Starting /dee2/code/volunteer_pipeline.sh SRR11389852 current disk space = 1544471314432 free memory = 1601930452 SRR11389852 SRAfilesize 2f6adb00edfd449cd5fbcedc27fc0aaf SRR11389852.sra SRR11389852.sra file validated SRR11389852 is paired end SRR11389852 is conventional basespace SRR11389852 read1 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.993 32.0 32.0 32.0 32.0 32.0 2 31.037 32.0 32.0 32.0 32.0 32.0 3 31.025 32.0 32.0 32.0 32.0 32.0 4 31.23925 32.0 32.0 32.0 32.0 32.0 5 31.15625 32.0 32.0 32.0 32.0 32.0 6 33.90075 36.0 36.0 36.0 32.0 36.0 7 33.9595 36.0 36.0 36.0 32.0 36.0 8 34.20825 36.0 36.0 36.0 32.0 36.0 9 33.923 36.0 36.0 36.0 32.0 36.0 10-11 33.8645 36.0 36.0 36.0 32.0 36.0 12-13 33.903125 36.0 36.0 36.0 32.0 36.0 14-15 33.95125 36.0 36.0 36.0 32.0 36.0 16-17 33.827625 36.0 36.0 36.0 32.0 36.0 18-19 33.7565 36.0 36.0 36.0 32.0 36.0 20-21 33.796625 36.0 36.0 36.0 29.5 36.0 22-23 33.66575 36.0 36.0 36.0 29.5 36.0 24-25 33.378625 36.0 36.0 36.0 24.0 36.0 26-27 33.360875 36.0 36.0 36.0 21.0 36.0 28-29 33.407 36.0 36.0 36.0 24.0 36.0 30-31 33.233 36.0 36.0 36.0 21.0 36.0 32-33 33.211124999999996 36.0 36.0 36.0 17.5 36.0 34-35 33.202125 36.0 36.0 36.0 17.5 36.0 36-37 32.998999999999995 36.0 36.0 36.0 14.0 36.0 38-39 33.197 36.0 36.0 36.0 21.0 36.0 40-41 33.163624999999996 36.0 36.0 36.0 14.0 36.0 42-43 32.99162290572643 36.0 36.0 36.0 17.5 36.0 44-45 33.07640085359009 36.0 36.0 36.0 14.0 36.0 46-47 32.61380690345173 36.0 32.0 36.0 17.5 36.0 48-49 32.664207103551774 36.0 32.0 36.0 14.0 36.0 50-51 32.39832416208104 36.0 32.0 36.0 14.0 36.0 52-53 32.33341670835418 36.0 32.0 36.0 14.0 36.0 54-55 32.286518259129565 36.0 32.0 36.0 14.0 36.0 56-57 32.052391890914436 36.0 32.0 36.0 14.0 36.0 58-59 32.02215269086358 36.0 32.0 36.0 14.0 36.0 60-61 32.06095118898624 36.0 32.0 36.0 14.0 36.0 62-63 31.942052565707133 36.0 32.0 36.0 14.0 36.0 64-65 31.80738423028786 36.0 32.0 36.0 14.0 36.0 66-67 31.725821752522485 36.0 32.0 36.0 14.0 36.0 68-69 31.682574055653276 36.0 32.0 36.0 14.0 36.0 70-71 31.693802648547145 36.0 32.0 36.0 14.0 36.0 72-73 31.6109624364129 36.0 32.0 36.0 14.0 36.0 74-75 31.576590119905372 36.0 32.0 36.0 14.0 36.0 76 29.989035087719298 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 9.0 23 8.0 24 25.0 25 40.0 26 59.0 27 99.0 28 144.0 29 218.0 30 289.0 31 355.0 32 463.0 33 615.0 34 970.0 35 702.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.725 8.825 14.299999999999999 32.15 2 30.099999999999998 11.025 27.1 31.775 3 27.375 16.6 21.2 34.825 4 31.874999999999996 24.224999999999998 19.225 24.675 5 29.25 27.700000000000003 21.6 21.45 6 23.5 31.1 23.025000000000002 22.375 7 16.5 24.925 36.9 21.675 8 20.349999999999998 21.525 32.75 25.374999999999996 9 20.674999999999997 19.725 32.775 26.825 10-11 22.8125 29.875 23.799999999999997 23.5125 12-13 23.6875 24.4375 25.45 26.424999999999997 14-15 23.0 24.725 26.924999999999997 25.35 16-17 24.5 25.937500000000004 24.2875 25.275 18-19 23.7375 25.412499999999998 26.1125 24.7375 20-21 23.974999999999998 25.912499999999998 25.074999999999996 25.0375 22-23 23.0 25.662499999999998 25.662499999999998 25.674999999999997 24-25 23.925 25.2 25.7875 25.087500000000002 26-27 23.549999999999997 25.162499999999998 24.962500000000002 26.325 28-29 23.8625 25.05 25.162499999999998 25.924999999999997 30-31 23.8375 25.7125 24.224999999999998 26.224999999999998 32-33 23.4625 25.074999999999996 25.937500000000004 25.525 34-35 23.45 25.025 25.224999999999998 26.3 36-37 24.0 25.2375 24.8125 25.95 38-39 24.75 25.05 25.2 25.0 40-41 25.124999999999996 24.725 25.124999999999996 25.025 42-43 24.10602650662666 25.156289072268066 24.518629657414355 26.219054763690924 44-45 24.034012754783042 24.98436913842691 24.64674252844817 26.334875578341876 46-47 25.42521260630315 24.499749874937468 24.474737368684345 25.60030015007504 48-49 23.974487243621812 24.949974987493746 24.412206103051524 26.663331665832917 50-51 23.574287143571787 25.012506253126567 25.062531265632813 26.350675337668832 52-53 24.12456228114057 25.53776888444222 24.72486243121561 25.6128064032016 54-55 23.84942471235618 24.337168584292147 25.48774387193597 26.32566283141571 56-57 24.6996996996997 24.524524524524523 24.874874874874877 25.900900900900904 58-59 24.217772215269086 25.18147684605757 24.85607008760951 25.744680851063826 60-61 24.49311639549437 24.58072590738423 24.267834793491865 26.65832290362954 62-63 24.06758448060075 24.568210262828536 24.96871088861076 26.395494367959948 64-65 24.46808510638298 25.36921151439299 24.84355444305382 25.319148936170212 66-67 24.912368552829246 24.036054081121684 25.0250375563345 26.02653980971457 68-69 24.251534510835526 24.61480646373544 25.078291369159462 26.055367656269574 70-71 25.08147405364753 24.74304336926548 24.717974429681625 25.457508147405367 72-73 24.238610621696452 24.46513969292726 25.308331235841937 25.98791844953436 74-75 25.139146567717997 21.110522130930296 25.841505433342167 27.90882586800954 76 26.937134502923975 0.0 35.19736842105263 37.86549707602339 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 1.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.5 18 3.0 19 3.0 20 4.5 21 6.5 22 5.0 23 3.0 24 4.0 25 6.0 26 8.0 27 9.5 28 13.5 29 16.0 30 14.5 31 17.0 32 27.5 33 36.5 34 46.0 35 60.5 36 83.0 37 96.0 38 110.0 39 137.0 40 150.5 41 183.0 42 215.0 43 223.0 44 227.5 45 224.5 46 225.0 47 221.0 48 217.0 49 219.0 50 219.5 51 188.0 52 147.5 53 137.0 54 132.0 55 122.0 56 120.0 57 117.0 58 112.0 59 112.0 60 109.5 61 94.5 62 83.0 63 89.5 64 86.5 65 69.5 66 58.0 67 60.0 68 55.5 69 47.5 70 46.5 71 48.0 72 45.5 73 41.5 74 33.0 75 26.0 76 24.0 77 19.5 78 15.0 79 12.5 80 10.5 81 7.0 82 4.5 83 4.0 84 3.0 85 2.5 86 2.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 2.0 67 1.0 68 1.0 69 1.0 70 2.0 71 6.0 72 18.0 73 61.0 74 260.0 75 907.0 76 2736.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.7581501137225171 1.5 3 0.1263583522870862 0.375 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389852 read2 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.50175 32.0 32.0 32.0 27.0 32.0 2 30.1615 32.0 32.0 32.0 21.0 32.0 3 30.1185 32.0 32.0 32.0 21.0 32.0 4 30.19375 32.0 32.0 32.0 21.0 32.0 5 30.05325 32.0 32.0 32.0 21.0 32.0 6 33.194 36.0 36.0 36.0 21.0 36.0 7 33.24875 36.0 36.0 36.0 21.0 36.0 8 33.05075 36.0 36.0 36.0 21.0 36.0 9 33.1715 36.0 36.0 36.0 21.0 36.0 10-11 33.01225 36.0 36.0 36.0 17.5 36.0 12-13 33.004625000000004 36.0 36.0 36.0 17.5 36.0 14-15 32.7825 36.0 36.0 36.0 14.0 36.0 16-17 32.929625 36.0 36.0 36.0 21.0 36.0 18-19 32.921125 36.0 36.0 36.0 17.5 36.0 20-21 32.692875 36.0 36.0 36.0 14.0 36.0 22-23 32.621375 36.0 36.0 36.0 14.0 36.0 24-25 32.732749999999996 36.0 36.0 36.0 14.0 36.0 26-27 32.55875 36.0 36.0 36.0 14.0 36.0 28-29 32.482 36.0 34.0 36.0 14.0 36.0 30-31 32.3495 36.0 34.0 36.0 14.0 36.0 32-33 32.450125 36.0 32.0 36.0 14.0 36.0 34-35 32.191125 36.0 32.0 36.0 14.0 36.0 36-37 32.295874999999995 36.0 32.0 36.0 14.0 36.0 38-39 32.2505 36.0 32.0 36.0 14.0 36.0 40-41 31.866125 36.0 32.0 36.0 14.0 36.0 42-43 31.741060265066267 36.0 32.0 36.0 14.0 36.0 44-45 31.73768442110528 36.0 32.0 36.0 14.0 36.0 46-47 31.640535133783445 36.0 32.0 36.0 14.0 36.0 48-49 31.61227806951738 36.0 32.0 36.0 14.0 36.0 50-51 31.57501875468867 36.0 32.0 36.0 14.0 36.0 52-53 31.576663331665834 36.0 32.0 36.0 14.0 36.0 54-55 31.12743871935968 36.0 32.0 36.0 14.0 36.0 56-57 31.12135127628575 36.0 32.0 36.0 14.0 36.0 58-59 31.104380475594493 36.0 32.0 36.0 14.0 36.0 60-61 30.91852315394243 36.0 32.0 36.0 14.0 36.0 62-63 30.99261576971214 36.0 32.0 36.0 14.0 36.0 64-65 30.830413016270338 36.0 29.5 36.0 14.0 36.0 66-67 30.70974671883556 36.0 29.5 36.0 14.0 36.0 68-69 30.67210241284574 36.0 27.0 36.0 14.0 36.0 70-71 30.67588195231121 36.0 29.5 36.0 14.0 36.0 72-73 30.612507005096603 36.0 27.0 36.0 14.0 36.0 74-75 30.528372343895036 36.0 27.0 36.0 14.0 36.0 76 28.895241608262634 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 5.0 16 14.0 17 6.0 18 8.0 19 7.0 20 3.0 21 9.0 22 22.0 23 37.0 24 47.0 25 68.0 26 121.0 27 141.0 28 213.0 29 250.0 30 337.0 31 408.0 32 497.0 33 634.0 34 785.0 35 387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.95 15.7 15.0 36.35 2 31.45 24.9 22.3 21.349999999999998 3 27.05 27.900000000000002 21.4 23.65 4 30.025000000000002 30.9 17.5 21.575 5 29.175 31.7 20.525 18.6 6 22.675 36.175000000000004 20.25 20.9 7 23.125 16.725 33.050000000000004 27.1 8 25.45 21.975 23.775 28.799999999999997 9 22.375 22.3 28.025 27.3 10-11 26.35 28.812500000000004 20.6875 24.15 12-13 26.35 22.8625 24.1125 26.674999999999997 14-15 25.687500000000004 24.75 23.4625 26.1 16-17 26.487500000000004 24.375 23.5 25.637500000000003 18-19 24.8 24.25 24.6875 26.2625 20-21 26.375 24.8625 23.425 25.337500000000002 22-23 26.6 24.325 23.225 25.85 24-25 25.424999999999997 25.637500000000003 24.1875 24.75 26-27 26.625 25.6 22.75 25.025 28-29 26.724999999999998 24.25 23.400000000000002 25.624999999999996 30-31 25.162499999999998 24.9875 24.1375 25.7125 32-33 26.275 25.474999999999998 23.5875 24.6625 34-35 26.637499999999996 24.4875 23.5375 25.337500000000002 36-37 25.7875 25.900000000000002 23.474999999999998 24.837500000000002 38-39 26.900000000000002 25.45 23.5625 24.087500000000002 40-41 26.224999999999998 25.1875 22.75 25.837500000000002 42-43 26.281570392598148 24.58114528632158 24.031007751937985 25.10627656914228 44-45 26.269067266816705 25.056264066016503 23.85596399099775 24.81870467616904 46-47 26.819204801200303 24.043510877719427 23.40585146286572 25.731432858214554 48-49 26.156539134783696 25.568892223055762 23.23080770192548 25.04376094023506 50-51 26.494123530882717 25.006251562890725 23.20580145036259 25.29382345586397 52-53 26.95097548774387 25.56278139069535 22.18609304652326 25.30015007503752 54-55 26.275637818909452 25.72536268134067 23.024012006003 24.974987493746873 56-57 26.413913913913913 25.18768768768769 24.36186186186186 24.036536536536538 58-59 26.87108886107635 24.167709637046308 23.504380475594495 25.456821026282856 60-61 26.032540675844807 24.93116395494368 23.654568210262827 25.381727158948685 62-63 26.18272841051314 25.319148936170212 24.267834793491865 24.23028785982478 64-65 26.570713391739677 25.14392991239049 23.266583229036293 25.018773466833544 66-67 24.98748122183275 25.338007010515774 24.57436154231347 25.10015022533801 68-69 26.69756953144575 24.292157354046605 23.991480831871712 25.018792282635932 70-71 26.40681789697957 24.62714625892969 23.687178844466725 25.27885699962401 72-73 25.2364737041241 24.719384537772733 24.504981712700214 25.53916004540295 74-75 27.237458193979936 21.190635451505017 25.65886287625418 25.91304347826087 76 27.259313906307636 0.0 35.11619328661011 37.624492807082255 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 1.5 22 1.5 23 4.5 24 7.0 25 6.5 26 7.0 27 11.5 28 14.5 29 14.5 30 17.5 31 19.5 32 22.5 33 34.0 34 42.5 35 58.5 36 92.0 37 108.5 38 109.0 39 126.5 40 158.5 41 182.5 42 188.0 43 196.5 44 203.0 45 180.5 46 170.5 47 185.0 48 183.0 49 180.0 50 179.0 51 170.0 52 153.5 53 128.0 54 117.5 55 125.5 56 130.5 57 123.0 58 120.0 59 119.5 60 126.0 61 119.0 62 98.0 63 95.5 64 85.5 65 81.5 66 86.5 67 81.0 68 70.0 69 65.5 70 67.0 71 63.5 72 60.5 73 51.0 74 42.5 75 40.0 76 31.0 77 22.5 78 20.0 79 18.5 80 12.5 81 7.5 82 5.5 83 4.0 84 5.5 85 4.0 86 1.5 87 0.5 88 1.0 89 3.0 90 2.0 91 1.0 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 2.0 67 1.0 68 2.0 69 0.0 70 1.0 71 13.0 72 23.0 73 83.0 74 265.0 75 894.0 76 2711.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra Read 654375 spots for SRR11389852.sra Written 654375 spots for SRR11389852.sra SRR ids: ['SRR11389852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y02oeev2 SRR11389852.sra spots: 13087500 blocks: [[1, 654375], [654376, 1308750], [1308751, 1963125], [1963126, 2617500], [2617501, 3271875], [3271876, 3926250], [3926251, 4580625], [4580626, 5235000], [5235001, 5889375], [5889376, 6543750], [6543751, 7198125], [7198126, 7852500], [7852501, 8506875], [8506876, 9161250], [9161251, 9815625], [9815626, 10470000], [10470001, 11124375], [11124376, 11778750], [11778751, 12433125], [12433126, 13087500]] SRR11389852 file size 2483093 SRR11389852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389852 SRR11389852_1.fastq SRR11389852_2.fastq Input file: SRR11389852_1.fastq Paired file: SRR11389852_2.fastq trimmed: SRR11389852-trimmed-pair1.fastq, SRR11389852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:13:26 2024 >> started Sat Dec 7 08:13:36 2024 >> done (10.385s) 13087500 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 9920 ( 0.08%) empty read pairs filtered out after trimming by size control 13077576 (99.92%) read pairs available; of these: 14376 ( 0.11%) trimmed read pairs available after processing 13063200 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 5 0.00% 34 0 0.00% 35 170 0.00% 36 199 0.00% 37 229 0.00% 38 254 0.00% 39 316 0.00% 40 384 0.00% 41 440 0.00% 42 516 0.00% 43 601 0.00% 44 681 0.01% 45 771 0.01% 46 779 0.01% 47 882 0.01% 48 1014 0.01% 49 1037 0.01% 50 1192 0.01% 51 1300 0.01% 52 1486 0.01% 53 1576 0.01% 54 1830 0.01% 55 1933 0.01% 56 2153 0.02% 57 2386 0.02% 58 2656 0.02% 59 2809 0.02% 60 2963 0.02% 61 3100 0.02% 62 3312 0.03% 63 3438 0.03% 64 3830 0.03% 65 4263 0.03% 66 4618 0.04% 67 5005 0.04% 68 5148 0.04% 69 5674 0.04% 70 6213 0.05% 71 7679 0.06% 72 16249 0.12% 73 110454 0.84% 74 898995 6.87% 75 5706406 43.64% 76 6262620 47.89% 13077576 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=101.18 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=16.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=2.1 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=174.66 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=21.3 sequence=CCGCCGCCGCCG SRR11389852 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:14:19 Started mapping on | Dec 07 08:14:19 Finished on | Dec 07 08:15:21 Mapping speed, Million of reads per hour | 759.34 Number of input reads | 13077576 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11331751 Uniquely mapped reads % | 86.65% Average mapped length | 149.91 Number of splices: Total | 5200180 Number of splices: Annotated (sjdb) | 4964965 Number of splices: GT/AG | 5126489 Number of splices: GC/AG | 64714 Number of splices: AT/AC | 1827 Number of splices: Non-canonical | 7150 Mismatch rate per base, % | 0.98% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 871403 % of reads mapped to multiple loci | 6.66% Number of reads mapped to too many loci | 14303 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.06% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874422 874422 874422 N_multimapping 871403 871403 871403 N_noFeature 350899 11025979 453026 N_ambiguous 267405 1337 67024 UnstrandedReadsAssigned:10713447 PositiveStrandReadsAssigned:304435 NegativeStrandReadsAssigned:10811701 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389852-trimmed-pair1.fastq SRR11389852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,077,576 reads, 11,751,822 reads pseudoaligned [quant] estimated average fragment length: 212.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR11389852.ke.tsv 35125 SRR11389852.se.tsv 88098 total ==> SRR11389852.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 725.148 0 0 PNS24247 1044 832.943 22.9104 3.1941 PNS24249 1928 1716.94 129.618 8.76682 PNS24246 1044 832.943 22.9104 3.1941 PNS24248 1044 832.943 22.9104 3.1941 PNS24244 1471 1259.94 18.6509 1.71902 PNS24243 293 104.659 1 1.10957 KQK14069 1603 1391.94 933.751 77.9008 KQK14071 474 266.069 85.0148 37.105 ==> SRR11389852.se.tsv <== BRADI_1g14170v3 1036 BRADI_1g53295v3 12 BRADI_1g59795v3 173 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 138 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 142 BRADI_1g48960v3 1 SRR11389852 completed mapping pipeline successfully