Starting /dee2/code/volunteer_pipeline.sh SRR11389855 current disk space = 1544481583104 free memory = 1598763204 SRR11389855 SRAfilesize 44f30e8d3ccce8610ffe9030406389e6 SRR11389855.sra SRR11389855.sra file validated SRR11389855 is paired end SRR11389855 is conventional basespace SRR11389855 read1 length is 45-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.035 32.0 32.0 32.0 32.0 32.0 2 31.08775 32.0 32.0 32.0 32.0 32.0 3 31.02975 32.0 32.0 32.0 32.0 32.0 4 31.065 32.0 32.0 32.0 32.0 32.0 5 31.08975 32.0 32.0 32.0 32.0 32.0 6 33.8185 36.0 36.0 36.0 32.0 36.0 7 33.965 36.0 36.0 36.0 32.0 36.0 8 33.9395 36.0 36.0 36.0 32.0 36.0 9 33.74225 36.0 36.0 36.0 32.0 36.0 10-11 33.801125 36.0 36.0 36.0 32.0 36.0 12-13 33.997875 36.0 36.0 36.0 32.0 36.0 14-15 33.9985 36.0 36.0 36.0 32.0 36.0 16-17 33.879125 36.0 36.0 36.0 32.0 36.0 18-19 33.791875000000005 36.0 36.0 36.0 29.5 36.0 20-21 33.703125 36.0 36.0 36.0 29.5 36.0 22-23 33.595375000000004 36.0 36.0 36.0 29.5 36.0 24-25 33.511624999999995 36.0 36.0 36.0 27.0 36.0 26-27 33.29175 36.0 36.0 36.0 21.0 36.0 28-29 33.283500000000004 36.0 36.0 36.0 17.5 36.0 30-31 33.285125 36.0 36.0 36.0 20.5 36.0 32-33 33.23125 36.0 36.0 36.0 21.0 36.0 34-35 33.052125000000004 36.0 36.0 36.0 14.0 36.0 36-37 32.884625 36.0 36.0 36.0 14.0 36.0 38-39 33.028875 36.0 36.0 36.0 14.0 36.0 40-41 32.985875 36.0 36.0 36.0 14.0 36.0 42-43 32.868875 36.0 36.0 36.0 14.0 36.0 44-45 32.964749999999995 36.0 36.0 36.0 14.0 36.0 46-47 32.5355088772193 36.0 32.0 36.0 14.0 36.0 48-49 32.528257064266064 36.0 32.0 36.0 14.0 36.0 50-51 32.448612153038255 36.0 32.0 36.0 14.0 36.0 52-53 32.381970492623154 36.0 32.0 36.0 14.0 36.0 54-55 32.24331082770692 36.0 32.0 36.0 14.0 36.0 56-57 32.07438712479521 36.0 32.0 36.0 14.0 36.0 58-59 31.836877658243683 36.0 32.0 36.0 14.0 36.0 60-61 32.01951463597698 36.0 32.0 36.0 14.0 36.0 62-63 31.906639680982607 36.0 32.0 36.0 14.0 36.0 64-65 31.902252816020024 36.0 32.0 36.0 14.0 36.0 66-67 31.762643965948925 36.0 32.0 36.0 14.0 36.0 68-69 31.687470436990242 36.0 32.0 36.0 14.0 36.0 70-71 31.717003558030196 36.0 32.0 36.0 14.0 36.0 72-73 31.556934559659844 36.0 32.0 36.0 14.0 36.0 74-75 31.51790438691899 36.0 32.0 36.0 14.0 36.0 76 30.21486387049301 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 1.0 22 5.0 23 11.0 24 16.0 25 38.0 26 60.0 27 118.0 28 156.0 29 215.0 30 283.0 31 356.0 32 468.0 33 662.0 34 914.0 35 694.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.375 9.2 14.2 29.225 2 31.3 11.325000000000001 26.375 31.0 3 28.975 15.299999999999999 21.0 34.725 4 33.35 21.15 18.9 26.6 5 29.975 25.575 21.3 23.150000000000002 6 25.324999999999996 29.075 24.675 20.925 7 18.65 25.775 34.325 21.25 8 20.575 25.15 28.525 25.75 9 20.65 20.974999999999998 31.225 27.150000000000002 10-11 23.7875 29.799999999999997 23.2125 23.200000000000003 12-13 25.8125 23.6375 25.275 25.275 14-15 24.2 24.7375 26.0625 25.0 16-17 24.85 24.7875 24.0 26.3625 18-19 24.4 25.1875 24.325 26.087500000000002 20-21 24.762500000000003 24.875 24.7375 25.624999999999996 22-23 24.887500000000003 25.0375 24.2 25.874999999999996 24-25 24.125 24.212500000000002 25.0375 26.625 26-27 24.2375 24.85 24.7875 26.125 28-29 24.75 24.5125 24.5125 26.224999999999998 30-31 24.4875 24.2625 24.2875 26.9625 32-33 23.7875 24.7875 24.65 26.775 34-35 24.4125 24.6 25.087500000000002 25.900000000000002 36-37 24.4 24.3625 25.0 26.237500000000004 38-39 23.875 23.8375 25.25 27.037499999999998 40-41 25.5375 23.8625 24.15 26.450000000000003 42-43 24.375 25.1 24.275 26.25 44-45 24.625 24.775 24.3875 26.2125 46-47 24.281070267566893 23.80595148787197 25.418854713678417 26.494123530882717 48-49 23.718429607401852 25.081270317579396 24.831207801950487 26.36909227306827 50-51 25.131282820705174 24.968742185546386 24.093523380845213 25.806451612903224 52-53 25.318829707426854 24.23105776444111 23.843460865216304 26.60665166291573 54-55 23.80595148787197 24.981245311327832 24.60615153788447 26.60665166291573 56-57 24.421658121795673 24.409153432537202 24.371639364761783 26.79754908090534 58-59 24.906179634726044 23.8804103077308 24.605954465849386 26.607455591693768 60-61 24.48086064548411 24.931198398799097 24.168126094570926 26.419814861145856 62-63 25.203353772994618 25.078212989613313 23.526467275685146 26.19196596170692 64-65 25.481852315394242 24.317897371714643 24.080100125156445 26.12015018773467 66-67 24.04857285928893 23.87330996494742 25.137706559839764 26.940410615923888 68-69 24.489540273080294 23.825629462608042 24.97807841663535 26.706751847676312 70-71 25.42925178593809 24.414086978318082 23.323724777541045 26.832936458202784 72-73 24.337228295011936 24.4880010051514 24.500565397663024 26.674205302173643 74-75 25.383192389006343 22.05338266384778 24.418604651162788 28.144820295983088 76 28.108903605592346 0.0 32.48712288447388 39.40397350993378 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 3.0 19 5.0 20 5.5 21 7.5 22 6.0 23 3.5 24 1.5 25 2.0 26 5.0 27 7.5 28 11.0 29 16.0 30 18.5 31 18.0 32 24.0 33 35.5 34 47.0 35 66.5 36 85.5 37 97.5 38 103.0 39 109.5 40 131.5 41 149.5 42 176.0 43 205.0 44 222.5 45 218.5 46 205.0 47 196.0 48 184.0 49 185.5 50 186.0 51 165.0 52 146.0 53 140.0 54 131.0 55 126.5 56 122.5 57 126.5 58 131.0 59 120.5 60 126.5 61 129.0 62 117.0 63 107.0 64 97.0 65 94.5 66 88.5 67 88.0 68 85.5 69 77.5 70 57.5 71 40.5 72 44.5 73 38.0 74 33.5 75 34.5 76 27.0 77 22.0 78 15.0 79 10.5 80 8.0 81 3.5 82 4.5 83 6.5 84 4.5 85 2.0 86 0.5 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 1.0 63 0.0 64 0.0 65 1.0 66 0.0 67 2.0 68 1.0 69 1.0 70 1.0 71 1.0 72 17.0 73 56.0 74 262.0 75 935.0 76 2718.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18877551020408 96.22500000000001 2 1.607142857142857 3.15 3 0.17857142857142858 0.525 4 0.025510204081632654 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389855 read2 length is 45-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44925 32.0 32.0 32.0 21.0 32.0 2 30.186 32.0 32.0 32.0 21.0 32.0 3 30.14075 32.0 32.0 32.0 21.0 32.0 4 30.232 32.0 32.0 32.0 21.0 32.0 5 30.0655 32.0 32.0 32.0 21.0 32.0 6 33.24225 36.0 36.0 36.0 21.0 36.0 7 33.3095 36.0 36.0 36.0 21.0 36.0 8 33.2325 36.0 36.0 36.0 21.0 36.0 9 33.0095 36.0 36.0 36.0 21.0 36.0 10-11 33.0265 36.0 36.0 36.0 17.5 36.0 12-13 32.87975 36.0 36.0 36.0 14.0 36.0 14-15 32.933125000000004 36.0 36.0 36.0 14.0 36.0 16-17 33.107749999999996 36.0 36.0 36.0 21.0 36.0 18-19 32.9205 36.0 36.0 36.0 17.5 36.0 20-21 32.71025 36.0 36.0 36.0 14.0 36.0 22-23 32.679 36.0 34.0 36.0 17.5 36.0 24-25 32.753125 36.0 36.0 36.0 14.0 36.0 26-27 32.473625 36.0 34.0 36.0 14.0 36.0 28-29 32.491375 36.0 34.0 36.0 14.0 36.0 30-31 32.476 36.0 34.0 36.0 14.0 36.0 32-33 32.336124999999996 36.0 32.0 36.0 14.0 36.0 34-35 32.1555 36.0 32.0 36.0 14.0 36.0 36-37 32.357375000000005 36.0 36.0 36.0 14.0 36.0 38-39 32.18600000000001 36.0 32.0 36.0 14.0 36.0 40-41 31.997 36.0 32.0 36.0 14.0 36.0 42-43 31.984750000000002 36.0 32.0 36.0 14.0 36.0 44-45 31.91875 36.0 32.0 36.0 14.0 36.0 46-47 31.76894223555889 36.0 32.0 36.0 14.0 36.0 48-49 31.77931982995749 36.0 32.0 36.0 14.0 36.0 50-51 31.672793198299573 36.0 32.0 36.0 14.0 36.0 52-53 31.56339084771193 36.0 32.0 36.0 14.0 36.0 54-55 31.211177794448613 36.0 32.0 36.0 14.0 36.0 56-57 30.954995658619506 36.0 32.0 36.0 14.0 36.0 58-59 31.325744308231172 36.0 32.0 36.0 14.0 36.0 60-61 31.080560420315237 36.0 32.0 36.0 14.0 36.0 62-63 30.957191515670864 36.0 29.5 36.0 14.0 36.0 64-65 30.844931163954943 36.0 27.0 36.0 14.0 36.0 66-67 30.707686529794692 36.0 29.5 36.0 14.0 36.0 68-69 30.794823203159012 36.0 27.0 36.0 14.0 36.0 70-71 30.918149912258713 36.0 32.0 36.0 14.0 36.0 72-73 30.76648386736755 36.0 27.0 36.0 14.0 36.0 74-75 30.6250577901557 36.0 27.0 36.0 14.0 36.0 76 28.83548030916452 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 14.0 16 15.0 17 11.0 18 7.0 19 8.0 20 8.0 21 15.0 22 21.0 23 30.0 24 54.0 25 75.0 26 104.0 27 154.0 28 203.0 29 225.0 30 301.0 31 371.0 32 459.0 33 589.0 34 806.0 35 529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.09304652326163 16.208104052026012 13.231615807903951 34.4672336168084 2 32.641320660330166 22.661330665332667 22.611305652826413 22.086043021510758 3 29.225 27.6 19.325 23.849999999999998 4 30.975 30.725 16.950000000000003 21.349999999999998 5 31.21560780390195 31.040520260130066 18.209104552276138 19.534767383691847 6 23.58679339669835 34.44222111055527 20.210105052526263 21.76088044022011 7 24.05 18.5 31.225 26.224999999999998 8 27.474999999999998 21.475 23.075000000000003 27.975 9 25.6 23.1 25.45 25.85 10-11 27.51937984496124 26.744186046511626 20.10502625656414 25.63140785196299 12-13 28.4125 22.3125 22.8125 26.4625 14-15 26.424999999999997 23.962500000000002 23.8875 25.724999999999998 16-17 27.675 23.200000000000003 22.3875 26.737499999999997 18-19 26.5625 24.462500000000002 23.025000000000002 25.95 20-21 26.887499999999996 24.1375 23.3875 25.587500000000002 22-23 27.737499999999997 24.1625 22.55 25.55 24-25 27.97648824412206 23.874437218609305 22.861430715357677 25.287643821910955 26-27 27.224999999999998 24.6125 22.2 25.9625 28-29 27.6125 24.525 22.225 25.637500000000003 30-31 25.85 24.575 23.3375 26.237500000000004 32-33 26.474999999999998 25.025 23.150000000000002 25.35 34-35 27.625 23.3375 23.4875 25.55 36-37 26.344086021505376 24.60615153788447 22.518129532383096 26.531632908227053 38-39 26.737499999999997 24.25 23.0125 26.0 40-41 28.225 23.9375 23.275000000000002 24.5625 42-43 27.250000000000004 24.15 23.025000000000002 25.575 44-45 27.224999999999998 24.0 23.4375 25.337500000000002 46-47 26.806701675418854 23.78094523630908 22.818204551137786 26.59414853713428 48-49 27.094273568392097 23.605901475368842 24.081020255063766 25.218804701175294 50-51 26.669167291822955 24.10602650662666 22.95573893473368 26.269067266816705 52-53 27.84446111527882 24.468617154288573 22.493123280820203 25.1937984496124 54-55 27.24431107776944 24.081020255063766 23.243310827706924 25.431357839459867 56-57 26.73502563461298 24.98436913842691 23.308740777791673 24.97186444916844 58-59 28.896672504378284 22.904678508881663 22.516887665749312 25.68176132099074 60-61 27.014514514514516 24.762262262262265 22.74774774774775 25.475475475475474 62-63 27.881366537354523 24.102114879239146 23.388812413965713 24.62770616944062 64-65 27.98498122653317 23.9549436795995 21.989987484355446 26.070087609511887 66-67 26.53980971457186 24.962443665498245 23.234852278417627 25.262894341512272 68-69 27.50845546786922 24.74007265439058 23.149192033070275 24.602279844669926 70-71 27.212333918275256 24.066182000501378 22.273752820255705 26.44773126096766 72-73 26.82619647355164 23.299748110831235 24.130982367758186 25.743073047858942 74-75 27.449673376883084 21.263831489134784 24.263431542461007 27.02306359152113 76 30.474788369525214 0.0 30.916451969083546 38.60875966139124 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 2.5 24 8.5 25 12.0 26 10.0 27 12.5 28 15.0 29 12.5 30 11.5 31 18.0 32 27.5 33 34.5 34 39.5 35 51.0 36 70.0 37 89.5 38 108.5 39 120.0 40 127.5 41 144.5 42 159.0 43 167.0 44 187.5 45 183.0 46 166.5 47 174.0 48 171.5 49 165.5 50 166.0 51 159.0 52 149.0 53 141.0 54 134.5 55 128.5 56 115.5 57 117.0 58 125.5 59 128.0 60 133.5 61 136.5 62 140.0 63 130.5 64 114.0 65 107.0 66 104.5 67 101.5 68 95.0 69 86.5 70 83.0 71 82.0 72 73.0 73 60.5 74 44.5 75 29.5 76 26.5 77 25.5 78 17.5 79 13.5 80 14.0 81 9.0 82 4.0 83 2.0 84 3.0 85 4.5 86 2.5 87 0.0 88 0.5 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 2.5 99 7.5 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.0 4 0.0 5 0.05 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.05 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.02501876407305479 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 1.0 63 0.0 64 0.0 65 1.0 66 0.0 67 2.0 68 1.0 69 2.0 70 0.0 71 10.0 72 18.0 73 70.0 74 281.0 75 893.0 76 2717.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67583396995163 96.875 2 1.0949834479246243 2.15 3 0.15278838808250572 0.44999999999999996 4 0.025464731347084286 0.1 5 0.025464731347084286 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025464731347084286 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534207 spots for SRR11389855.sra Written 534207 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra Read 534192 spots for SRR11389855.sra Written 534192 spots for SRR11389855.sra SRR ids: ['SRR11389855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_otf4d3tn SRR11389855.sra spots: 10683855 blocks: [[1, 534192], [534193, 1068384], [1068385, 1602576], [1602577, 2136768], [2136769, 2670960], [2670961, 3205152], [3205153, 3739344], [3739345, 4273536], [4273537, 4807728], [4807729, 5341920], [5341921, 5876112], [5876113, 6410304], [6410305, 6944496], [6944497, 7478688], [7478689, 8012880], [8012881, 8547072], [8547073, 9081264], [9081265, 9615456], [9615457, 10149648], [10149649, 10683855]] SRR11389855 file size 2024066 SRR11389855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389855 SRR11389855_1.fastq SRR11389855_2.fastq Input file: SRR11389855_1.fastq Paired file: SRR11389855_2.fastq trimmed: SRR11389855-trimmed-pair1.fastq, SRR11389855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:16:29 2024 >> started Sat Dec 7 08:16:38 2024 >> done (9.136s) 10683855 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 33111 ( 0.31%) empty read pairs filtered out after trimming by size control 10650740 (99.69%) read pairs available; of these: 6079 ( 0.06%) trimmed read pairs available after processing 10644661 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 78 0.00% 36 84 0.00% 37 103 0.00% 38 123 0.00% 39 163 0.00% 40 169 0.00% 41 198 0.00% 42 256 0.00% 43 261 0.00% 44 284 0.00% 45 322 0.00% 46 373 0.00% 47 409 0.00% 48 435 0.00% 49 480 0.00% 50 496 0.00% 51 541 0.01% 52 616 0.01% 53 684 0.01% 54 710 0.01% 55 817 0.01% 56 932 0.01% 57 1121 0.01% 58 1105 0.01% 59 1252 0.01% 60 1235 0.01% 61 1358 0.01% 62 1405 0.01% 63 1594 0.01% 64 1608 0.02% 65 1815 0.02% 66 1953 0.02% 67 2208 0.02% 68 2293 0.02% 69 2496 0.02% 70 3011 0.03% 71 3921 0.04% 72 10545 0.10% 73 85026 0.80% 74 701996 6.59% 75 4631293 43.48% 76 5184963 48.68% 10650740 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=24 fanout-score=36.81 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=10.3 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.41 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=7.67 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.0 sequence=CACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCA SRR11389855 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:17:35 Started mapping on | Dec 07 08:17:35 Finished on | Dec 07 08:18:28 Mapping speed, Million of reads per hour | 723.45 Number of input reads | 10650740 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 9269294 Uniquely mapped reads % | 87.03% Average mapped length | 150.10 Number of splices: Total | 3932311 Number of splices: Annotated (sjdb) | 3775473 Number of splices: GT/AG | 3881416 Number of splices: GC/AG | 44929 Number of splices: AT/AC | 1001 Number of splices: Non-canonical | 4965 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 718218 % of reads mapped to multiple loci | 6.74% Number of reads mapped to too many loci | 18749 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.32% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 663228 663228 663228 N_multimapping 718218 718218 718218 N_noFeature 252396 9048536 311516 N_ambiguous 211914 802 53470 UnstrandedReadsAssigned:8804984 PositiveStrandReadsAssigned:219956 NegativeStrandReadsAssigned:8904308 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389855-trimmed-pair1.fastq SRR11389855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,650,740 reads, 9,667,833 reads pseudoaligned [quant] estimated average fragment length: 206.47 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52973 SRR11389855.ke.tsv 35125 SRR11389855.se.tsv 88098 total ==> SRR11389855.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 730.722 0 0 PNS24247 1044 838.53 10.0578 1.61173 PNS24249 1928 1722.53 58.9443 4.59817 PNS24246 1044 838.53 10.0578 1.61173 PNS24248 1044 838.53 10.0578 1.61173 PNS24244 1471 1265.53 12.8824 1.36784 PNS24243 293 106.683 0 0 KQK14069 1603 1397.53 534.068 51.3506 KQK14071 474 271.176 50.8634 25.2037 ==> SRR11389855.se.tsv <== BRADI_1g14170v3 643 BRADI_1g53295v3 3 BRADI_1g59795v3 308 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 89 BRADI_1g74790v3 27 BRADI_1g09890v3 0 BRADI_1g77505v3 106 BRADI_1g48960v3 0 SRR11389855 completed mapping pipeline successfully