 26.24734275353258 56-57 23.974487243621812 24.787393696848426 24.337168584292147 26.900950475237618 58-59 24.037018509254626 25.587793896948476 24.312156078039017 26.063031515757878 60-61 24.768576432324245 25.068801601200903 24.26820115086315 25.894420815611706 62-63 24.8998998998999 25.5005005005005 23.623623623623622 25.975975975975974 64-65 24.3993993993994 25.412912912912912 24.336836836836838 25.850850850850847 66-67 24.38932732055618 24.664912939997492 24.82775898784918 26.118000751597144 68-69 24.25457278877474 24.27962916562265 25.72037083437735 25.74542721122526 70-71 24.76500814638426 23.987968417094873 25.053264820152904 26.19375861636797 72-73 24.15659617321249 24.74823766364552 25.062940584088622 26.032225579053375 74-75 23.4729261136303 21.25900240064017 26.393704987996795 28.87436649773273 76 28.351083363936837 0.0 35.40213000367242 36.246786632390744 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.5 21 3.0 22 3.5 23 5.0 24 4.0 25 3.0 26 3.5 27 5.5 28 11.0 29 14.5 30 20.0 31 29.0 32 33.5 33 34.0 34 41.0 35 61.0 36 83.0 37 97.0 38 112.5 39 148.0 40 172.5 41 177.0 42 189.5 43 211.0 44 233.0 45 235.5 46 238.0 47 223.0 48 207.0 49 196.5 50 179.0 51 165.0 52 145.0 53 132.0 54 116.0 55 110.0 56 112.0 57 115.0 58 120.0 59 115.0 60 103.5 61 99.0 62 99.5 63 92.5 64 83.5 65 81.0 66 75.0 67 68.5 68 61.5 69 54.5 70 50.0 71 45.5 72 37.5 73 35.5 74 35.5 75 30.5 76 28.5 77 18.5 78 14.0 79 13.5 80 8.0 81 8.0 82 7.0 83 3.5 84 1.5 85 0.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 4.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 9.0 72 16.0 73 79.0 74 272.0 75 890.0 76 2723.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8860759493671 97.65 2 0.9873417721518988 1.95 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389851 read2 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.215 32.0 32.0 32.0 21.0 32.0 2 29.91 32.0 32.0 32.0 14.0 32.0 3 29.74425 32.0 32.0 32.0 14.0 32.0 4 29.737 32.0 32.0 32.0 14.0 32.0 5 29.84725 32.0 32.0 32.0 21.0 32.0 6 32.611 36.0 36.0 36.0 14.0 36.0 7 32.91425 36.0 36.0 36.0 21.0 36.0 8 32.70475 36.0 32.0 36.0 14.0 36.0 9 32.58625 36.0 32.0 36.0 14.0 36.0 10-11 32.480875 36.0 34.0 36.0 14.0 36.0 12-13 32.4315 36.0 32.0 36.0 14.0 36.0 14-15 32.415375 36.0 32.0 36.0 14.0 36.0 16-17 32.475875 36.0 32.0 36.0 14.0 36.0 18-19 32.316125 36.0 32.0 36.0 14.0 36.0 20-21 32.356750000000005 36.0 32.0 36.0 14.0 36.0 22-23 32.3225 36.0 32.0 36.0 14.0 36.0 24-25 32.13425 36.0 32.0 36.0 14.0 36.0 26-27 32.023375 36.0 32.0 36.0 14.0 36.0 28-29 31.96975 36.0 32.0 36.0 14.0 36.0 30-31 31.9185 36.0 32.0 36.0 14.0 36.0 32-33 31.899749999999997 36.0 32.0 36.0 14.0 36.0 34-35 31.8545 36.0 32.0 36.0 14.0 36.0 36-37 31.612000000000002 36.0 32.0 36.0 14.0 36.0 38-39 31.636125 36.0 32.0 36.0 14.0 36.0 40-41 31.30725 36.0 32.0 36.0 14.0 36.0 42-43 31.4725 36.0 32.0 36.0 14.0 36.0 44-45 31.466 36.0 32.0 36.0 14.0 36.0 46-47 31.240375 36.0 32.0 36.0 14.0 36.0 48-49 31.413125 36.0 32.0 36.0 14.0 36.0 50-51 31.3185 36.0 32.0 36.0 14.0 36.0 52-53 31.021 36.0 32.0 36.0 14.0 36.0 54-55 30.638034508627157 36.0 29.5 36.0 14.0 36.0 56-57 30.570892723180794 36.0 27.0 36.0 14.0 36.0 58-59 30.69454863715929 36.0 29.5 36.0 14.0 36.0 60-61 30.583166583291646 36.0 27.0 36.0 14.0 36.0 62-63 30.5298974230673 36.0 27.0 36.0 14.0 36.0 64-65 30.38116087065299 36.0 27.0 36.0 14.0 36.0 66-67 30.30783163497042 36.0 27.0 36.0 14.0 36.0 68-69 30.29258517034068 36.0 27.0 36.0 14.0 36.0 70-71 30.11211214829757 36.0 27.0 36.0 14.0 36.0 72-73 30.12850377808617 36.0 27.0 36.0 14.0 36.0 74-75 30.198012788665118 36.0 27.0 36.0 14.0 36.0 76 28.574551971326166 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 6.0 16 7.0 17 13.0 18 6.0 19 3.0 20 8.0 21 10.0 22 19.0 23 39.0 24 58.0 25 101.0 26 138.0 27 183.0 28 237.0 29 300.0 30 345.0 31 506.0 32 515.0 33 629.0 34 650.0 35 226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.941970985492745 16.30815407703852 14.85742871435718 34.892446223111556 2 31.615807903951975 23.961980990495245 22.836418209104554 21.585792896448226 3 27.925 27.175 20.200000000000003 24.7 4 30.025000000000002 31.7 17.724999999999998 20.549999999999997 5 30.29014507253627 31.390695347673837 19.23461730865433 19.084542271135568 6 23.425 36.4 20.125 20.05 7 22.975 18.15 32.6 26.275 8 26.525 22.0 24.25 27.224999999999998 9 24.4 20.8 27.525 27.275 10-11 27.1125 28.3875 19.900000000000002 24.6 12-13 27.037499999999998 23.1 23.3375 26.525 14-15 26.275 24.6125 24.3875 24.725 16-17 28.000000000000004 23.5875 23.1875 25.224999999999998 18-19 25.974999999999998 25.2625 24.4375 24.325 20-21 27.800000000000004 25.25 23.0875 23.8625 22-23 26.8625 25.025 22.4875 25.624999999999996 24-25 26.2625 24.7875 24.2 24.75 26-27 27.325 25.5 23.75 23.425 28-29 27.537499999999998 24.0625 22.85 25.55 30-31 26.200000000000003 24.375 23.674999999999997 25.75 32-33 26.3 25.5125 24.3125 23.875 34-35 26.85 24.0375 23.325000000000003 25.7875 36-37 25.8 24.6875 24.5625 24.95 38-39 27.250000000000004 24.075 23.4125 25.2625 40-41 27.575 23.6125 23.275000000000002 25.5375 42-43 26.6 24.962500000000002 23.6125 24.825 44-45 27.1375 24.887500000000003 23.974999999999998 24.0 46-47 27.35 24.5375 22.7375 25.374999999999996 48-49 27.200000000000003 24.7375 23.2375 24.825 50-51 26.8 24.625 23.5875 24.9875 52-53 27.4125 24.4875 23.2625 24.837500000000002 54-55 27.081770442610654 24.918729682420604 22.99324831207802 25.006251562890725 56-57 26.70667666916729 23.968492123030757 23.78094523630908 25.543885971492873 58-59 27.619404851212803 23.543385846461614 23.58089522380595 25.256314078519633 60-61 26.138069034517258 24.83741870935468 24.249624812406203 24.77488744372186 62-63 27.24543407555667 24.605954465849386 23.617713284963724 24.530898173630224 64-65 27.08281210908181 23.705278959219413 22.81711283462597 26.394796097072803 66-67 26.43706950532248 24.53350031308704 24.14527238572323 24.88415779586725 68-69 26.966432865731466 24.9624248496994 22.732965931863728 25.33817635270541 70-71 27.631578947368425 24.661654135338345 23.182957393483708 24.523809523809522 72-73 26.417233560090704 25.056689342403626 24.5527840765936 23.973293020912067 74-75 27.773333333333333 22.32 25.240000000000002 24.666666666666668 76 28.70967741935484 0.0 34.48028673835125 36.81003584229391 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 0.5 22 0.5 23 1.0 24 2.0 25 4.5 26 6.0 27 7.0 28 12.0 29 18.0 30 18.0 31 23.0 32 30.0 33 27.0 34 34.0 35 61.0 36 87.5 37 94.5 38 99.5 39 122.5 40 139.5 41 148.5 42 162.5 43 184.5 44 221.0 45 231.0 46 224.0 47 212.0 48 193.0 49 179.5 50 166.0 51 158.0 52 147.0 53 148.5 54 148.5 55 133.5 56 119.5 57 114.0 58 117.5 59 127.0 60 122.0 61 104.0 62 102.0 63 104.5 64 100.5 65 94.5 66 87.5 67 78.5 68 67.0 69 58.5 70 65.0 71 70.0 72 65.0 73 58.0 74 42.5 75 31.0 76 26.0 77 19.5 78 15.0 79 14.5 80 12.5 81 10.0 82 8.5 83 6.5 84 5.0 85 4.5 86 3.0 87 1.0 88 2.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 1.5 98 2.0 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 4.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 8.0 72 24.0 73 61.0 74 292.0 75 814.0 76 2790.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6565656565656566 1.3 3 0.07575757575757576 0.22499999999999998 4 0.0 0.0 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra Read 578651 spots for SRR11389851.sra Written 578651 spots for SRR11389851.sra Read 578635 spots for SRR11389851.sra Written 578635 spots for SRR11389851.sra SRR ids: ['SRR11389851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dt4wh7xi SRR11389851.sra spots: 11572716 blocks: [[1, 578635], [578636, 1157270], [1157271, 1735905], [1735906, 2314540], [2314541, 2893175], [2893176, 3471810], [3471811, 4050445], [4050446, 4629080], [4629081, 5207715], [5207716, 5786350], [5786351, 6364985], [6364986, 6943620], [6943621, 7522255], [7522256, 8100890], [8100891, 8679525], [8679526, 9258160], [9258161, 9836795], [9836796, 10415430], [10415431, 10994065], [10994066, 11572716]] SRR11389851 file size 2193606 SRR11389851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389851 SRR11389851_1.fastq SRR11389851_2.fastq Input file: SRR11389851_1.fastq Paired file: SRR11389851_2.fastq trimmed: SRR11389851-trimmed-pair1.fastq, SRR11389851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:11:54 2024 >> started Sat Dec 7 08:12:09 2024 >> done (15.018s) 11572716 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 15211 ( 0.13%) empty read pairs filtered out after trimming by size control 11557504 (99.87%) read pairs available; of these: 9025 ( 0.08%) trimmed read pairs available after processing 11548479 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 7 0.00% 32 7 0.00% 33 6 0.00% 34 4 0.00% 35 109 0.00% 36 140 0.00% 37 148 0.00% 38 188 0.00% 39 268 0.00% 40 285 0.00% 41 328 0.00% 42 335 0.00% 43 414 0.00% 44 443 0.00% 45 501 0.00% 46 587 0.01% 47 631 0.01% 48 692 0.01% 49 780 0.01% 50 861 0.01% 51 922 0.01% 52 999 0.01% 53 1126 0.01% 54 1228 0.01% 55 1404 0.01% 56 1504 0.01% 57 1706 0.01% 58 1935 0.02% 59 2013 0.02% 60 2239 0.02% 61 2105 0.02% 62 2354 0.02% 63 2420 0.02% 64 2671 0.02% 65 2938 0.03% 66 3296 0.03% 67 3578 0.03% 68 3812 0.03% 69 4239 0.04% 70 4673 0.04% 71 5825 0.05% 72 13239 0.11% 73 95665 0.83% 74 780808 6.76% 75 4992782 43.20% 76 5615270 48.59% 11557504 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=23 prefix-density=0.53 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=80.43 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=14.4 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.35 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=161.64 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=20.4 sequence=GCCGCCGCCGCC SRR11389851 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:12:38 Started mapping on | Dec 07 08:12:38 Finished on | Dec 07 08:13:48 Mapping speed, Million of reads per hour | 594.39 Number of input reads | 11557504 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 10077759 Uniquely mapped reads % | 87.20% Average mapped length | 149.91 Number of splices: Total | 4629794 Number of splices: Annotated (sjdb) | 4435032 Number of splices: GT/AG | 4565303 Number of splices: GC/AG | 56430 Number of splices: AT/AC | 1980 Number of splices: Non-canonical | 6081 Mismatch rate per base, % | 1.06% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.00% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 746343 % of reads mapped to multiple loci | 6.46% Number of reads mapped to too many loci | 16337 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733402 733402 733402 N_multimapping 746343 746343 746343 N_noFeature 281383 9820394 361983 N_ambiguous 230766 1122 57056 UnstrandedReadsAssigned:9565610 PositiveStrandReadsAssigned:256243 NegativeStrandReadsAssigned:9658720 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389851-trimmed-pair1.fastq SRR11389851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,557,504 reads, 10,461,324 reads pseudoaligned [quant] estimated average fragment length: 204.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52973 SRR11389851.ke.tsv 35125 SRR11389851.se.tsv 88098 total ==> SRR11389851.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.628 0 0 PNS24247 1044 840.526 16.7736 2.60675 PNS24249 1928 1724.53 101.679 7.70171 PNS24246 1044 840.526 16.7736 2.60675 PNS24248 1044 840.526 16.7736 2.60675 PNS24244 1471 1267.53 0 0 PNS24243 293 108.911 0 0 KQK14069 1603 1399.53 388.918 36.2996 KQK14071 474 273.068 62.6936 29.9901 ==> SRR11389851.se.tsv <== BRADI_1g14170v3 489 BRADI_1g53295v3 17 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 109 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 105 BRADI_1g48960v3 0 SRR11389851 completed mapping pipeline successfully