Starting /dee2/code/volunteer_pipeline.sh SRR11389853 current disk space = 1544473890816 free memory = 1604696816 SRR11389853 SRAfilesize d76672561fe769f42a6304027a9c08e9 SRR11389853.sra SRR11389853.sra file validated SRR11389853 is paired end SRR11389853 is conventional basespace SRR11389853 read1 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1045 32.0 32.0 32.0 32.0 32.0 2 31.10175 32.0 32.0 32.0 32.0 32.0 3 30.938 32.0 32.0 32.0 32.0 32.0 4 31.14275 32.0 32.0 32.0 32.0 32.0 5 31.1365 32.0 32.0 32.0 32.0 32.0 6 33.89175 36.0 36.0 36.0 32.0 36.0 7 33.88675 36.0 36.0 36.0 32.0 36.0 8 33.89625 36.0 36.0 36.0 32.0 36.0 9 33.9925 36.0 36.0 36.0 32.0 36.0 10-11 33.929249999999996 36.0 36.0 36.0 32.0 36.0 12-13 33.970375000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.95725 36.0 36.0 36.0 32.0 36.0 16-17 33.876000000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.772125 36.0 36.0 36.0 32.0 36.0 20-21 33.605000000000004 36.0 36.0 36.0 27.0 36.0 22-23 33.711 36.0 36.0 36.0 29.5 36.0 24-25 33.459625 36.0 36.0 36.0 27.0 36.0 26-27 33.412125 36.0 36.0 36.0 24.0 36.0 28-29 33.33025 36.0 36.0 36.0 21.0 36.0 30-31 33.18725 36.0 36.0 36.0 17.5 36.0 32-33 33.3075 36.0 36.0 36.0 24.0 36.0 34-35 33.1395 36.0 36.0 36.0 17.5 36.0 36-37 33.111999999999995 36.0 36.0 36.0 17.5 36.0 38-39 33.1435 36.0 36.0 36.0 17.5 36.0 40-41 33.1515 36.0 36.0 36.0 14.0 36.0 42-43 32.839959989997496 36.0 36.0 36.0 14.0 36.0 44-45 32.88272068017004 36.0 36.0 36.0 14.0 36.0 46-47 32.493623405851466 36.0 32.0 36.0 14.0 36.0 48-49 32.49549887471868 36.0 32.0 36.0 14.0 36.0 50-51 32.461240310077514 36.0 32.0 36.0 14.0 36.0 52-53 32.35046261565391 36.0 32.0 36.0 14.0 36.0 54-55 32.195923980995246 36.0 32.0 36.0 14.0 36.0 56-57 31.894348587146787 36.0 32.0 36.0 14.0 36.0 58-59 31.963615903975995 36.0 32.0 36.0 14.0 36.0 60-61 32.065516379094774 36.0 32.0 36.0 14.0 36.0 62-63 31.908204102051027 36.0 32.0 36.0 14.0 36.0 64-65 31.905577788894448 36.0 32.0 36.0 14.0 36.0 66-67 31.76870152614461 36.0 32.0 36.0 14.0 36.0 68-69 31.65511633725294 36.0 32.0 36.0 14.0 36.0 70-71 31.715570376155082 36.0 32.0 36.0 14.0 36.0 72-73 31.674444875507024 36.0 32.0 36.0 14.0 36.0 74-75 31.48677240462736 36.0 32.0 36.0 14.0 36.0 76 30.349617207437113 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 17.0 24 30.0 25 36.0 26 68.0 27 94.0 28 150.0 29 193.0 30 293.0 31 375.0 32 467.0 33 648.0 34 931.0 35 694.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.35 9.049999999999999 14.325 33.275 2 28.925 11.15 28.075 31.85 3 28.425 16.25 22.625 32.7 4 29.75 25.025 20.325 24.9 5 28.4 25.874999999999996 23.075000000000003 22.650000000000002 6 21.675 30.675 26.35 21.3 7 17.974999999999998 25.35 35.25 21.425 8 19.825 24.125 31.025000000000002 25.025 9 19.875 21.525 32.1 26.5 10-11 22.900000000000002 29.612500000000004 23.6125 23.875 12-13 23.875 24.4375 25.5375 26.150000000000002 14-15 23.375 24.55 26.224999999999998 25.85 16-17 24.95 25.162499999999998 24.575 25.3125 18-19 24.0 24.525 26.150000000000002 25.324999999999996 20-21 23.2875 25.2 25.775 25.7375 22-23 23.525 25.112499999999997 25.874999999999996 25.4875 24-25 23.275000000000002 25.412499999999998 25.662499999999998 25.650000000000002 26-27 23.625 24.5625 25.887500000000003 25.924999999999997 28-29 24.625 24.625 24.4 26.35 30-31 23.4875 25.124999999999996 25.112499999999997 26.275 32-33 23.925 25.6125 25.0625 25.4 34-35 24.3 24.7875 25.35 25.5625 36-37 23.8875 23.875 25.937500000000004 26.3 38-39 23.65 26.075 24.8625 25.412499999999998 40-41 24.212500000000002 24.6125 24.875 26.3 42-43 23.818454613653415 24.88122030507627 24.518629657414355 26.78169542385596 44-45 23.893473368342086 25.49387346836709 25.693923480870218 24.918729682420604 46-47 23.63090772693173 25.681420355088775 24.456114028507127 26.231557889472366 48-49 23.668417104276067 25.343835958989747 24.618654663665918 26.36909227306827 50-51 24.243560890222557 24.593648412103025 25.28132033008252 25.881470367591895 52-53 24.093523380845213 24.043510877719427 24.93123280820205 26.93173293323331 54-55 23.793448362090523 25.55638909727432 24.60615153788447 26.04401100275069 56-57 23.643410852713178 25.343835958989747 24.656164041010253 26.356589147286826 58-59 23.455863965991497 24.50612653163291 24.868717179294826 27.169292323080768 60-61 24.3935983995999 25.10627656914228 25.29382345586397 25.206301575393848 62-63 24.224612306153077 25.125062531265634 24.537268634317158 26.113056528264135 64-65 24.749874937468736 23.911955977988995 25.48774387193597 25.850425212606304 66-67 25.21891418563923 23.44258193645234 25.268951713785338 26.069552164123095 68-69 23.58018513885414 24.380785589191895 25.544158118588946 26.494871153365025 70-71 24.286786786786788 24.587087087087088 25.275275275275277 25.850850850850847 72-73 24.56360668089916 23.772447570011302 24.3877935451463 27.276152203943237 74-75 23.919651116690897 21.488040174441654 26.496630104400687 28.095678604466762 76 26.540284360189574 0.0 36.05541378053226 37.40430185927816 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 2.5 20 3.0 21 2.0 22 2.0 23 2.0 24 3.5 25 4.5 26 5.5 27 10.5 28 13.0 29 12.0 30 18.0 31 27.5 32 34.0 33 38.5 34 47.0 35 62.5 36 87.0 37 100.5 38 107.5 39 136.0 40 166.0 41 187.0 42 205.5 43 202.0 44 204.0 45 226.5 46 236.0 47 231.0 48 219.5 49 204.0 50 191.5 51 175.5 52 160.5 53 153.0 54 135.5 55 130.5 56 129.5 57 122.5 58 116.0 59 110.0 60 103.0 61 97.0 62 96.0 63 91.0 64 82.5 65 75.5 66 68.5 67 65.0 68 58.0 69 54.0 70 52.5 71 47.0 72 43.5 73 32.5 74 24.5 75 22.5 76 22.5 77 20.5 78 15.0 79 11.0 80 10.0 81 6.0 82 3.0 83 3.5 84 3.5 85 3.0 86 1.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 7.0 72 13.0 73 66.0 74 251.0 75 915.0 76 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389853 read2 length is 41-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.31875 32.0 32.0 32.0 21.0 32.0 2 29.901 32.0 32.0 32.0 14.0 32.0 3 29.78625 32.0 32.0 32.0 21.0 32.0 4 29.9945 32.0 32.0 32.0 21.0 32.0 5 29.93025 32.0 32.0 32.0 21.0 32.0 6 32.80525 36.0 36.0 36.0 14.0 36.0 7 32.98925 36.0 36.0 36.0 21.0 36.0 8 32.69725 36.0 36.0 36.0 14.0 36.0 9 32.79775 36.0 32.0 36.0 14.0 36.0 10-11 32.6225 36.0 34.0 36.0 17.5 36.0 12-13 32.50025 36.0 34.0 36.0 14.0 36.0 14-15 32.431749999999994 36.0 34.0 36.0 14.0 36.0 16-17 32.631249999999994 36.0 32.0 36.0 14.0 36.0 18-19 32.429875 36.0 32.0 36.0 14.0 36.0 20-21 32.2205 36.0 32.0 36.0 14.0 36.0 22-23 32.38875 36.0 32.0 36.0 14.0 36.0 24-25 32.209875 36.0 32.0 36.0 14.0 36.0 26-27 32.158125 36.0 32.0 36.0 14.0 36.0 28-29 32.148875000000004 36.0 32.0 36.0 14.0 36.0 30-31 31.96625 36.0 32.0 36.0 14.0 36.0 32-33 31.979125000000003 36.0 32.0 36.0 14.0 36.0 34-35 31.9345 36.0 32.0 36.0 14.0 36.0 36-37 31.713500000000003 36.0 32.0 36.0 14.0 36.0 38-39 31.720875 36.0 32.0 36.0 14.0 36.0 40-41 31.361375000000002 36.0 32.0 36.0 14.0 36.0 42-43 31.261565391347837 36.0 32.0 36.0 14.0 36.0 44-45 31.286196549137284 36.0 32.0 36.0 14.0 36.0 46-47 31.25768942235559 36.0 32.0 36.0 14.0 36.0 48-49 31.382845711427855 36.0 32.0 36.0 14.0 36.0 50-51 31.01712928232058 36.0 32.0 36.0 14.0 36.0 52-53 31.059514878719682 36.0 32.0 36.0 14.0 36.0 54-55 30.80457614403601 36.0 29.5 36.0 14.0 36.0 56-57 30.594148537134284 36.0 27.0 36.0 14.0 36.0 58-59 30.812328082020507 36.0 29.5 36.0 14.0 36.0 60-61 30.59739934983746 36.0 27.0 36.0 14.0 36.0 62-63 30.60605302651326 36.0 27.0 36.0 14.0 36.0 64-65 30.321535767883944 36.0 27.0 36.0 14.0 36.0 66-67 30.275206404803605 36.0 27.0 36.0 14.0 36.0 68-69 30.40893169877408 36.0 27.0 36.0 14.0 36.0 70-71 30.13179149583937 36.0 27.0 36.0 14.0 36.0 72-73 30.060345949894433 36.0 27.0 36.0 14.0 36.0 74-75 30.152165698236686 36.0 27.0 36.0 14.0 36.0 76 28.3714496495758 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 11.0 16 25.0 17 9.0 18 8.0 19 7.0 20 8.0 21 12.0 22 24.0 23 44.0 24 60.0 25 79.0 26 120.0 27 161.0 28 243.0 29 281.0 30 363.0 31 434.0 32 542.0 33 611.0 34 650.0 35 307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5266449837378 16.46234676007005 14.085564173129846 33.925444083062295 2 31.94896172129097 23.642732049036777 23.19239429572179 21.215911933950462 3 29.625 27.200000000000003 18.975 24.2 4 31.025000000000002 31.55 15.825 21.6 5 30.540270135067534 31.665832916458232 18.159079539769884 19.634817408704354 6 24.912456228114056 33.96698349174587 20.735367683841922 20.38519259629815 7 24.175 18.2 31.775 25.85 8 26.35 23.150000000000002 23.5 27.0 9 25.8 22.400000000000002 26.424999999999997 25.374999999999996 10-11 27.728466058257283 28.01600200025003 19.41492686585823 24.840605075634453 12-13 27.224999999999998 22.575 23.775 26.424999999999997 14-15 26.625 24.474999999999998 24.4125 24.4875 16-17 27.6625 23.575 23.200000000000003 25.5625 18-19 26.150000000000002 24.6125 23.875 25.362499999999997 20-21 26.787499999999998 24.462500000000002 23.75 25.0 22-23 26.7625 24.6 23.45 25.1875 24-25 26.43491309240965 24.821808178066775 24.096536201075402 24.64674252844817 26-27 26.8625 24.85 23.925 24.3625 28-29 27.775 24.4 22.9375 24.887500000000003 30-31 26.450000000000003 24.975 23.4625 25.112499999999997 32-33 27.3875 25.2125 23.200000000000003 24.2 34-35 27.287499999999998 25.45 22.787499999999998 24.474999999999998 36-37 26.25 25.2625 23.0875 25.4 38-39 27.625 24.8 23.225 24.349999999999998 40-41 28.65 24.1125 22.900000000000002 24.337500000000002 42-43 26.569142285571395 25.156289072268066 22.493123280820203 25.78144536134033 44-45 26.906726681670417 24.943735933983497 23.143285821455365 25.006251562890725 46-47 26.969242310577645 23.868467116779193 23.293323330832706 25.868967241810452 48-49 26.71917979494874 24.981245311327832 23.118279569892472 25.18129532383096 50-51 26.994248562140534 24.781195298824706 22.693173293323333 25.531382845711427 52-53 27.219304826206553 24.318579644911228 23.268317079269817 25.1937984496124 54-55 26.85671417854464 25.243810952738183 23.030757689422355 24.868717179294826 56-57 26.906726681670417 24.643660915228807 23.843460865216304 24.60615153788447 58-59 26.969242310577645 25.006251562890725 22.55563890972743 25.468867216804203 60-61 26.447417781668126 24.871826935100664 23.183693885206953 25.497061398024258 62-63 26.28814407203602 25.062531265632813 24.287143571785894 24.362181090545274 64-65 27.051025512756375 24.599799899949975 23.36168084042021 24.987493746873437 66-67 26.870152614460846 24.943707780835627 24.168126094570926 24.0180135101326 68-69 26.745058794095574 25.081310983237426 23.267450587940957 24.906179634726044 70-71 27.391086629944915 24.76214321482223 22.734101151727593 25.112669003505257 72-73 25.817815802717664 25.050327126321086 23.88022143935581 25.251635631605435 74-75 26.35576282478348 22.105263157894736 25.03664223850766 26.502331778814124 76 29.59409594095941 0.0 31.69741697416974 38.708487084870846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.5 22 3.0 23 4.0 24 3.5 25 4.0 26 3.5 27 6.5 28 12.0 29 14.0 30 18.5 31 22.5 32 24.5 33 31.0 34 43.5 35 54.5 36 71.0 37 84.5 38 94.0 39 129.5 40 154.0 41 159.0 42 168.5 43 179.5 44 194.0 45 216.5 46 221.0 47 206.5 48 192.0 49 172.0 50 167.0 51 160.0 52 145.0 53 139.5 54 134.5 55 129.5 56 122.5 57 117.5 58 120.0 59 126.0 60 137.0 61 129.5 62 115.0 63 101.5 64 89.5 65 92.5 66 82.0 67 72.0 68 72.5 69 67.0 70 58.5 71 51.5 72 50.5 73 45.0 74 45.0 75 48.0 76 36.0 77 26.0 78 22.0 79 20.5 80 16.0 81 10.0 82 6.5 83 4.0 84 2.5 85 1.0 86 1.0 87 1.0 88 0.5 89 1.0 90 4.0 91 3.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.5 98 1.5 99 7.0 100 12.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.0 4 0.0 5 0.05 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.012503125781445362 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.03688675765400221 >>END_MODULE >>Sequence Length Distribution warn #Length Count 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 6.0 71 7.0 72 20.0 73 75.0 74 273.0 75 905.0 76 2711.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52092788703983 98.675 2 0.37821482602118006 0.75 3 0.02521432173474534 0.075 4 0.05042864346949068 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617698 spots for SRR11389853.sra Written 617698 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra Read 617689 spots for SRR11389853.sra Written 617689 spots for SRR11389853.sra SRR ids: ['SRR11389853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xh1f6s8z SRR11389853.sra spots: 12353789 blocks: [[1, 617689], [617690, 1235378], [1235379, 1853067], [1853068, 2470756], [2470757, 3088445], [3088446, 3706134], [3706135, 4323823], [4323824, 4941512], [4941513, 5559201], [5559202, 6176890], [6176891, 6794579], [6794580, 7412268], [7412269, 8029957], [8029958, 8647646], [8647647, 9265335], [9265336, 9883024], [9883025, 10500713], [10500714, 11118402], [11118403, 11736091], [11736092, 12353789]] SRR11389853 file size 2343705 SRR11389853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389853 SRR11389853_1.fastq SRR11389853_2.fastq Input file: SRR11389853_1.fastq Paired file: SRR11389853_2.fastq trimmed: SRR11389853-trimmed-pair1.fastq, SRR11389853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:14:58 2024 >> started Sat Dec 7 08:15:08 2024 >> done (10.039s) 12353789 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 42338 ( 0.34%) empty read pairs filtered out after trimming by size control 12311449 (99.66%) read pairs available; of these: 6294 ( 0.05%) trimmed read pairs available after processing 12305155 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 93 0.00% 36 81 0.00% 37 129 0.00% 38 143 0.00% 39 150 0.00% 40 173 0.00% 41 219 0.00% 42 250 0.00% 43 269 0.00% 44 316 0.00% 45 346 0.00% 46 374 0.00% 47 421 0.00% 48 437 0.00% 49 490 0.00% 50 517 0.00% 51 588 0.00% 52 624 0.01% 53 726 0.01% 54 705 0.01% 55 903 0.01% 56 960 0.01% 57 1038 0.01% 58 1147 0.01% 59 1226 0.01% 60 1292 0.01% 61 1359 0.01% 62 1553 0.01% 63 1524 0.01% 64 1688 0.01% 65 1761 0.01% 66 1972 0.02% 67 2174 0.02% 68 2181 0.02% 69 2471 0.02% 70 2998 0.02% 71 4054 0.03% 72 11822 0.10% 73 101567 0.82% 74 857862 6.97% 75 5419475 44.02% 76 5883358 47.79% 12311449 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=73.56 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=13.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=28 prefix-density=0.36 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=149.94 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=19.0 sequence=GCCGCCGCCACCCTGA SRR11389853 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:15:36 Started mapping on | Dec 07 08:15:36 Finished on | Dec 07 08:16:36 Mapping speed, Million of reads per hour | 738.69 Number of input reads | 12311449 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 10846302 Uniquely mapped reads % | 88.10% Average mapped length | 150.02 Number of splices: Total | 5087500 Number of splices: Annotated (sjdb) | 4871893 Number of splices: GT/AG | 5017003 Number of splices: GC/AG | 62631 Number of splices: AT/AC | 1816 Number of splices: Non-canonical | 6050 Mismatch rate per base, % | 1.00% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 653774 % of reads mapped to multiple loci | 5.31% Number of reads mapped to too many loci | 15004 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.90% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811373 811373 811373 N_multimapping 653774 653774 653774 N_noFeature 328875 10570763 407759 N_ambiguous 252863 1274 60037 UnstrandedReadsAssigned:10264564 PositiveStrandReadsAssigned:274265 NegativeStrandReadsAssigned:10378506 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389853-trimmed-pair1.fastq SRR11389853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,311,449 reads, 11,114,025 reads pseudoaligned [quant] estimated average fragment length: 220.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR11389853.ke.tsv 35125 SRR11389853.se.tsv 88098 total ==> SRR11389853.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.233 15.0203 2.58875 PNS24247 1044 824.011 10.1939 1.52712 PNS24249 1928 1708.01 115.5 8.34752 PNS24246 1044 824.011 10.1939 1.52712 PNS24248 1044 824.011 10.1939 1.52712 PNS24244 1471 1251.01 20.8975 2.06204 PNS24243 293 98.861 0 0 KQK14069 1603 1383.01 168.871 15.0728 KQK14071 474 257.562 7.63798 3.66067 ==> SRR11389853.se.tsv <== BRADI_1g14170v3 185 BRADI_1g53295v3 23 BRADI_1g59795v3 161 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 138 BRADI_1g74790v3 165 BRADI_1g09890v3 0 BRADI_1g77505v3 115 BRADI_1g48960v3 0 SRR11389853 completed mapping pipeline successfully