Starting /dee2/code/volunteer_pipeline.sh SRR11389856 current disk space = 1544468447232 free memory = 1417595372 SRR11389856 SRAfilesize 318b1c400f264e2ba1a512f45b43d064 SRR11389856.sra SRR11389856.sra file validated SRR11389856 is paired end SRR11389856 is conventional basespace SRR11389856 read1 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.04575 32.0 32.0 32.0 32.0 32.0 2 31.1045 32.0 32.0 32.0 32.0 32.0 3 31.045 32.0 32.0 32.0 32.0 32.0 4 30.99225 32.0 32.0 32.0 32.0 32.0 5 31.07225 32.0 32.0 32.0 32.0 32.0 6 33.88225 36.0 36.0 36.0 32.0 36.0 7 33.73675 36.0 36.0 36.0 32.0 36.0 8 33.8025 36.0 36.0 36.0 32.0 36.0 9 33.82875 36.0 36.0 36.0 32.0 36.0 10-11 33.698750000000004 36.0 36.0 36.0 32.0 36.0 12-13 33.878375 36.0 36.0 36.0 32.0 36.0 14-15 33.870125 36.0 36.0 36.0 32.0 36.0 16-17 33.7335 36.0 36.0 36.0 32.0 36.0 18-19 33.704625 36.0 36.0 36.0 32.0 36.0 20-21 33.723 36.0 36.0 36.0 29.5 36.0 22-23 33.55675 36.0 36.0 36.0 27.0 36.0 24-25 33.3905 36.0 36.0 36.0 27.0 36.0 26-27 33.310625 36.0 36.0 36.0 21.0 36.0 28-29 33.350125000000006 36.0 36.0 36.0 24.0 36.0 30-31 33.289125 36.0 36.0 36.0 21.0 36.0 32-33 33.0415 36.0 36.0 36.0 17.5 36.0 34-35 33.071250000000006 36.0 36.0 36.0 14.0 36.0 36-37 33.00425 36.0 36.0 36.0 14.0 36.0 38-39 33.098124999999996 36.0 36.0 36.0 14.0 36.0 40-41 32.831999999999994 36.0 36.0 36.0 14.0 36.0 42-43 32.82475 36.0 36.0 36.0 14.0 36.0 44-45 32.848625 36.0 36.0 36.0 14.0 36.0 46-47 32.42079513628407 36.0 32.0 36.0 14.0 36.0 48-49 32.40935233808452 36.0 32.0 36.0 14.0 36.0 50-51 32.31387952666006 36.0 32.0 36.0 14.0 36.0 52-53 32.08679339669835 36.0 32.0 36.0 14.0 36.0 54-55 32.18488866649987 36.0 32.0 36.0 14.0 36.0 56-57 31.96509009009009 36.0 32.0 36.0 14.0 36.0 58-59 31.647474476980108 36.0 32.0 36.0 14.0 36.0 60-61 31.818102153229844 36.0 32.0 36.0 14.0 36.0 62-63 31.7137490608565 36.0 32.0 36.0 14.0 36.0 64-65 31.407337841222137 36.0 32.0 36.0 14.0 36.0 66-67 31.441633266533067 36.0 32.0 36.0 14.0 36.0 68-69 31.58671679197995 36.0 32.0 36.0 14.0 36.0 70-71 31.44810408262945 36.0 32.0 36.0 14.0 36.0 72-73 31.364121630206228 36.0 32.0 36.0 14.0 36.0 74-75 31.31126133201905 36.0 32.0 36.0 14.0 36.0 76 29.727535185853483 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 5.0 23 10.0 24 20.0 25 44.0 26 70.0 27 104.0 28 172.0 29 235.0 30 309.0 31 375.0 32 455.0 33 664.0 34 910.0 35 623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.525 8.774999999999999 14.149999999999999 30.55 2 28.875 11.05 28.325 31.75 3 29.625 16.875 20.575 32.925 4 32.45 22.925 19.275000000000002 25.35 5 29.75 26.525 22.1 21.625 6 24.275 30.2 24.7 20.825 7 17.599999999999998 25.900000000000002 35.4 21.099999999999998 8 20.424999999999997 23.549999999999997 30.775000000000002 25.25 9 19.6 21.725 32.1 26.575 10-11 23.5 28.799999999999997 23.2875 24.4125 12-13 24.85 24.75 24.837500000000002 25.5625 14-15 24.2 25.637500000000003 25.5 24.6625 16-17 23.974999999999998 24.625 25.412499999999998 25.9875 18-19 23.8375 24.5125 24.762500000000003 26.887499999999996 20-21 24.9875 25.525 23.724999999999998 25.7625 22-23 23.6125 24.9375 25.0 26.450000000000003 24-25 24.95 24.587500000000002 24.5125 25.95 26-27 24.337500000000002 25.15 24.762500000000003 25.75 28-29 24.0125 24.5125 24.762500000000003 26.7125 30-31 24.2875 25.900000000000002 23.7625 26.05 32-33 25.15 24.7 24.637500000000003 25.5125 34-35 24.474999999999998 24.85 24.95 25.724999999999998 36-37 24.4875 25.4875 24.474999999999998 25.55 38-39 24.4375 24.125 24.55 26.887499999999996 40-41 24.45 25.0375 24.175 26.337500000000002 42-43 23.3875 25.525 24.3875 26.700000000000003 44-45 25.525 25.124999999999996 23.7125 25.637500000000003 46-47 24.115514439304913 25.778222277784725 23.8404800600075 26.26578322290286 48-49 24.268567141785446 25.03125781445361 24.01850462615654 26.6816704176044 50-51 24.484181568088033 24.809303488808304 24.534200325121923 26.172314617981744 52-53 25.125062531265634 24.937468734367183 23.724362181090545 26.21310655327664 54-55 23.942957217913435 24.580935701776333 25.21891418563923 26.257192894671004 56-57 24.83733733733734 24.1991991991992 24.174174174174173 26.789289289289293 58-59 24.21474158428232 23.864347390814665 25.115755224627705 26.80515580027531 60-61 25.062593890836254 23.798197295943915 25.17526289434151 25.963945918878316 62-63 24.430252942649634 25.39444027047333 24.079639368895567 26.095667417981467 64-65 24.9686952166291 24.355121462559477 24.380165289256198 26.296018031555224 66-67 24.09819639278557 24.649298597194388 24.273547094188377 26.978957915831664 68-69 25.012531328320804 23.92230576441103 24.348370927318296 26.71679197994987 70-71 25.10969035978438 23.22928419205215 24.52049642722828 27.14052902093519 72-73 24.298830335806816 23.896365237077095 24.902527983901397 26.90227644321469 74-75 24.858608444035248 21.18900434039195 25.858213862948837 28.09417335262396 76 27.174305304944063 0.0 35.47455792132804 37.351136773727895 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 4.5 22 5.0 23 6.0 24 5.0 25 4.0 26 7.0 27 11.0 28 12.0 29 11.5 30 14.0 31 21.5 32 32.5 33 35.5 34 43.5 35 65.0 36 83.0 37 96.0 38 106.0 39 128.0 40 149.0 41 164.5 42 181.0 43 193.5 44 220.5 45 219.5 46 204.5 47 210.5 48 195.0 49 176.5 50 167.5 51 148.5 52 131.5 53 126.5 54 123.5 55 123.0 56 117.5 57 116.5 58 128.0 59 141.0 60 138.0 61 131.5 62 133.0 63 109.0 64 98.0 65 94.5 66 75.5 67 71.0 68 73.0 69 71.0 70 57.5 71 46.0 72 44.5 73 34.5 74 26.5 75 27.0 76 27.5 77 21.0 78 12.5 79 10.0 80 7.5 81 7.0 82 5.0 83 3.0 84 3.0 85 1.0 86 0.5 87 1.5 88 2.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 2.0 68 0.0 69 0.0 70 3.0 71 3.0 72 17.0 73 51.0 74 229.0 75 916.0 76 2771.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18414322250639 95.975 2 1.4578005115089514 2.85 3 0.2557544757033248 0.75 4 0.07672634271099744 0.3 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389856 read2 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52325 32.0 32.0 32.0 27.0 32.0 2 30.30625 32.0 32.0 32.0 21.0 32.0 3 30.17525 32.0 32.0 32.0 21.0 32.0 4 30.18675 32.0 32.0 32.0 21.0 32.0 5 30.2375 32.0 32.0 32.0 21.0 32.0 6 33.4015 36.0 36.0 36.0 21.0 36.0 7 33.28625 36.0 36.0 36.0 21.0 36.0 8 33.21625 36.0 36.0 36.0 21.0 36.0 9 33.21325 36.0 36.0 36.0 21.0 36.0 10-11 33.1375 36.0 36.0 36.0 17.5 36.0 12-13 33.0405 36.0 36.0 36.0 14.0 36.0 14-15 33.02025 36.0 36.0 36.0 17.5 36.0 16-17 33.01875 36.0 36.0 36.0 21.0 36.0 18-19 33.039625 36.0 36.0 36.0 21.0 36.0 20-21 32.80325 36.0 36.0 36.0 14.0 36.0 22-23 32.868875 36.0 36.0 36.0 17.5 36.0 24-25 32.689750000000004 36.0 36.0 36.0 14.0 36.0 26-27 32.741375000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.564375 36.0 34.0 36.0 14.0 36.0 30-31 32.428375 36.0 34.0 36.0 14.0 36.0 32-33 32.42675 36.0 32.0 36.0 14.0 36.0 34-35 32.342875 36.0 34.0 36.0 14.0 36.0 36-37 32.22324999999999 36.0 32.0 36.0 14.0 36.0 38-39 32.252250000000004 36.0 32.0 36.0 14.0 36.0 40-41 31.987499999999997 36.0 32.0 36.0 14.0 36.0 42-43 31.899625 36.0 32.0 36.0 14.0 36.0 44-45 31.779625 36.0 32.0 36.0 14.0 36.0 46-47 31.893619779944984 36.0 32.0 36.0 14.0 36.0 48-49 31.72905726431608 36.0 32.0 36.0 14.0 36.0 50-51 31.68029507376844 36.0 32.0 36.0 14.0 36.0 52-53 31.51350337584396 36.0 32.0 36.0 14.0 36.0 54-55 31.18584292146073 36.0 32.0 36.0 14.0 36.0 56-57 30.903177383037278 36.0 32.0 36.0 14.0 36.0 58-59 31.236214855085258 36.0 32.0 36.0 14.0 36.0 60-61 31.008760951188986 36.0 32.0 36.0 14.0 36.0 62-63 31.031797696544817 36.0 32.0 36.0 14.0 36.0 64-65 30.81347020530796 36.0 29.5 36.0 14.0 36.0 66-67 31.005760080140245 36.0 29.5 36.0 14.0 36.0 68-69 30.783137058381357 36.0 29.5 36.0 14.0 36.0 70-71 30.665116277170274 36.0 27.0 36.0 14.0 36.0 72-73 30.550198145578143 36.0 27.0 36.0 14.0 36.0 74-75 30.37032443049353 36.0 27.0 36.0 14.0 36.0 76 28.67152221412964 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 10.0 16 8.0 17 7.0 18 11.0 19 10.0 20 12.0 21 15.0 22 9.0 23 30.0 24 51.0 25 71.0 26 103.0 27 149.0 28 179.0 29 261.0 30 318.0 31 375.0 32 487.0 33 658.0 34 764.0 35 470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.075 16.475 12.85 34.599999999999994 2 31.674999999999997 24.45 22.425 21.45 3 28.999999999999996 26.825 18.65 25.525 4 30.3 31.4 16.35 21.95 5 30.349999999999998 30.175 18.55 20.925 6 23.974999999999998 34.375 19.975 21.675 7 23.925 17.825 30.625000000000004 27.625 8 26.3 23.575 22.1 28.025 9 24.6 21.8 26.5 27.1 10-11 27.737499999999997 26.424999999999997 19.8 26.0375 12-13 27.500000000000004 21.987499999999997 23.3375 27.175 14-15 26.5625 24.0375 23.474999999999998 25.924999999999997 16-17 28.025 23.599999999999998 22.55 25.825 18-19 25.924999999999997 23.8875 22.8125 27.375 20-21 26.9125 25.3 22.7 25.087500000000002 22-23 28.0625 24.224999999999998 22.7 25.0125 24-25 27.0625 25.087500000000002 22.375 25.474999999999998 26-27 27.3125 23.4375 23.325000000000003 25.924999999999997 28-29 27.150000000000002 24.1125 23.150000000000002 25.587500000000002 30-31 25.874999999999996 24.637500000000003 22.9625 26.525 32-33 25.9625 25.9875 23.2875 24.762500000000003 34-35 27.1625 24.2875 22.6 25.95 36-37 26.5 24.65 23.6125 25.2375 38-39 26.4625 24.337500000000002 23.45 25.75 40-41 27.3625 24.675 22.7375 25.224999999999998 42-43 26.087500000000002 24.025 23.7875 26.1 44-45 26.5 24.625 23.225 25.650000000000002 46-47 27.140892611576444 25.19064883110389 22.177772221527693 25.490686335791974 48-49 26.63165791447862 24.681170292573142 22.593148287071767 26.094023505876468 50-51 27.04426106526632 24.3935983995999 23.20580145036259 25.35633908477119 52-53 26.669167291822955 25.256314078519633 21.605401350337583 26.469117279319832 54-55 27.463731865932967 23.58679339669835 22.923961980990494 26.025512756378188 56-57 26.444833625218916 25.106329747310486 23.605203902927197 24.843632724543408 58-59 26.635806330539225 24.10859502064306 23.64568997873139 25.609908670086323 60-61 26.633291614518146 24.080100125156445 22.665832290362953 26.62077596996245 62-63 26.577366049073607 24.161241862794192 23.059589384076116 26.20180270405608 64-65 26.902854281422133 25.375563345017525 21.156735102653982 26.564847270906363 66-67 26.73428499874781 24.117205108940645 22.71475081392437 26.433759078387176 68-69 26.910548734652966 25.056376847907792 23.352543222250063 24.680531195189175 70-71 26.757739065045744 24.26369219200401 22.947737811755857 26.030830931194387 72-73 26.553459119496853 23.69811320754717 23.88679245283019 25.861635220125784 74-75 26.937907193192395 20.808403137880603 25.70136949873687 26.552320170190136 76 29.20611798980335 0.0 33.1755280407866 37.61835396941005 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 4.0 20 4.0 21 3.0 22 2.0 23 1.0 24 1.5 25 4.5 26 7.0 27 10.0 28 8.5 29 6.0 30 10.0 31 17.0 32 25.5 33 31.5 34 37.0 35 53.0 36 81.0 37 100.5 38 113.0 39 124.0 40 129.5 41 154.0 42 166.5 43 163.0 44 178.0 45 182.0 46 175.5 47 178.0 48 176.5 49 152.5 50 135.5 51 138.0 52 127.0 53 118.5 54 129.0 55 127.5 56 129.5 57 141.0 58 140.0 59 152.0 60 170.5 61 158.5 62 143.5 63 132.5 64 106.5 65 93.5 66 100.0 67 106.0 68 98.5 69 86.0 70 72.5 71 68.0 72 71.0 73 55.0 74 36.0 75 34.0 76 28.5 77 21.5 78 20.0 79 18.5 80 11.5 81 8.5 82 8.5 83 4.5 84 4.0 85 2.0 86 1.5 87 3.0 88 2.5 89 1.0 90 0.5 91 0.5 92 0.0 93 1.0 94 2.0 95 1.5 96 1.0 97 0.5 98 0.5 99 4.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 2.0 68 0.0 69 0.0 70 3.0 71 2.0 72 22.0 73 81.0 74 245.0 75 892.0 76 2746.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18414322250639 95.975 2 1.5089514066496164 2.9499999999999997 3 0.2557544757033248 0.75 4 0.025575447570332477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025575447570332477 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657656 spots for SRR11389856.sra Written 657656 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra Read 657646 spots for SRR11389856.sra Written 657646 spots for SRR11389856.sra SRR ids: ['SRR11389856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f6g05tq6 SRR11389856.sra spots: 13152930 blocks: [[1, 657646], [657647, 1315292], [1315293, 1972938], [1972939, 2630584], [2630585, 3288230], [3288231, 3945876], [3945877, 4603522], [4603523, 5261168], [5261169, 5918814], [5918815, 6576460], [6576461, 7234106], [7234107, 7891752], [7891753, 8549398], [8549399, 9207044], [9207045, 9864690], [9864691, 10522336], [10522337, 11179982], [11179983, 11837628], [11837629, 12495274], [12495275, 13152930]] SRR11389856 file size 2496237 SRR11389856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389856 SRR11389856_1.fastq SRR11389856_2.fastq Input file: SRR11389856_1.fastq Paired file: SRR11389856_2.fastq trimmed: SRR11389856-trimmed-pair1.fastq, SRR11389856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:18:51 2024 >> started Sat Dec 7 08:19:54 2024 >> done (62.544s) 13152930 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 36797 ( 0.28%) empty read pairs filtered out after trimming by size control 13116131 (99.72%) read pairs available; of these: 9504 ( 0.07%) trimmed read pairs available after processing 13106627 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 1 0.00% 33 2 0.00% 34 8 0.00% 35 149 0.00% 36 174 0.00% 37 174 0.00% 38 201 0.00% 39 256 0.00% 40 274 0.00% 41 342 0.00% 42 402 0.00% 43 473 0.00% 44 457 0.00% 45 566 0.00% 46 604 0.00% 47 672 0.01% 48 747 0.01% 49 818 0.01% 50 910 0.01% 51 1023 0.01% 52 1122 0.01% 53 1255 0.01% 54 1353 0.01% 55 1569 0.01% 56 1682 0.01% 57 1885 0.01% 58 2129 0.02% 59 2156 0.02% 60 2461 0.02% 61 2466 0.02% 62 2683 0.02% 63 2916 0.02% 64 3235 0.02% 65 3466 0.03% 66 3729 0.03% 67 4240 0.03% 68 4233 0.03% 69 4831 0.04% 70 5347 0.04% 71 6762 0.05% 72 15331 0.12% 73 108376 0.83% 74 866763 6.61% 75 5714510 43.57% 76 6343363 48.36% 13116131 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.75 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=23.10 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=16 prefix-density=0.75 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.17 sequence-density-rank=28 fanout-score=5.39 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.7 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR11389856 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:23:13 Started mapping on | Dec 07 08:23:14 Finished on | Dec 07 08:31:53 Mapping speed, Million of reads per hour | 90.98 Number of input reads | 13116131 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11284410 Uniquely mapped reads % | 86.03% Average mapped length | 150.07 Number of splices: Total | 4848784 Number of splices: Annotated (sjdb) | 4653603 Number of splices: GT/AG | 4786506 Number of splices: GC/AG | 55136 Number of splices: AT/AC | 1297 Number of splices: Non-canonical | 5845 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1034305 % of reads mapped to multiple loci | 7.89% Number of reads mapped to too many loci | 14075 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 797416 797416 797416 N_multimapping 1034305 1034305 1034305 N_noFeature 301437 11017558 368554 N_ambiguous 275489 1043 80641 UnstrandedReadsAssigned:10707484 PositiveStrandReadsAssigned:265809 NegativeStrandReadsAssigned:10835215 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389856-trimmed-pair1.fastq SRR11389856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,116,131 reads, 11,964,113 reads pseudoaligned [quant] estimated average fragment length: 207.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52973 SRR11389856.ke.tsv 35125 SRR11389856.se.tsv 88098 total ==> SRR11389856.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.331 0 0 PNS24247 1044 837.205 13.7247 1.7744 PNS24249 1928 1721.2 50.4993 3.17565 PNS24246 1044 837.205 13.7247 1.7744 PNS24248 1044 837.205 13.7247 1.7744 PNS24244 1471 1264.2 10.3265 0.88413 PNS24243 293 105.863 0 0 KQK14069 1603 1396.2 1028.24 79.7121 KQK14071 474 269.655 62.0468 24.9052 ==> SRR11389856.se.tsv <== BRADI_1g14170v3 1145 BRADI_1g53295v3 8 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 91 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 121 BRADI_1g48960v3 0 SRR11389856 completed mapping pipeline successfully