Starting /dee2/code/volunteer_pipeline.sh SRR11389857 current disk space = 1544469450752 free memory = 1600391628 SRR11389857 SRAfilesize 50cfd445aeb864e391d7d23099132327 SRR11389857.sra SRR11389857.sra file validated SRR11389857 is paired end SRR11389857 is conventional basespace SRR11389857 read1 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0265 32.0 32.0 32.0 32.0 32.0 2 31.158 32.0 32.0 32.0 32.0 32.0 3 31.023 32.0 32.0 32.0 32.0 32.0 4 31.223 32.0 32.0 32.0 32.0 32.0 5 31.12875 32.0 32.0 32.0 32.0 32.0 6 34.124 36.0 36.0 36.0 32.0 36.0 7 34.04925 36.0 36.0 36.0 32.0 36.0 8 34.00275 36.0 36.0 36.0 32.0 36.0 9 33.779 36.0 36.0 36.0 32.0 36.0 10-11 34.032250000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.045375 36.0 36.0 36.0 32.0 36.0 14-15 33.939375 36.0 36.0 36.0 32.0 36.0 16-17 33.937250000000006 36.0 36.0 36.0 32.0 36.0 18-19 33.89125 36.0 36.0 36.0 32.0 36.0 20-21 33.762125 36.0 36.0 36.0 32.0 36.0 22-23 33.65375 36.0 36.0 36.0 27.0 36.0 24-25 33.477125 36.0 36.0 36.0 27.0 36.0 26-27 33.486000000000004 36.0 36.0 36.0 27.0 36.0 28-29 33.3165 36.0 36.0 36.0 21.0 36.0 30-31 33.29075 36.0 36.0 36.0 21.0 36.0 32-33 33.192625 36.0 36.0 36.0 20.5 36.0 34-35 33.091499999999996 36.0 36.0 36.0 14.0 36.0 36-37 33.03675 36.0 36.0 36.0 17.5 36.0 38-39 33.103625 36.0 36.0 36.0 14.0 36.0 40-41 33.062375 36.0 36.0 36.0 17.5 36.0 42-43 32.882625 36.0 36.0 36.0 17.5 36.0 44-45 32.98025 36.0 36.0 36.0 14.0 36.0 46-47 32.54075 36.0 32.0 36.0 14.0 36.0 48-49 32.58475 36.0 32.0 36.0 14.0 36.0 50-51 32.49205723305826 36.0 32.0 36.0 14.0 36.0 52-53 32.285321330332586 36.0 32.0 36.0 14.0 36.0 54-55 32.22030507626907 36.0 32.0 36.0 14.0 36.0 56-57 31.988872218054514 36.0 32.0 36.0 14.0 36.0 58-59 31.996998499249624 36.0 32.0 36.0 14.0 36.0 60-61 32.15510047367942 36.0 32.0 36.0 14.0 36.0 62-63 31.87403052289217 36.0 32.0 36.0 14.0 36.0 64-65 31.709980276749103 36.0 32.0 36.0 14.0 36.0 66-67 31.54336410878964 36.0 32.0 36.0 14.0 36.0 68-69 31.723153942428034 36.0 32.0 36.0 14.0 36.0 70-71 31.697629589889466 36.0 32.0 36.0 14.0 36.0 72-73 31.48398700701957 36.0 32.0 36.0 14.0 36.0 74-75 31.532316992487704 36.0 32.0 36.0 14.0 36.0 76 29.9490095377843 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 10.0 24 22.0 25 38.0 26 65.0 27 115.0 28 143.0 29 206.0 30 270.0 31 400.0 32 456.0 33 618.0 34 923.0 35 727.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.175 8.05 14.674999999999999 33.1 2 29.725 11.1 28.125 31.05 3 28.525 15.475 20.95 35.05 4 31.324999999999996 22.675 20.375 25.624999999999996 5 28.1 25.45 22.975 23.474999999999998 6 24.775 29.725 24.5 21.0 7 17.125 26.075 34.2 22.6 8 20.674999999999997 24.2 30.375000000000004 24.75 9 20.325 21.55 32.375 25.75 10-11 22.8625 28.749999999999996 24.3625 24.025 12-13 24.5375 23.8375 25.724999999999998 25.900000000000002 14-15 23.724999999999998 24.6125 25.5625 26.1 16-17 23.525 25.974999999999998 24.625 25.874999999999996 18-19 24.587500000000002 25.2125 24.9375 25.2625 20-21 23.799999999999997 25.575 24.8125 25.8125 22-23 25.025 24.575 24.9375 25.4625 24-25 24.55 24.6 24.7375 26.1125 26-27 24.425 24.6625 24.7875 26.125 28-29 24.4 24.1375 24.85 26.6125 30-31 23.425 25.275 24.75 26.55 32-33 23.775 25.2875 25.0 25.937500000000004 34-35 24.2875 24.725 25.5 25.4875 36-37 24.3875 25.2 25.324999999999996 25.087500000000002 38-39 24.775 25.2 24.375 25.650000000000002 40-41 24.025 24.9 24.7 26.375 42-43 24.6 24.337500000000002 24.95 26.1125 44-45 24.275 24.775 24.4 26.55 46-47 24.125 24.712500000000002 24.4875 26.674999999999997 48-49 24.2375 24.325 24.837500000000002 26.6 50-51 23.40292536567071 24.315539442430303 24.90311288911114 27.378422302787847 52-53 24.33108277069267 24.356089022255563 25.018754688672168 26.294073518379594 54-55 23.99349837459365 24.356089022255563 24.3935983995999 27.25681420355089 56-57 23.918479619904975 24.781195298824706 24.88122030507627 26.419104776194047 58-59 25.03751875937969 24.712356178089045 24.287143571785894 25.962981490745374 60-61 25.14071294559099 24.377736085053158 24.92808005003127 25.553470919324578 62-63 24.243182386790092 24.818613960470355 23.90542907180385 27.032774580935705 64-65 25.43475541098461 23.78331039659702 25.42224446390592 25.359689728512446 66-67 25.328494556375926 24.32736828932549 24.577649856088097 25.76648729821049 68-69 24.730913642052567 23.779724655819777 24.11764705882353 27.37171464330413 70-71 24.852885939651934 25.003130086390385 24.214348316013524 25.92963565794416 72-73 25.64360165766671 24.425467788521914 24.073841517016202 25.857089036795177 74-75 25.49800796812749 20.42496679946879 25.830013280212484 28.247011952191237 76 28.46661775495231 0.0 33.52898019075569 38.004402054292 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.5 2 1.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.5 19 3.0 20 2.5 21 4.0 22 4.5 23 3.0 24 4.0 25 6.0 26 7.0 27 11.0 28 12.5 29 11.5 30 16.5 31 26.0 32 28.0 33 22.5 34 38.0 35 63.0 36 72.5 37 80.0 38 101.0 39 141.5 40 155.0 41 175.5 42 204.0 43 213.5 44 224.5 45 217.0 46 212.5 47 198.5 48 181.5 49 168.5 50 158.0 51 169.5 52 161.0 53 135.5 54 128.0 55 129.0 56 128.0 57 132.0 58 142.0 59 134.5 60 123.5 61 121.5 62 118.0 63 107.0 64 91.0 65 84.0 66 71.0 67 59.0 68 59.5 69 55.5 70 53.0 71 50.5 72 47.0 73 38.5 74 30.5 75 28.5 76 25.5 77 22.0 78 15.0 79 11.0 80 10.5 81 7.0 82 4.0 83 4.0 84 3.5 85 2.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 2.0 72 19.0 73 65.0 74 284.0 75 897.0 76 2726.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 97.73837059881778 95.075 2 1.953225391930095 3.8 3 0.1285016705217168 0.375 4 0.1285016705217168 0.5 5 0.05140066820868672 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389857 read2 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6835 32.0 32.0 32.0 32.0 32.0 2 30.4385 32.0 32.0 32.0 32.0 32.0 3 30.36325 32.0 32.0 32.0 21.0 32.0 4 30.44625 32.0 32.0 32.0 27.0 32.0 5 30.42525 32.0 32.0 32.0 27.0 32.0 6 33.41875 36.0 36.0 36.0 21.0 36.0 7 33.63925 36.0 36.0 36.0 32.0 36.0 8 33.32875 36.0 36.0 36.0 21.0 36.0 9 33.219 36.0 36.0 36.0 21.0 36.0 10-11 33.168499999999995 36.0 36.0 36.0 21.0 36.0 12-13 33.192875 36.0 36.0 36.0 21.0 36.0 14-15 33.265125 36.0 36.0 36.0 21.0 36.0 16-17 33.29425 36.0 36.0 36.0 21.0 36.0 18-19 33.177125000000004 36.0 36.0 36.0 21.0 36.0 20-21 32.828 36.0 36.0 36.0 14.0 36.0 22-23 32.991 36.0 36.0 36.0 17.5 36.0 24-25 32.85975 36.0 36.0 36.0 14.0 36.0 26-27 32.753375000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.854875 36.0 36.0 36.0 14.0 36.0 30-31 32.65075 36.0 34.0 36.0 14.0 36.0 32-33 32.73025 36.0 36.0 36.0 14.0 36.0 34-35 32.6835 36.0 36.0 36.0 14.0 36.0 36-37 32.676125 36.0 36.0 36.0 14.0 36.0 38-39 32.468 36.0 34.0 36.0 14.0 36.0 40-41 32.024125 36.0 32.0 36.0 14.0 36.0 42-43 32.040125 36.0 32.0 36.0 14.0 36.0 44-45 32.049499999999995 36.0 32.0 36.0 14.0 36.0 46-47 32.036874999999995 36.0 32.0 36.0 14.0 36.0 48-49 32.025375 36.0 32.0 36.0 14.0 36.0 50-51 31.889224837459366 36.0 32.0 36.0 14.0 36.0 52-53 31.692048012003 36.0 32.0 36.0 14.0 36.0 54-55 31.57639409852463 36.0 32.0 36.0 14.0 36.0 56-57 31.22118029507377 36.0 32.0 36.0 14.0 36.0 58-59 31.413331665832917 36.0 32.0 36.0 14.0 36.0 60-61 31.26028754307101 36.0 32.0 36.0 14.0 36.0 62-63 31.265824368276206 36.0 32.0 36.0 14.0 36.0 64-65 30.918427809846374 36.0 29.5 36.0 14.0 36.0 66-67 30.962210051102417 36.0 32.0 36.0 14.0 36.0 68-69 31.014893617021276 36.0 32.0 36.0 14.0 36.0 70-71 31.011388479058525 36.0 32.0 36.0 14.0 36.0 72-73 30.8655535077108 36.0 29.5 36.0 14.0 36.0 74-75 30.811005889030792 36.0 29.5 36.0 14.0 36.0 76 28.814285714285713 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 8.0 16 16.0 17 21.0 18 7.0 19 9.0 20 10.0 21 7.0 22 17.0 23 26.0 24 50.0 25 49.0 26 92.0 27 137.0 28 179.0 29 205.0 30 291.0 31 363.0 32 483.0 33 600.0 34 868.0 35 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.29264632316158 15.957978989494748 13.256628314157078 35.4927463731866 2 31.36568284142071 24.73736868434217 23.08654327163582 20.810405202601302 3 27.450000000000003 27.200000000000003 19.875 25.474999999999998 4 30.875000000000004 30.775000000000002 17.1 21.25 5 31.090545272636316 31.81590795397699 18.384192096048025 18.70935467733867 6 23.93098274568642 33.633408352088026 21.080270067516878 21.355338834708675 7 24.075 17.775 31.624999999999996 26.525 8 26.200000000000003 22.575 24.15 27.075 9 24.4 22.525000000000002 26.400000000000002 26.674999999999997 10-11 27.85 26.687499999999996 20.325 25.137500000000003 12-13 27.6375 22.2 23.125 27.037499999999998 14-15 26.437500000000004 24.65 24.3125 24.6 16-17 27.975 23.325000000000003 22.237499999999997 26.4625 18-19 26.187500000000004 23.7125 23.6375 26.4625 20-21 26.05 24.5375 24.0375 25.374999999999996 22-23 27.675 24.637500000000003 22.9625 24.725 24-25 26.0 24.7375 23.2125 26.05 26-27 26.55 25.8625 22.375 25.2125 28-29 28.6375 24.462500000000002 21.1625 25.7375 30-31 26.4625 25.112499999999997 23.0875 25.337500000000002 32-33 26.900000000000002 24.474999999999998 23.8125 24.8125 34-35 27.275 23.7625 22.575 26.387500000000003 36-37 26.0 25.174999999999997 22.237499999999997 26.5875 38-39 26.400000000000002 25.3125 22.675 25.6125 40-41 27.200000000000003 24.025 22.3125 26.4625 42-43 26.55 24.95 22.95 25.55 44-45 26.424999999999997 25.3125 23.075000000000003 25.1875 46-47 26.887499999999996 24.4875 22.775000000000002 25.85 48-49 26.387500000000003 24.975 23.4375 25.2 50-51 26.24078009751219 24.228028503562946 23.39042380297537 26.140767595949495 52-53 26.79419854963741 24.8062015503876 23.280820205051263 25.11877969492373 54-55 26.644161040260066 24.893723430857715 22.755688922230558 25.70642660665166 56-57 26.131532883220803 25.431357839459867 23.13078269567392 25.30632658164541 58-59 27.55127563781891 24.524762381190595 22.32366183091546 25.60030015007504 60-61 26.07879924953096 24.390243902439025 23.42714196372733 26.10381488430269 62-63 26.394796097072803 25.481611208406306 23.317488116087066 24.806104578433825 64-65 27.211309896159143 23.658200925810082 23.15776304266233 25.972726135368447 66-67 25.641346514829184 24.602678012764358 23.3012138655988 26.454761606807658 68-69 26.958698372966204 25.244055068836047 22.715894868585732 25.081351689612013 70-71 27.395715896279594 24.577226606538897 22.197168984091196 25.829888513090317 72-73 25.34306936925595 24.713584288052374 22.76218053632129 27.181165806370387 74-75 27.219486223878608 22.294689205377345 24.344469586050845 26.141354984693198 76 29.04761904761905 0.0 32.67399267399267 38.27838827838828 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 3.0 19 4.5 20 3.5 21 2.0 22 1.5 23 2.0 24 2.0 25 2.5 26 4.0 27 7.0 28 9.0 29 10.0 30 15.0 31 21.0 32 26.0 33 33.0 34 49.5 35 63.5 36 74.0 37 88.0 38 95.5 39 114.0 40 136.0 41 164.5 42 184.5 43 181.5 44 184.0 45 194.5 46 203.0 47 179.5 48 158.5 49 166.5 50 163.0 51 143.5 52 128.5 53 129.5 54 137.5 55 130.5 56 127.5 57 135.0 58 134.5 59 144.0 60 154.0 61 143.0 62 128.0 63 115.5 64 101.0 65 92.5 66 92.5 67 96.0 68 87.0 69 78.5 70 68.5 71 55.5 72 54.0 73 52.5 74 43.5 75 37.0 76 33.5 77 27.5 78 17.5 79 9.5 80 12.0 81 13.0 82 8.5 83 4.5 84 5.5 85 4.5 86 1.5 87 1.0 88 1.0 89 0.5 90 1.0 91 1.0 92 0.0 93 0.5 94 1.0 95 1.5 96 2.0 97 1.5 98 3.5 99 6.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.0 4 0.0 5 0.05 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 5.0 71 6.0 72 23.0 73 72.0 74 263.0 75 895.0 76 2730.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36317135549872 96.15 2 1.329923273657289 2.6 3 0.17902813299232737 0.525 4 0.051150895140664954 0.2 5 0.051150895140664954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025575447570332477 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCG 5 0.125 No Hit GAAAACGTAAACTCACAACCATTTATGCGCTGGAGAGATCGTTTTGTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra Read 565572 spots for SRR11389857.sra Written 565572 spots for SRR11389857.sra Read 565562 spots for SRR11389857.sra Written 565562 spots for SRR11389857.sra SRR ids: ['SRR11389857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmzo1xts SRR11389857.sra spots: 11311250 blocks: [[1, 565562], [565563, 1131124], [1131125, 1696686], [1696687, 2262248], [2262249, 2827810], [2827811, 3393372], [3393373, 3958934], [3958935, 4524496], [4524497, 5090058], [5090059, 5655620], [5655621, 6221182], [6221183, 6786744], [6786745, 7352306], [7352307, 7917868], [7917869, 8483430], [8483431, 9048992], [9048993, 9614554], [9614555, 10180116], [10180117, 10745678], [10745679, 11311250]] SRR11389857 file size 2143999 SRR11389857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389857 SRR11389857_1.fastq SRR11389857_2.fastq Input file: SRR11389857_1.fastq Paired file: SRR11389857_2.fastq trimmed: SRR11389857-trimmed-pair1.fastq, SRR11389857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:17:13 2024 >> started Sat Dec 7 08:17:23 2024 >> done (10.139s) 11311250 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 32715 ( 0.29%) empty read pairs filtered out after trimming by size control 11278532 (99.71%) read pairs available; of these: 8028 ( 0.07%) trimmed read pairs available after processing 11270504 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 0 0.00% 35 82 0.00% 36 115 0.00% 37 109 0.00% 38 143 0.00% 39 176 0.00% 40 190 0.00% 41 212 0.00% 42 283 0.00% 43 298 0.00% 44 357 0.00% 45 370 0.00% 46 437 0.00% 47 442 0.00% 48 526 0.00% 49 577 0.01% 50 644 0.01% 51 685 0.01% 52 783 0.01% 53 883 0.01% 54 905 0.01% 55 1009 0.01% 56 1135 0.01% 57 1341 0.01% 58 1482 0.01% 59 1527 0.01% 60 1629 0.01% 61 1622 0.01% 62 1743 0.02% 63 1930 0.02% 64 2083 0.02% 65 2272 0.02% 66 2435 0.02% 67 2682 0.02% 68 2770 0.02% 69 3083 0.03% 70 3516 0.03% 71 4802 0.04% 72 12524 0.11% 73 93845 0.83% 74 762283 6.76% 75 4969200 44.06% 76 5395392 47.84% 11278532 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=25.32 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.4 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=16 prefix-density=0.72 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=42.27 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389857 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:17:50 Started mapping on | Dec 07 08:17:50 Finished on | Dec 07 08:18:48 Mapping speed, Million of reads per hour | 700.05 Number of input reads | 11278532 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 9730439 Uniquely mapped reads % | 86.27% Average mapped length | 150.09 Number of splices: Total | 4495145 Number of splices: Annotated (sjdb) | 4311298 Number of splices: GT/AG | 4433436 Number of splices: GC/AG | 55025 Number of splices: AT/AC | 1391 Number of splices: Non-canonical | 5293 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 882452 % of reads mapped to multiple loci | 7.82% Number of reads mapped to too many loci | 12770 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 665641 665641 665641 N_multimapping 882452 882452 882452 N_noFeature 263937 9496885 322050 N_ambiguous 241436 900 70192 UnstrandedReadsAssigned:9225066 PositiveStrandReadsAssigned:232654 NegativeStrandReadsAssigned:9338197 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389857-trimmed-pair1.fastq SRR11389857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,278,532 reads, 10,305,327 reads pseudoaligned [quant] estimated average fragment length: 203.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52973 SRR11389857.ke.tsv 35125 SRR11389857.se.tsv 88098 total ==> SRR11389857.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 733.268 0 0 PNS24247 1044 841.107 16.4358 2.5039 PNS24249 1928 1725.11 54.5646 4.05297 PNS24246 1044 841.107 16.4358 2.5039 PNS24248 1044 841.107 16.4358 2.5039 PNS24244 1471 1268.11 6.12809 0.619224 PNS24243 293 108.514 0 0 KQK14069 1603 1400.11 335.317 30.6883 KQK14071 474 273.54 32.5297 15.2383 ==> SRR11389857.se.tsv <== BRADI_1g14170v3 398 BRADI_1g53295v3 11 BRADI_1g59795v3 137 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 84 BRADI_1g74790v3 118 BRADI_1g09890v3 0 BRADI_1g77505v3 106 BRADI_1g48960v3 0 SRR11389857 completed mapping pipeline successfully