Starting /dee2/code/volunteer_pipeline.sh SRR11389859 current disk space = 1544528408576 free memory = 1601778020 SRR11389859 SRAfilesize 14013216416fedd2035f2ad5eea1dabe SRR11389859.sra SRR11389859.sra file validated SRR11389859 is paired end SRR11389859 is conventional basespace SRR11389859 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0735 32.0 32.0 32.0 32.0 32.0 2 31.03075 32.0 32.0 32.0 32.0 32.0 3 31.0345 32.0 32.0 32.0 32.0 32.0 4 31.172 32.0 32.0 32.0 32.0 32.0 5 31.13375 32.0 32.0 32.0 32.0 32.0 6 34.042 36.0 36.0 36.0 32.0 36.0 7 34.1105 36.0 36.0 36.0 32.0 36.0 8 33.89825 36.0 36.0 36.0 32.0 36.0 9 33.806 36.0 36.0 36.0 32.0 36.0 10-11 33.858000000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.199125 36.0 36.0 36.0 32.0 36.0 14-15 34.022875 36.0 36.0 36.0 32.0 36.0 16-17 33.909 36.0 36.0 36.0 32.0 36.0 18-19 33.90025 36.0 36.0 36.0 32.0 36.0 20-21 33.925 36.0 36.0 36.0 32.0 36.0 22-23 33.657624999999996 36.0 36.0 36.0 27.0 36.0 24-25 33.582625 36.0 36.0 36.0 29.5 36.0 26-27 33.368624999999994 36.0 36.0 36.0 24.0 36.0 28-29 33.363625 36.0 36.0 36.0 24.0 36.0 30-31 33.303875000000005 36.0 36.0 36.0 24.0 36.0 32-33 33.250875 36.0 36.0 36.0 21.0 36.0 34-35 33.274375 36.0 36.0 36.0 20.5 36.0 36-37 33.17775 36.0 36.0 36.0 21.0 36.0 38-39 33.295500000000004 36.0 36.0 36.0 24.0 36.0 40-41 33.156375 36.0 36.0 36.0 17.5 36.0 42-43 32.960750000000004 36.0 36.0 36.0 17.5 36.0 44-45 33.145624999999995 36.0 36.0 36.0 17.5 36.0 46-47 32.647125 36.0 32.0 36.0 14.0 36.0 48-49 32.668875 36.0 32.0 36.0 14.0 36.0 50-51 32.581307573578414 36.0 32.0 36.0 14.0 36.0 52-53 32.394045534150614 36.0 32.0 36.0 14.0 36.0 54-55 32.32086564923692 36.0 32.0 36.0 14.0 36.0 56-57 32.162041149134694 36.0 32.0 36.0 14.0 36.0 58-59 32.009762202753436 36.0 32.0 36.0 14.0 36.0 60-61 32.284431798200046 36.0 32.0 36.0 14.0 36.0 62-63 32.02166833667334 36.0 32.0 36.0 14.0 36.0 64-65 32.01453998495863 36.0 32.0 36.0 14.0 36.0 66-67 31.847407226144227 36.0 32.0 36.0 14.0 36.0 68-69 31.78802126373772 36.0 32.0 36.0 14.0 36.0 70-71 31.682332244282485 36.0 32.0 36.0 14.0 36.0 72-73 31.65255811406581 36.0 32.0 36.0 14.0 36.0 74-75 31.76461499863285 36.0 32.0 36.0 14.0 36.0 76 30.288440366972477 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 7.0 23 11.0 24 11.0 25 36.0 26 75.0 27 96.0 28 141.0 29 222.0 30 263.0 31 344.0 32 455.0 33 602.0 34 936.0 35 797.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.550000000000004 9.6 14.7 29.15 2 29.849999999999998 10.0 27.425 32.725 3 26.5 16.325 23.075000000000003 34.1 4 31.75 22.775000000000002 19.975 25.5 5 29.15 24.625 23.200000000000003 23.025000000000002 6 24.15 30.55 24.275 21.025 7 16.825000000000003 26.325 35.225 21.625 8 20.150000000000002 24.4 30.0 25.45 9 19.875 21.625 34.2 24.3 10-11 22.3625 29.95 24.05 23.6375 12-13 23.474999999999998 24.6125 26.637499999999996 25.275 14-15 23.2875 25.75 25.6125 25.35 16-17 24.575 25.3 25.162499999999998 24.962500000000002 18-19 22.900000000000002 25.637500000000003 25.4625 26.0 20-21 23.7375 26.150000000000002 25.775 24.337500000000002 22-23 24.8625 25.4375 24.462500000000002 25.2375 24-25 22.8875 24.65 26.9625 25.5 26-27 24.325 24.4 25.887500000000003 25.387500000000003 28-29 24.212500000000002 24.637500000000003 25.4625 25.687500000000004 30-31 23.3875 25.137500000000003 25.5375 25.937500000000004 32-33 24.224999999999998 25.4625 25.387500000000003 24.925 34-35 24.3 25.0 25.4625 25.2375 36-37 23.549999999999997 25.2375 25.662499999999998 25.55 38-39 24.425 24.762500000000003 24.925 25.887500000000003 40-41 24.4375 25.362499999999997 24.637500000000003 25.5625 42-43 23.8125 24.887500000000003 25.575 25.724999999999998 44-45 24.075 25.224999999999998 25.0 25.7 46-47 24.125 24.8 25.224999999999998 25.85 48-49 23.6375 25.2875 24.925 26.150000000000002 50-51 24.112056028014006 25.11255627813907 24.574787393696848 26.20060030015007 52-53 24.468351263447584 24.96872654490868 24.718538904178132 25.8443832874656 54-55 22.742056542406804 24.7935951963973 25.99449587190393 26.46985238929197 56-57 24.386886886886888 24.96246246246246 25.275275275275277 25.375375375375377 58-59 23.30413016270338 25.306633291614517 26.18272841051314 25.20650813516896 60-61 23.460190285428144 24.937406109163746 25.61342013019529 25.98898347521282 62-63 24.611723446893787 25.062625250501004 24.73697394789579 25.58867735470942 64-65 24.79318124843319 23.66507896715969 25.65805966407621 25.883680120330908 66-67 24.306688417618272 24.658049943531182 25.498807880537083 25.536453758313467 68-69 24.75197789777722 24.13663192264222 24.576164762024362 26.535225417556198 70-71 25.534053782357375 23.91304347826087 24.440814274943452 26.112088464438298 72-73 23.416603583144084 24.26192278576836 25.725460509714864 26.596013121372696 74-75 26.08753140288245 21.301071003570012 26.206531799550444 26.40486579399709 76 26.75229357798165 0.0 35.88990825688073 37.35779816513761 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 4.0 19 4.5 20 5.0 21 8.5 22 7.0 23 6.0 24 6.0 25 5.0 26 6.5 27 12.5 28 18.5 29 19.0 30 18.0 31 27.0 32 35.5 33 36.0 34 42.0 35 50.5 36 74.0 37 99.0 38 119.0 39 141.0 40 164.0 41 186.5 42 194.5 43 205.5 44 220.0 45 222.5 46 217.0 47 225.5 48 222.0 49 188.0 50 161.0 51 157.5 52 155.0 53 139.0 54 122.5 55 132.0 56 131.5 57 126.5 58 135.0 59 127.0 60 127.5 61 118.5 62 104.0 63 92.0 64 74.5 65 72.0 66 66.0 67 52.0 68 52.0 69 53.0 70 48.0 71 39.5 72 28.0 73 25.5 74 33.0 75 37.0 76 25.5 77 15.5 78 10.5 79 5.0 80 6.5 81 5.5 82 4.0 83 5.5 84 3.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 2.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 0.0 60 2.0 61 1.0 62 0.0 63 3.0 64 0.0 65 4.0 66 1.0 67 1.0 68 3.0 69 1.0 70 0.0 71 9.0 72 14.0 73 54.0 74 241.0 75 936.0 76 2725.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31288343558282 96.15 2 1.3548057259713702 2.65 3 0.23006134969325154 0.675 4 0.051124744376278126 0.2 5 0.0 0.0 6 0.025562372188139063 0.15 7 0.025562372188139063 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 7 0.17500000000000002 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAA 15 0.002126993 69.4875 51 >>END_MODULE SRR11389859 read2 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.53225 32.0 32.0 32.0 32.0 32.0 2 30.4345 32.0 32.0 32.0 32.0 32.0 3 30.355 32.0 32.0 32.0 21.0 32.0 4 30.32125 32.0 32.0 32.0 21.0 32.0 5 30.35875 32.0 32.0 32.0 21.0 32.0 6 33.4295 36.0 36.0 36.0 21.0 36.0 7 33.4835 36.0 36.0 36.0 21.0 36.0 8 33.397 36.0 36.0 36.0 21.0 36.0 9 33.386 36.0 36.0 36.0 21.0 36.0 10-11 33.221375 36.0 36.0 36.0 21.0 36.0 12-13 33.17725 36.0 36.0 36.0 21.0 36.0 14-15 32.995374999999996 36.0 36.0 36.0 14.0 36.0 16-17 33.134125 36.0 36.0 36.0 21.0 36.0 18-19 33.009375 36.0 36.0 36.0 21.0 36.0 20-21 32.950874999999996 36.0 36.0 36.0 14.0 36.0 22-23 33.02575 36.0 36.0 36.0 17.5 36.0 24-25 32.812124999999995 36.0 36.0 36.0 14.0 36.0 26-27 32.7485 36.0 36.0 36.0 14.0 36.0 28-29 32.739125 36.0 36.0 36.0 14.0 36.0 30-31 32.65575 36.0 36.0 36.0 14.0 36.0 32-33 32.583875 36.0 34.0 36.0 14.0 36.0 34-35 32.531000000000006 36.0 36.0 36.0 14.0 36.0 36-37 32.59725 36.0 36.0 36.0 14.0 36.0 38-39 32.472125 36.0 36.0 36.0 14.0 36.0 40-41 32.18275 36.0 32.0 36.0 14.0 36.0 42-43 32.121 36.0 34.0 36.0 14.0 36.0 44-45 31.948 36.0 32.0 36.0 14.0 36.0 46-47 32.182375 36.0 32.0 36.0 14.0 36.0 48-49 32.058625 36.0 32.0 36.0 14.0 36.0 50-51 31.92572680090045 36.0 32.0 36.0 14.0 36.0 52-53 31.818034017008504 36.0 32.0 36.0 14.0 36.0 54-55 31.700850425212607 36.0 32.0 36.0 14.0 36.0 56-57 31.252322482562604 36.0 32.0 36.0 14.0 36.0 58-59 31.54179179179179 36.0 32.0 36.0 14.0 36.0 60-61 31.164236845759127 36.0 32.0 36.0 14.0 36.0 62-63 31.51465063861758 36.0 32.0 36.0 14.0 36.0 64-65 31.255639097744364 36.0 32.0 36.0 14.0 36.0 66-67 31.259128356320108 36.0 32.0 36.0 14.0 36.0 68-69 31.106059072602115 36.0 32.0 36.0 14.0 36.0 70-71 30.962881378857265 36.0 32.0 36.0 14.0 36.0 72-73 30.82342334859011 36.0 29.5 36.0 14.0 36.0 74-75 30.8993588505178 36.0 29.5 36.0 14.0 36.0 76 29.08017984263769 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 13.0 16 17.0 17 14.0 18 11.0 19 7.0 20 10.0 21 11.0 22 13.0 23 26.0 24 44.0 25 61.0 26 92.0 27 128.0 28 181.0 29 220.0 30 291.0 31 336.0 32 454.0 33 598.0 34 870.0 35 600.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6591647911978 17.05426356589147 14.153538384596148 32.13303325831458 2 31.207801950487625 23.455863965991497 24.006001500375092 21.330332583145786 3 27.925 28.1 20.05 23.925 4 29.75 30.425 18.6 21.224999999999998 5 30.332583145786447 30.932733183295824 20.355088772193046 18.37959489872468 6 24.625 32.7 21.125 21.55 7 23.0 18.725 33.074999999999996 25.2 8 25.624999999999996 23.375 24.375 26.625 9 25.650000000000002 21.775 26.224999999999998 26.35 10-11 27.487499999999997 28.249999999999996 20.150000000000002 24.1125 12-13 26.087500000000002 23.175 24.3 26.437500000000004 14-15 25.4875 25.374999999999996 24.5 24.637500000000003 16-17 27.537499999999998 24.1875 22.975 25.3 18-19 26.0375 24.525 24.3 25.137500000000003 20-21 25.724999999999998 25.650000000000002 24.2375 24.3875 22-23 27.925 25.2375 23.225 23.6125 24-25 26.237500000000004 25.362499999999997 23.775 24.625 26-27 25.7625 25.275 23.875 25.087500000000002 28-29 26.8375 25.324999999999996 23.1375 24.7 30-31 26.337500000000002 25.224999999999998 23.3125 25.124999999999996 32-33 27.3625 24.837500000000002 23.8625 23.9375 34-35 25.8625 24.8625 24.6 24.675 36-37 25.5 25.8 23.5625 25.137500000000003 38-39 27.05 25.900000000000002 23.6625 23.3875 40-41 26.8625 24.962500000000002 23.3875 24.7875 42-43 25.624999999999996 25.637500000000003 24.3625 24.375 44-45 26.0375 24.887500000000003 23.7375 25.337500000000002 46-47 26.200000000000003 25.9875 23.05 24.762500000000003 48-49 25.1875 25.5375 24.25 25.025 50-51 25.6064016004001 25.743935983995996 23.905976494123532 24.74368592148037 52-53 26.3631815907954 25.212606303151574 23.21160580290145 25.212606303151574 54-55 26.96348174087044 26.113056528264135 22.848924462231114 24.074537268634316 56-57 26.09457092819615 25.856892669502123 23.417563172379285 24.630973229922443 58-59 26.95195195195195 24.71221221221221 23.24824824824825 25.08758758758759 60-61 26.12015018773467 25.64455569461827 23.642052565707132 24.593241551939926 62-63 26.13323315802655 25.569747057350362 23.303280741297268 24.993739043325817 64-65 26.553884711779446 25.100250626566417 23.408521303258144 24.93734335839599 66-67 26.226012793176974 25.636523266022827 23.416530791421046 24.720933149379153 68-69 25.354587674155894 25.354587674155894 23.77306388854023 25.517760763147983 70-71 26.146500816685514 24.814675210453572 23.50797838924488 25.53084558361603 72-73 25.873417721518987 24.949367088607595 24.0 25.17721518987342 74-75 26.182160128962924 22.98495432563138 24.9462654486835 25.88662009672219 76 27.500936680404646 0.0 35.369052079430496 37.130011240164855 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 3.0 19 3.5 20 1.5 21 0.5 22 2.0 23 4.5 24 7.0 25 9.0 26 8.5 27 10.0 28 14.5 29 17.0 30 16.5 31 22.0 32 32.0 33 39.5 34 45.0 35 58.0 36 76.0 37 89.5 38 110.0 39 129.5 40 142.0 41 161.5 42 181.5 43 187.0 44 182.0 45 187.5 46 198.0 47 197.5 48 203.5 49 208.0 50 196.0 51 170.0 52 141.0 53 141.0 54 153.5 55 149.0 56 132.0 57 125.5 58 121.5 59 110.5 60 122.5 61 125.5 62 114.0 63 103.5 64 86.0 65 70.0 66 65.5 67 70.5 68 73.5 69 62.5 70 55.0 71 60.0 72 50.0 73 41.5 74 35.0 75 27.0 76 25.5 77 18.5 78 12.5 79 13.0 80 10.0 81 9.0 82 7.5 83 3.5 84 3.0 85 1.5 86 0.5 87 1.0 88 1.5 89 1.0 90 1.5 91 1.5 92 0.0 93 0.5 94 2.5 95 2.0 96 0.0 97 0.0 98 0.5 99 3.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 2.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 0.0 60 2.0 61 1.0 62 0.0 63 3.0 64 0.0 65 3.0 66 1.0 67 1.0 68 3.0 69 1.0 70 3.0 71 12.0 72 32.0 73 62.0 74 300.0 75 903.0 76 2669.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.79260780287474 95.25 2 2.002053388090349 3.9 3 0.07700205338809035 0.22499999999999998 4 0.07700205338809035 0.3 5 0.025667351129363452 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025667351129363452 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCTTACTTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411599 spots for SRR11389859.sra Written 411599 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra Read 411584 spots for SRR11389859.sra Written 411584 spots for SRR11389859.sra SRR ids: ['SRR11389859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x_z6twik SRR11389859.sra spots: 8231695 blocks: [[1, 411584], [411585, 823168], [823169, 1234752], [1234753, 1646336], [1646337, 2057920], [2057921, 2469504], [2469505, 2881088], [2881089, 3292672], [3292673, 3704256], [3704257, 4115840], [4115841, 4527424], [4527425, 4939008], [4939009, 5350592], [5350593, 5762176], [5762177, 6173760], [6173761, 6585344], [6585345, 6996928], [6996929, 7408512], [7408513, 7820096], [7820097, 8231695]] SRR11389859 file size 1556341 SRR11389859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389859 SRR11389859_1.fastq SRR11389859_2.fastq Input file: SRR11389859_1.fastq Paired file: SRR11389859_2.fastq trimmed: SRR11389859-trimmed-pair1.fastq, SRR11389859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:22:38 2024 >> started Sat Dec 7 08:22:44 2024 >> done (6.798s) 8231695 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 44055 ( 0.54%) empty read pairs filtered out after trimming by size control 8187638 (99.46%) read pairs available; of these: 8042 ( 0.10%) trimmed read pairs available after processing 8179596 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 1 0.00% 34 4 0.00% 35 149 0.00% 36 156 0.00% 37 191 0.00% 38 256 0.00% 39 321 0.00% 40 333 0.00% 41 406 0.00% 42 486 0.01% 43 569 0.01% 44 608 0.01% 45 660 0.01% 46 788 0.01% 47 856 0.01% 48 951 0.01% 49 1042 0.01% 50 1098 0.01% 51 1244 0.02% 52 1314 0.02% 53 1426 0.02% 54 1554 0.02% 55 1831 0.02% 56 2070 0.03% 57 2334 0.03% 58 2551 0.03% 59 2793 0.03% 60 2865 0.03% 61 2991 0.04% 62 3186 0.04% 63 3486 0.04% 64 3904 0.05% 65 4303 0.05% 66 4625 0.06% 67 5354 0.07% 68 5498 0.07% 69 6172 0.08% 70 6712 0.08% 71 8357 0.10% 72 14039 0.17% 73 73114 0.89% 74 557216 6.81% 75 3605304 44.03% 76 3854509 47.08% 8187638 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.70 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=27.40 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.19 sequence-density-rank=24 fanout-score=4.57 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=1.5 sequence=CCTTTCCAGGGGCTCAAGTCCAC SRR11389859 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:23:11 Started mapping on | Dec 07 08:23:11 Finished on | Dec 07 08:23:54 Mapping speed, Million of reads per hour | 685.48 Number of input reads | 8187638 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 6873278 Uniquely mapped reads % | 83.95% Average mapped length | 149.92 Number of splices: Total | 3103079 Number of splices: Annotated (sjdb) | 2971768 Number of splices: GT/AG | 3061252 Number of splices: GC/AG | 37055 Number of splices: AT/AC | 868 Number of splices: Non-canonical | 3904 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 796251 % of reads mapped to multiple loci | 9.73% Number of reads mapped to too many loci | 19438 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.04% % of reads unmapped: other | 1.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518109 518109 518109 N_multimapping 796251 796251 796251 N_noFeature 203954 6709194 250391 N_ambiguous 169149 635 55354 UnstrandedReadsAssigned:6500175 PositiveStrandReadsAssigned:163449 NegativeStrandReadsAssigned:6567533 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389859-trimmed-pair1.fastq SRR11389859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,187,638 reads, 7,398,980 reads pseudoaligned [quant] estimated average fragment length: 178.678 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR11389859.ke.tsv 35125 SRR11389859.se.tsv 88098 total ==> SRR11389859.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.493 12.8644 3.10955 PNS24247 1044 866.322 5.35614 1.13353 PNS24249 1928 1750.32 40.2311 4.21408 PNS24246 1044 866.322 5.35614 1.13353 PNS24248 1044 866.322 5.35614 1.13353 PNS24244 1471 1293.32 19.8361 2.81196 PNS24243 293 128.006 1 1.43228 KQK14069 1603 1425.32 336.044 43.2258 KQK14071 474 298.195 21.8752 13.4497 ==> SRR11389859.se.tsv <== BRADI_1g14170v3 375 BRADI_1g53295v3 7 BRADI_1g59795v3 83 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 123 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 62 BRADI_1g48960v3 0 SRR11389859 completed mapping pipeline successfully