Starting /dee2/code/volunteer_pipeline.sh SRR11389858 current disk space = 1544481665024 free memory = 1601387984 SRR11389858 SRAfilesize edd2d79b5e38a372c8e16817f75f0e94 SRR11389858.sra SRR11389858.sra file validated SRR11389858 is paired end SRR11389858 is conventional basespace SRR11389858 read1 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01025 32.0 32.0 32.0 32.0 32.0 2 30.9115 32.0 32.0 32.0 32.0 32.0 3 31.0485 32.0 32.0 32.0 32.0 32.0 4 31.183 32.0 32.0 32.0 32.0 32.0 5 31.12125 32.0 32.0 32.0 32.0 32.0 6 33.90375 36.0 36.0 36.0 32.0 36.0 7 33.75375 36.0 36.0 36.0 32.0 36.0 8 33.9585 36.0 36.0 36.0 32.0 36.0 9 33.7815 36.0 36.0 36.0 32.0 36.0 10-11 33.897375 36.0 36.0 36.0 32.0 36.0 12-13 34.0295 36.0 36.0 36.0 32.0 36.0 14-15 34.028125 36.0 36.0 36.0 32.0 36.0 16-17 33.886125 36.0 36.0 36.0 32.0 36.0 18-19 33.931875000000005 36.0 36.0 36.0 32.0 36.0 20-21 33.7475 36.0 36.0 36.0 29.5 36.0 22-23 33.6935 36.0 36.0 36.0 29.5 36.0 24-25 33.473375000000004 36.0 36.0 36.0 27.0 36.0 26-27 33.419875000000005 36.0 36.0 36.0 27.0 36.0 28-29 33.33925 36.0 36.0 36.0 24.0 36.0 30-31 33.263 36.0 36.0 36.0 21.0 36.0 32-33 33.16375 36.0 36.0 36.0 20.5 36.0 34-35 33.014250000000004 36.0 36.0 36.0 14.0 36.0 36-37 32.977999999999994 36.0 36.0 36.0 14.0 36.0 38-39 33.180625 36.0 36.0 36.0 17.5 36.0 40-41 33.016625000000005 36.0 36.0 36.0 14.0 36.0 42-43 32.791624999999996 36.0 36.0 36.0 14.0 36.0 44-45 32.90560971492873 36.0 36.0 36.0 14.0 36.0 46-47 32.52738184546136 36.0 32.0 36.0 14.0 36.0 48-49 32.35321330332583 36.0 32.0 36.0 14.0 36.0 50-51 32.39147286821705 36.0 32.0 36.0 14.0 36.0 52-53 32.293323330832706 36.0 32.0 36.0 14.0 36.0 54-55 32.235082563787515 36.0 32.0 36.0 14.0 36.0 56-57 32.08546046046046 36.0 32.0 36.0 14.0 36.0 58-59 31.88738738738739 36.0 32.0 36.0 14.0 36.0 60-61 31.961336336336338 36.0 32.0 36.0 14.0 36.0 62-63 31.815019399875467 36.0 32.0 36.0 14.0 36.0 64-65 31.792285843154183 36.0 32.0 36.0 14.0 36.0 66-67 31.764620289187746 36.0 32.0 36.0 14.0 36.0 68-69 31.80073932019059 36.0 32.0 36.0 14.0 36.0 70-71 31.690740364172974 36.0 32.0 36.0 14.0 36.0 72-73 31.499787390876794 36.0 32.0 36.0 14.0 36.0 74-75 31.49534583505813 36.0 32.0 36.0 14.0 36.0 76 29.715129151291514 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 3.0 23 10.0 24 22.0 25 62.0 26 59.0 27 95.0 28 182.0 29 218.0 30 287.0 31 334.0 32 472.0 33 565.0 34 956.0 35 731.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.625 9.275 14.2 29.9 2 29.549999999999997 11.325000000000001 26.775 32.35 3 27.05 16.950000000000003 21.325 34.675 4 30.325000000000003 23.175 20.150000000000002 26.35 5 28.599999999999998 25.650000000000002 22.400000000000002 23.35 6 25.05 29.525000000000002 23.674999999999997 21.75 7 17.175 26.25 35.05 21.525 8 20.025000000000002 24.7 30.425 24.85 9 20.75 22.1 31.175000000000004 25.974999999999998 10-11 23.575 28.9 24.0375 23.4875 12-13 23.8875 24.9375 25.6125 25.5625 14-15 22.8625 25.224999999999998 25.7375 26.174999999999997 16-17 23.799999999999997 25.0625 25.112499999999997 26.025 18-19 24.212500000000002 25.5 24.474999999999998 25.8125 20-21 23.175 25.650000000000002 26.375 24.8 22-23 24.224999999999998 25.0375 25.074999999999996 25.662499999999998 24-25 23.1875 25.5625 24.75 26.5 26-27 24.474999999999998 24.337500000000002 25.0375 26.150000000000002 28-29 23.962500000000002 24.775 25.3125 25.95 30-31 23.275000000000002 24.887500000000003 25.474999999999998 26.3625 32-33 23.7 25.5625 25.162499999999998 25.575 34-35 23.7 24.9875 25.362499999999997 25.95 36-37 23.575 25.5375 24.7875 26.1 38-39 24.025 24.575 25.137500000000003 26.2625 40-41 23.525 25.775 25.124999999999996 25.575 42-43 23.7125 25.074999999999996 24.9375 26.275 44-45 23.052881610201275 25.090636329541194 25.678209776222026 26.178272284035504 46-47 23.618404601150285 23.50587646911728 25.55638909727432 27.319329832458116 48-49 23.40585146286572 25.081270317579396 25.18129532383096 26.331582895723933 50-51 23.918479619904975 25.1937984496124 24.706176544136035 26.18154538634659 52-53 24.093523380845213 25.018754688672168 24.58114528632158 26.30657664416104 54-55 23.971489308490685 25.09691134175316 24.64674252844817 26.28485682130799 56-57 23.4984984984985 24.81231231231231 25.287787787787785 26.401401401401404 58-59 23.586086086086087 24.91241241241241 24.537037037037038 26.964464464464466 60-61 24.46196196196196 24.16166166166166 25.18768768768769 26.18868868868869 62-63 24.389938681016144 23.95194593918158 25.403579026404703 26.254536353397572 64-65 25.17526289434151 24.349023535302955 25.137706559839764 25.338007010515774 66-67 23.449830890642616 25.04071151196292 24.26406112990104 27.24539646749342 68-69 24.752475247524753 25.078330617871913 24.76500814638426 25.404185988219076 70-71 25.090954710826747 24.413498933634425 24.651863003387277 25.843683352151547 72-73 24.11624103660838 25.047175745376776 24.41816580701975 26.418417410995094 74-75 24.5699920613919 21.75178618682191 25.602011114051336 28.07621063773485 76 27.785977859778598 0.0 33.837638376383765 38.37638376383764 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 3.0 21 5.0 22 6.0 23 4.5 24 3.0 25 4.5 26 4.0 27 7.5 28 10.5 29 9.0 30 12.0 31 18.5 32 28.0 33 35.5 34 42.5 35 52.0 36 70.5 37 92.0 38 118.0 39 142.0 40 149.0 41 167.0 42 188.0 43 207.5 44 223.0 45 240.0 46 255.0 47 240.5 48 216.0 49 216.5 50 217.0 51 178.0 52 152.5 53 144.0 54 130.0 55 136.5 56 133.0 57 119.0 58 117.5 59 109.5 60 104.0 61 102.5 62 96.0 63 91.0 64 76.5 65 67.5 66 66.0 67 61.0 68 61.0 69 56.5 70 43.5 71 35.5 72 37.5 73 38.5 74 35.0 75 29.5 76 22.0 77 15.5 78 11.0 79 8.5 80 6.5 81 3.0 82 2.0 83 2.0 84 3.0 85 3.5 86 3.0 87 3.0 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 2.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 1.0 66 1.0 67 0.0 68 3.0 69 2.0 70 1.0 71 3.0 72 15.0 73 62.0 74 252.0 75 943.0 76 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389858 read2 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.48075 32.0 32.0 32.0 21.0 32.0 2 30.181 32.0 32.0 32.0 21.0 32.0 3 30.25325 32.0 32.0 32.0 21.0 32.0 4 30.29 32.0 32.0 32.0 21.0 32.0 5 30.37225 32.0 32.0 32.0 21.0 32.0 6 33.5385 36.0 36.0 36.0 21.0 36.0 7 33.15275 36.0 36.0 36.0 21.0 36.0 8 33.37525 36.0 36.0 36.0 21.0 36.0 9 33.31675 36.0 36.0 36.0 21.0 36.0 10-11 33.270125 36.0 36.0 36.0 21.0 36.0 12-13 33.195750000000004 36.0 36.0 36.0 21.0 36.0 14-15 32.97475 36.0 36.0 36.0 14.0 36.0 16-17 33.149125 36.0 36.0 36.0 21.0 36.0 18-19 32.93375 36.0 36.0 36.0 17.5 36.0 20-21 32.8305 36.0 36.0 36.0 14.0 36.0 22-23 32.834625 36.0 36.0 36.0 17.5 36.0 24-25 32.769999999999996 36.0 36.0 36.0 14.0 36.0 26-27 32.64125 36.0 36.0 36.0 14.0 36.0 28-29 32.780249999999995 36.0 36.0 36.0 14.0 36.0 30-31 32.572500000000005 36.0 34.0 36.0 14.0 36.0 32-33 32.566125 36.0 34.0 36.0 14.0 36.0 34-35 32.34375 36.0 32.0 36.0 14.0 36.0 36-37 32.34825 36.0 34.0 36.0 14.0 36.0 38-39 32.361625000000004 36.0 36.0 36.0 14.0 36.0 40-41 31.9275 36.0 32.0 36.0 14.0 36.0 42-43 31.978 36.0 32.0 36.0 14.0 36.0 44-45 31.847605370092523 36.0 32.0 36.0 14.0 36.0 46-47 31.95623905976494 36.0 32.0 36.0 14.0 36.0 48-49 31.865591397849464 36.0 32.0 36.0 14.0 36.0 50-51 31.64403600900225 36.0 32.0 36.0 14.0 36.0 52-53 31.691047761940485 36.0 32.0 36.0 14.0 36.0 54-55 31.244221573152167 36.0 32.0 36.0 14.0 36.0 56-57 31.11936936936937 36.0 32.0 36.0 14.0 36.0 58-59 31.27464964964965 36.0 32.0 36.0 14.0 36.0 60-61 31.29466966966967 36.0 32.0 36.0 14.0 36.0 62-63 31.141160904333617 36.0 32.0 36.0 14.0 36.0 64-65 30.846791714480354 36.0 29.5 36.0 14.0 36.0 66-67 31.001878287002256 36.0 32.0 36.0 14.0 36.0 68-69 30.919456298585164 36.0 29.5 36.0 14.0 36.0 70-71 30.937680835185425 36.0 29.5 36.0 14.0 36.0 72-73 30.73940980153292 36.0 29.5 36.0 14.0 36.0 74-75 30.63728536146224 36.0 27.0 36.0 14.0 36.0 76 28.540068363083936 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 12.0 16 25.0 17 14.0 18 10.0 19 10.0 20 11.0 21 8.0 22 11.0 23 39.0 24 36.0 25 64.0 26 87.0 27 132.0 28 160.0 29 245.0 30 319.0 31 393.0 32 466.0 33 565.0 34 840.0 35 548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.30907726931733 16.404101025256317 14.553638409602401 32.733183295823956 2 33.158289572393095 23.1807951987997 23.055763940985248 20.605151287821954 3 28.775000000000002 28.625 18.175 24.425 4 30.775000000000002 31.574999999999996 17.299999999999997 20.349999999999998 5 30.90772693173293 31.58289572393098 18.30457614403601 19.204801200300075 6 25.85646411602901 34.7586896724181 19.979994998749685 19.4048512128032 7 22.95 18.975 32.75 25.324999999999996 8 26.724999999999998 22.825 23.575 26.875 9 24.8 22.375 27.3 25.525 10-11 27.6 28.325 19.8875 24.1875 12-13 27.212500000000002 22.75 24.0 26.0375 14-15 26.575 25.0375 24.474999999999998 23.9125 16-17 27.1 24.4125 23.1125 25.374999999999996 18-19 26.375 24.8125 24.15 24.6625 20-21 27.1125 25.2625 24.0 23.625 22-23 27.3 25.162499999999998 23.3875 24.15 24-25 26.76919229807452 24.668667166791696 23.980995248812203 24.58114528632158 26-27 26.400000000000002 25.5125 23.525 24.5625 28-29 26.6625 24.975 23.974999999999998 24.3875 30-31 25.937500000000004 25.112499999999997 23.275000000000002 25.674999999999997 32-33 26.275 26.075 23.45 24.2 34-35 27.200000000000003 24.6 23.1375 25.0625 36-37 26.400000000000002 25.55 24.349999999999998 23.7 38-39 26.174999999999997 26.0625 24.425 23.3375 40-41 26.487500000000004 25.3 22.8125 25.4 42-43 26.35 25.374999999999996 23.7 24.575 44-45 26.765845730716343 25.403175396924617 23.47793474184273 24.353044130516317 46-47 26.531632908227053 25.343835958989747 23.34333583395849 24.781195298824706 48-49 26.30657664416104 24.681170292573142 24.118529632408105 24.893723430857715 50-51 26.069017254313575 25.756439109777446 23.74343585896474 24.431107776944234 52-53 26.30657664416104 24.81870467616904 23.968492123030757 24.90622655663916 54-55 26.997624109040892 25.32199574840565 22.821057896711267 24.85932224584219 56-57 26.401401401401404 26.38888888888889 23.135635635635634 24.074074074074073 58-59 26.7017017017017 25.11261261261261 23.473473473473476 24.71221221221221 60-61 25.075075075075077 25.33783783783784 24.674674674674673 24.91241241241241 62-63 26.004254786634963 25.55374796646227 23.839319234138408 24.602678012764358 64-65 26.47390161472024 25.597696833145577 22.618600575791714 25.309800976342473 66-67 25.45704983721513 25.807663410969194 24.405209115952918 24.33007763586276 68-69 26.265030060120242 25.764028056112227 23.86022044088176 24.110721442885772 70-71 27.66704274790021 24.921649743011155 23.3546446032343 24.05666290585433 72-73 25.54156171284635 24.83627204030227 23.992443324937028 25.629722921914354 74-75 26.175841795831108 22.942276857295564 25.868519508284336 25.013361838588988 76 26.785714285714285 0.0 35.828267477203646 37.38601823708207 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 3.0 21 2.5 22 1.5 23 3.0 24 6.0 25 7.5 26 7.0 27 9.0 28 9.5 29 5.5 30 13.5 31 25.0 32 31.5 33 36.5 34 42.0 35 62.0 36 87.5 37 100.0 38 113.5 39 140.0 40 163.0 41 160.5 42 161.5 43 181.5 44 197.5 45 206.0 46 201.5 47 208.5 48 218.5 49 197.0 50 173.5 51 159.5 52 153.5 53 151.5 54 145.5 55 132.5 56 124.5 57 125.0 58 117.0 59 112.0 60 118.0 61 124.5 62 116.5 63 92.5 64 83.0 65 85.0 66 83.0 67 83.0 68 77.0 69 74.5 70 65.0 71 53.5 72 47.5 73 38.5 74 29.0 75 24.5 76 24.5 77 18.5 78 12.5 79 11.0 80 8.0 81 6.5 82 5.5 83 3.5 84 2.0 85 1.5 86 1.5 87 1.5 88 2.5 89 1.5 90 0.5 91 1.0 92 1.0 93 1.5 94 1.5 95 1.5 96 2.0 97 2.0 98 1.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0379794910748196 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 2.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 2.0 69 2.0 70 1.0 71 8.0 72 20.0 73 86.0 74 264.0 75 977.0 76 2633.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7573844988639232 1.5 3 0.025246149962130777 0.075 4 0.025246149962130777 0.1 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra Read 590688 spots for SRR11389858.sra Written 590688 spots for SRR11389858.sra SRR ids: ['SRR11389858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3kebdh0o SRR11389858.sra spots: 11813760 blocks: [[1, 590688], [590689, 1181376], [1181377, 1772064], [1772065, 2362752], [2362753, 2953440], [2953441, 3544128], [3544129, 4134816], [4134817, 4725504], [4725505, 5316192], [5316193, 5906880], [5906881, 6497568], [6497569, 7088256], [7088257, 7678944], [7678945, 8269632], [8269633, 8860320], [8860321, 9451008], [9451009, 10041696], [10041697, 10632384], [10632385, 11223072], [11223073, 11813760]] SRR11389858 file size 2239541 SRR11389858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389858 SRR11389858_1.fastq SRR11389858_2.fastq Input file: SRR11389858_1.fastq Paired file: SRR11389858_2.fastq trimmed: SRR11389858-trimmed-pair1.fastq, SRR11389858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:17:58 2024 >> started Sat Dec 7 08:18:10 2024 >> done (11.543s) 11813760 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 45265 ( 0.38%) empty read pairs filtered out after trimming by size control 11768490 (99.62%) read pairs available; of these: 10440 ( 0.09%) trimmed read pairs available after processing 11758050 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 0 0.00% 29 2 0.00% 30 5 0.00% 31 3 0.00% 32 2 0.00% 33 4 0.00% 34 9 0.00% 35 132 0.00% 36 165 0.00% 37 184 0.00% 38 188 0.00% 39 243 0.00% 40 292 0.00% 41 303 0.00% 42 387 0.00% 43 428 0.00% 44 473 0.00% 45 530 0.00% 46 620 0.01% 47 619 0.01% 48 738 0.01% 49 802 0.01% 50 826 0.01% 51 875 0.01% 52 1002 0.01% 53 1076 0.01% 54 1186 0.01% 55 1304 0.01% 56 1555 0.01% 57 1695 0.01% 58 1910 0.02% 59 2035 0.02% 60 2228 0.02% 61 2254 0.02% 62 2404 0.02% 63 2735 0.02% 64 2983 0.03% 65 3267 0.03% 66 3534 0.03% 67 4138 0.04% 68 4113 0.03% 69 4586 0.04% 70 5497 0.05% 71 7048 0.06% 72 14426 0.12% 73 100145 0.85% 74 824985 7.01% 75 5230906 44.45% 76 5533632 47.02% 11768490 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=20 prefix-density=0.58 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=98.09 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=16.0 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=27 fanout-score=134.26 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=19.0 sequence=GCCGCCGCCGCC SRR11389858 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:18:37 Started mapping on | Dec 07 08:18:37 Finished on | Dec 07 08:19:32 Mapping speed, Million of reads per hour | 770.30 Number of input reads | 11768490 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 10452338 Uniquely mapped reads % | 88.82% Average mapped length | 150.01 Number of splices: Total | 4941949 Number of splices: Annotated (sjdb) | 4727875 Number of splices: GT/AG | 4872082 Number of splices: GC/AG | 61542 Number of splices: AT/AC | 2030 Number of splices: Non-canonical | 6295 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 641808 % of reads mapped to multiple loci | 5.45% Number of reads mapped to too many loci | 13736 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 674344 674344 674344 N_multimapping 641808 641808 641808 N_noFeature 298436 10176852 375457 N_ambiguous 248325 1054 52834 UnstrandedReadsAssigned:9905577 PositiveStrandReadsAssigned:274432 NegativeStrandReadsAssigned:10024047 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389858-trimmed-pair1.fastq SRR11389858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,768,490 reads, 10,742,428 reads pseudoaligned [quant] estimated average fragment length: 189.127 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR11389858.ke.tsv 35125 SRR11389858.se.tsv 88098 total ==> SRR11389858.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.04 0 0 PNS24247 1044 855.873 21.6968 3.28648 PNS24249 1928 1739.87 87.0973 6.4898 PNS24246 1044 855.873 21.6968 3.28648 PNS24248 1044 855.873 21.6968 3.28648 PNS24244 1471 1282.87 15.8123 1.59793 PNS24243 293 118.858 0 0 KQK14069 1603 1414.87 1770.49 162.226 KQK14071 474 287.851 154.298 69.4921 ==> SRR11389858.se.tsv <== BRADI_1g14170v3 2045 BRADI_1g53295v3 20 BRADI_1g59795v3 113 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 210 BRADI_1g74790v3 200 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 1 SRR11389858 completed mapping pipeline successfully