Starting /dee2/code/volunteer_pipeline.sh SRR11389854 current disk space = 1544466448384 free memory = 1597255448 SRR11389854 SRAfilesize 96604c57281c9fd22dd63d0c18673d3b SRR11389854.sra SRR11389854.sra file validated SRR11389854 is paired end SRR11389854 is conventional basespace SRR11389854 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.093 32.0 32.0 32.0 32.0 32.0 2 31.0095 32.0 32.0 32.0 32.0 32.0 3 31.073 32.0 32.0 32.0 32.0 32.0 4 31.04225 32.0 32.0 32.0 32.0 32.0 5 31.0405 32.0 32.0 32.0 32.0 32.0 6 33.934 36.0 36.0 36.0 32.0 36.0 7 33.854 36.0 36.0 36.0 32.0 36.0 8 33.907 36.0 36.0 36.0 32.0 36.0 9 33.86175 36.0 36.0 36.0 32.0 36.0 10-11 33.93825 36.0 36.0 36.0 32.0 36.0 12-13 34.002250000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.90475 36.0 36.0 36.0 32.0 36.0 16-17 33.900625000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.784125 36.0 36.0 36.0 32.0 36.0 20-21 33.703125 36.0 36.0 36.0 29.5 36.0 22-23 33.673500000000004 36.0 36.0 36.0 27.0 36.0 24-25 33.36475 36.0 36.0 36.0 24.0 36.0 26-27 33.360125 36.0 36.0 36.0 27.0 36.0 28-29 33.2605 36.0 36.0 36.0 21.0 36.0 30-31 33.1975 36.0 36.0 36.0 17.5 36.0 32-33 33.27612499999999 36.0 36.0 36.0 21.0 36.0 34-35 33.057375 36.0 36.0 36.0 17.5 36.0 36-37 33.079125000000005 36.0 36.0 36.0 17.5 36.0 38-39 33.181875000000005 36.0 36.0 36.0 17.5 36.0 40-41 32.907375 36.0 36.0 36.0 14.0 36.0 42-43 32.818625 36.0 36.0 36.0 14.0 36.0 44-45 32.94575 36.0 36.0 36.0 14.0 36.0 46-47 32.51625 36.0 32.0 36.0 14.0 36.0 48-49 32.46425 36.0 32.0 36.0 14.0 36.0 50-51 32.441360340085026 36.0 32.0 36.0 14.0 36.0 52-53 32.26606651662915 36.0 32.0 36.0 14.0 36.0 54-55 32.381970492623154 36.0 32.0 36.0 14.0 36.0 56-57 31.98599649912478 36.0 32.0 36.0 14.0 36.0 58-59 31.928482120530134 36.0 32.0 36.0 14.0 36.0 60-61 32.08517036712905 36.0 32.0 36.0 14.0 36.0 62-63 31.777263631815906 36.0 32.0 36.0 14.0 36.0 64-65 31.69647323661831 36.0 32.0 36.0 14.0 36.0 66-67 31.747185389041782 36.0 32.0 36.0 14.0 36.0 68-69 31.665415415415417 36.0 32.0 36.0 14.0 36.0 70-71 31.67498916313059 36.0 32.0 36.0 14.0 36.0 72-73 31.368899304147064 36.0 32.0 36.0 14.0 36.0 74-75 31.551661730259642 36.0 32.0 36.0 14.0 36.0 76 29.918389955686855 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 7.0 23 11.0 24 13.0 25 48.0 26 67.0 27 114.0 28 166.0 29 209.0 30 260.0 31 358.0 32 470.0 33 671.0 34 926.0 35 678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.65 8.325000000000001 13.750000000000002 32.275 2 30.275000000000002 10.7 26.424999999999997 32.6 3 27.275 15.4 22.225 35.099999999999994 4 31.324999999999996 23.724999999999998 19.900000000000002 25.05 5 29.375 25.75 21.725 23.150000000000002 6 24.25 31.1 23.549999999999997 21.099999999999998 7 18.825 24.675 34.35 22.15 8 20.349999999999998 23.925 30.85 24.875 9 20.05 21.775 32.025 26.150000000000002 10-11 23.525 28.549999999999997 23.375 24.55 12-13 24.625 24.587500000000002 25.137500000000003 25.650000000000002 14-15 23.9125 25.2875 25.9875 24.8125 16-17 24.75 25.124999999999996 24.175 25.95 18-19 23.4625 25.224999999999998 25.112499999999997 26.200000000000003 20-21 23.625 24.175 25.6125 26.5875 22-23 25.025 24.637500000000003 24.125 26.2125 24-25 23.9875 24.8625 24.962500000000002 26.187500000000004 26-27 24.9125 24.425 24.2625 26.400000000000002 28-29 25.474999999999998 24.637500000000003 24.1625 25.724999999999998 30-31 24.4125 24.3125 24.2625 27.0125 32-33 23.962500000000002 24.6625 25.45 25.924999999999997 34-35 24.337500000000002 24.65 24.474999999999998 26.5375 36-37 24.925 23.65 25.1 26.325 38-39 24.0125 24.95 25.112499999999997 25.924999999999997 40-41 24.625 24.125 24.05 27.200000000000003 42-43 24.275 24.474999999999998 25.025 26.224999999999998 44-45 24.675 24.1125 24.65 26.5625 46-47 24.575 24.337500000000002 24.85 26.237500000000004 48-49 24.525 24.462500000000002 24.375 26.637499999999996 50-51 24.306076519129782 24.118529632408105 24.306076519129782 27.26931732933233 52-53 25.218804701175294 23.13078269567392 24.468617154288573 27.181795448862218 54-55 24.843710927731934 23.755938984746187 24.781195298824706 26.619154788697173 56-57 24.218554638659665 25.081270317579396 24.618654663665918 26.081520380095025 58-59 24.55613903475869 23.618404601150285 25.143785946486624 26.6816704176044 60-61 24.621733149931224 24.634237839189694 25.09691134175316 25.647117669125922 62-63 25.11255627813907 23.54927463731866 24.824912456228116 26.513256628314156 64-65 24.862431215607803 24.937468734367183 23.71185592796398 26.488244122061033 66-67 24.418313735301474 24.243182386790092 24.69352014010508 26.64498373780335 68-69 24.93743743743744 24.512012012012015 23.836336336336338 26.714214214214216 70-71 25.31598047803779 24.740332874483794 23.201101238893756 26.742585408584656 72-73 24.5605223505776 23.392767453540934 25.200904068307384 26.845806127574086 74-75 25.148358169589873 21.27126467097455 25.201107740999607 28.379269418435975 76 27.99113737075332 0.0 33.93648449039882 38.07237813884786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 2.5 20 3.5 21 2.5 22 3.0 23 4.0 24 3.0 25 1.5 26 4.0 27 8.0 28 10.5 29 13.5 30 18.5 31 19.0 32 18.0 33 24.5 34 37.5 35 53.5 36 66.0 37 79.5 38 103.5 39 125.5 40 149.0 41 181.0 42 200.0 43 203.5 44 206.0 45 222.0 46 231.5 47 218.5 48 201.0 49 177.5 50 156.0 51 140.0 52 136.5 53 121.0 54 102.5 55 125.0 56 140.5 57 144.0 58 149.0 59 141.0 60 141.0 61 145.0 62 141.5 63 120.0 64 97.0 65 89.5 66 78.0 67 63.0 68 55.0 69 55.5 70 54.0 71 49.0 72 44.0 73 37.5 74 31.0 75 27.5 76 26.5 77 24.5 78 13.5 79 4.5 80 6.5 81 5.5 82 2.5 83 2.0 84 1.0 85 2.5 86 3.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 1.0 68 0.0 69 0.0 70 1.0 71 3.0 72 20.0 73 56.0 74 249.0 75 959.0 76 2708.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.92094455852155 95.375 2 1.6683778234086244 3.25 3 0.3336755646817248 0.975 4 0.025667351129363452 0.1 5 0.025667351129363452 0.125 6 0.0 0.0 7 0.025667351129363452 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 7 0.17500000000000002 No Hit GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389854 read2 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.58275 32.0 32.0 32.0 32.0 32.0 2 30.21725 32.0 32.0 32.0 21.0 32.0 3 30.1665 32.0 32.0 32.0 21.0 32.0 4 30.21275 32.0 32.0 32.0 21.0 32.0 5 30.25 32.0 32.0 32.0 21.0 32.0 6 33.43125 36.0 36.0 36.0 21.0 36.0 7 33.34625 36.0 36.0 36.0 21.0 36.0 8 33.2275 36.0 36.0 36.0 21.0 36.0 9 33.2145 36.0 36.0 36.0 21.0 36.0 10-11 33.17 36.0 36.0 36.0 17.5 36.0 12-13 33.002624999999995 36.0 36.0 36.0 17.5 36.0 14-15 32.892624999999995 36.0 36.0 36.0 14.0 36.0 16-17 32.99925 36.0 36.0 36.0 21.0 36.0 18-19 33.07875 36.0 36.0 36.0 21.0 36.0 20-21 32.783875 36.0 36.0 36.0 14.0 36.0 22-23 32.831875 36.0 36.0 36.0 17.5 36.0 24-25 32.677875 36.0 36.0 36.0 14.0 36.0 26-27 32.53075 36.0 36.0 36.0 14.0 36.0 28-29 32.5865 36.0 34.0 36.0 14.0 36.0 30-31 32.475375 36.0 36.0 36.0 14.0 36.0 32-33 32.474000000000004 36.0 34.0 36.0 14.0 36.0 34-35 32.292 36.0 34.0 36.0 14.0 36.0 36-37 32.181250000000006 36.0 32.0 36.0 14.0 36.0 38-39 32.111374999999995 36.0 32.0 36.0 14.0 36.0 40-41 32.017375 36.0 32.0 36.0 14.0 36.0 42-43 31.7575 36.0 32.0 36.0 14.0 36.0 44-45 31.7665 36.0 32.0 36.0 14.0 36.0 46-47 31.61575 36.0 32.0 36.0 14.0 36.0 48-49 31.731 36.0 32.0 36.0 14.0 36.0 50-51 31.51575393848462 36.0 32.0 36.0 14.0 36.0 52-53 31.575393848462117 36.0 32.0 36.0 14.0 36.0 54-55 31.17908954477239 36.0 32.0 36.0 14.0 36.0 56-57 30.80415207603802 36.0 29.5 36.0 14.0 36.0 58-59 31.04614807403702 36.0 32.0 36.0 14.0 36.0 60-61 31.015638855204436 36.0 32.0 36.0 14.0 36.0 62-63 30.996372279209407 36.0 32.0 36.0 14.0 36.0 64-65 30.728546409807358 36.0 27.0 36.0 14.0 36.0 66-67 30.638763763763762 36.0 27.0 36.0 14.0 36.0 68-69 30.7828535669587 36.0 29.5 36.0 14.0 36.0 70-71 30.786198263991352 36.0 29.5 36.0 14.0 36.0 72-73 30.624262367777014 36.0 27.0 36.0 14.0 36.0 74-75 30.35271198502815 36.0 27.0 36.0 14.0 36.0 76 28.704570791527313 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 14.0 16 23.0 17 17.0 18 13.0 19 9.0 20 11.0 21 15.0 22 21.0 23 27.0 24 38.0 25 56.0 26 114.0 27 144.0 28 198.0 29 239.0 30 290.0 31 397.0 32 431.0 33 622.0 34 802.0 35 515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.247809762202756 15.869837296620776 11.76470588235294 34.11764705882353 2 32.715894868585735 21.97747183979975 23.379224030037545 21.927409261576972 3 28.775000000000002 27.6 17.825 25.8 4 31.624999999999996 28.349999999999998 17.224999999999998 22.8 5 31.11389236545682 31.08886107634543 19.0738423028786 18.72340425531915 6 25.7007007007007 32.432432432432435 20.545545545545547 21.32132132132132 7 25.174999999999997 16.6 31.5 26.724999999999998 8 26.700000000000003 22.0 21.8 29.5 9 24.725 22.575 25.775 26.924999999999997 10-11 29.275000000000002 26.375 19.425 24.925 12-13 28.225 22.162499999999998 22.662499999999998 26.950000000000003 14-15 27.450000000000003 24.1375 22.900000000000002 25.5125 16-17 27.4125 23.549999999999997 22.125 26.9125 18-19 27.3875 25.05 22.6375 24.925 20-21 27.925 24.325 23.3125 24.4375 22-23 27.6875 25.162499999999998 21.1375 26.0125 24-25 27.822933600100036 24.446667500312618 22.733525071901965 24.99687382768538 26-27 27.425 25.7 22.5125 24.3625 28-29 27.8625 24.375 21.55 26.2125 30-31 26.75 24.3625 23.3875 25.5 32-33 27.212500000000002 24.7 22.5 25.587500000000002 34-35 28.512500000000003 24.45 22.537499999999998 24.5 36-37 27.187499999999996 24.15 22.775000000000002 25.887500000000003 38-39 27.037499999999998 24.887500000000003 22.912499999999998 25.162499999999998 40-41 27.5875 24.224999999999998 22.25 25.937500000000004 42-43 26.724999999999998 24.675 23.05 25.55 44-45 26.950000000000003 24.175 22.55 26.325 46-47 28.1375 24.825 21.85 25.1875 48-49 26.575 24.25 23.799999999999997 25.374999999999996 50-51 27.569392348087025 24.843710927731934 22.655663915978995 24.93123280820205 52-53 26.6816704176044 25.143785946486624 22.780695173793447 25.393848462115532 54-55 27.126063031515756 24.83741870935468 22.448724362181093 25.587793896948476 56-57 26.413206603301653 25.237618809404704 23.349174587293646 25.0 58-59 27.838919459729865 23.911955977988995 21.96098049024512 26.28814407203602 60-61 26.391494684177612 24.853033145716072 22.80175109443402 25.95372107567229 62-63 26.782586940205157 24.806104578433825 23.01726294721041 25.39404553415061 64-65 27.070302727045288 23.855391543657746 22.54190642982237 26.53239929947461 66-67 26.964464464464466 22.922922922922922 23.673673673673672 26.43893893893894 68-69 27.722152690863577 24.993742177722154 22.753441802252816 24.53066332916145 70-71 27.848735286751815 24.380165289256198 22.564487853744055 25.206611570247933 72-73 27.0392749244713 23.992950654582074 22.910372608257802 26.057401812688823 74-75 27.481017716797655 22.339150126548553 24.084188091114957 26.09564406553883 76 29.304574191149126 0.0 33.02342878393455 37.67199702491632 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.5 17 2.0 18 2.5 19 2.5 20 3.0 21 3.5 22 4.0 23 3.5 24 3.0 25 3.0 26 5.5 27 9.0 28 11.5 29 14.5 30 18.0 31 19.5 32 23.0 33 26.5 34 31.0 35 44.5 36 61.5 37 73.0 38 95.0 39 121.5 40 131.5 41 147.5 42 163.0 43 181.0 44 191.5 45 175.0 46 164.0 47 166.5 48 164.5 49 156.0 50 148.0 51 143.0 52 144.0 53 142.5 54 135.0 55 139.0 56 148.5 57 141.0 58 133.5 59 145.0 60 149.0 61 135.5 62 126.0 63 117.0 64 104.0 65 104.5 66 110.0 67 106.0 68 89.0 69 67.5 70 67.5 71 74.5 72 67.5 73 56.0 74 42.5 75 31.5 76 26.0 77 19.0 78 16.0 79 18.5 80 16.5 81 10.0 82 8.0 83 8.0 84 5.0 85 2.5 86 4.5 87 6.0 88 2.5 89 1.5 90 2.5 91 3.5 92 5.0 93 3.5 94 4.0 95 5.0 96 4.0 97 2.0 98 1.5 99 7.5 100 12.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.0 4 0.0 5 0.125 6 0.1 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.07432181345224824 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 1.0 68 0.0 69 0.0 70 4.0 71 8.0 72 22.0 73 75.0 74 265.0 75 930.0 76 2691.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57288481141691 96.7 2 1.2487257900101938 2.45 3 0.127420998980632 0.375 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661320 spots for SRR11389854.sra Written 661320 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra Read 661319 spots for SRR11389854.sra Written 661319 spots for SRR11389854.sra SRR ids: ['SRR11389854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hybwj_uk SRR11389854.sra spots: 13226381 blocks: [[1, 661319], [661320, 1322638], [1322639, 1983957], [1983958, 2645276], [2645277, 3306595], [3306596, 3967914], [3967915, 4629233], [4629234, 5290552], [5290553, 5951871], [5951872, 6613190], [6613191, 7274509], [7274510, 7935828], [7935829, 8597147], [8597148, 9258466], [9258467, 9919785], [9919786, 10581104], [10581105, 11242423], [11242424, 11903742], [11903743, 12565061], [12565062, 13226381]] SRR11389854 file size 2510769 SRR11389854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389854 SRR11389854_1.fastq SRR11389854_2.fastq Input file: SRR11389854_1.fastq Paired file: SRR11389854_2.fastq trimmed: SRR11389854-trimmed-pair1.fastq, SRR11389854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:15:51 2024 >> started Sat Dec 7 08:16:02 2024 >> done (10.989s) 13226381 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 39096 ( 0.30%) empty read pairs filtered out after trimming by size control 13187282 (99.70%) read pairs available; of these: 7416 ( 0.06%) trimmed read pairs available after processing 13179866 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 8 0.00% 32 2 0.00% 33 3 0.00% 34 4 0.00% 35 117 0.00% 36 138 0.00% 37 187 0.00% 38 197 0.00% 39 234 0.00% 40 263 0.00% 41 335 0.00% 42 327 0.00% 43 378 0.00% 44 443 0.00% 45 441 0.00% 46 496 0.00% 47 524 0.00% 48 583 0.00% 49 616 0.00% 50 741 0.01% 51 798 0.01% 52 894 0.01% 53 1016 0.01% 54 1032 0.01% 55 1188 0.01% 56 1370 0.01% 57 1525 0.01% 58 1588 0.01% 59 1796 0.01% 60 1731 0.01% 61 1909 0.01% 62 2063 0.02% 63 2265 0.02% 64 2381 0.02% 65 2554 0.02% 66 2883 0.02% 67 3156 0.02% 68 3072 0.02% 69 3537 0.03% 70 4033 0.03% 71 5371 0.04% 72 14001 0.11% 73 106222 0.81% 74 876921 6.65% 75 5766506 43.73% 76 6371407 48.31% 13187282 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=15 prefix-density=0.98 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=9.81 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.7 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=16 prefix-density=0.76 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=23.20 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389854 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:16:33 Started mapping on | Dec 07 08:16:33 Finished on | Dec 07 08:17:34 Mapping speed, Million of reads per hour | 778.27 Number of input reads | 13187282 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11259034 Uniquely mapped reads % | 85.38% Average mapped length | 150.12 Number of splices: Total | 5051706 Number of splices: Annotated (sjdb) | 4850568 Number of splices: GT/AG | 4987298 Number of splices: GC/AG | 57247 Number of splices: AT/AC | 1444 Number of splices: Non-canonical | 5717 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1036324 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 31231 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891924 891924 891924 N_multimapping 1036324 1036324 1036324 N_noFeature 306134 11000305 383718 N_ambiguous 255557 1048 79219 UnstrandedReadsAssigned:10697343 PositiveStrandReadsAssigned:257681 NegativeStrandReadsAssigned:10796097 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389854-trimmed-pair1.fastq SRR11389854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,187,282 reads, 11,885,334 reads pseudoaligned [quant] estimated average fragment length: 213.005 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52973 SRR11389854.ke.tsv 35125 SRR11389854.se.tsv 88098 total ==> SRR11389854.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.123 0 0 PNS24247 1044 831.995 10.6504 1.42013 PNS24249 1928 1715.99 53.9984 3.49099 PNS24246 1044 831.995 10.6504 1.42013 PNS24248 1044 831.995 10.6504 1.42013 PNS24244 1471 1258.99 7.05034 0.621255 PNS24243 293 103.871 0 0 KQK14069 1603 1390.99 7.72098 0.615786 KQK14071 474 265.288 2.35569 0.985106 ==> SRR11389854.se.tsv <== BRADI_1g14170v3 15 BRADI_1g53295v3 12 BRADI_1g59795v3 166 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 130 BRADI_1g74790v3 70 BRADI_1g09890v3 0 BRADI_1g77505v3 83 BRADI_1g48960v3 0 SRR11389854 completed mapping pipeline successfully