Starting /dee2/code/volunteer_pipeline.sh SRR11389860 current disk space = 1544529252352 free memory = 1600844784 SRR11389860 SRAfilesize 363761a7b09b7391c015a9b3cbbfbdd8 SRR11389860.sra SRR11389860.sra file validated SRR11389860 is paired end SRR11389860 is conventional basespace SRR11389860 read1 length is 60-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 60-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.99225 32.0 32.0 32.0 32.0 32.0 2 31.06525 32.0 32.0 32.0 32.0 32.0 3 31.062 32.0 32.0 32.0 32.0 32.0 4 30.992 32.0 32.0 32.0 32.0 32.0 5 31.1695 32.0 32.0 32.0 32.0 32.0 6 34.06125 36.0 36.0 36.0 32.0 36.0 7 33.8655 36.0 36.0 36.0 32.0 36.0 8 34.134 36.0 36.0 36.0 32.0 36.0 9 33.8335 36.0 36.0 36.0 32.0 36.0 10-11 33.861374999999995 36.0 36.0 36.0 32.0 36.0 12-13 33.925625 36.0 36.0 36.0 32.0 36.0 14-15 33.878 36.0 36.0 36.0 32.0 36.0 16-17 33.937375 36.0 36.0 36.0 32.0 36.0 18-19 33.813 36.0 36.0 36.0 32.0 36.0 20-21 33.708375000000004 36.0 36.0 36.0 29.5 36.0 22-23 33.693124999999995 36.0 36.0 36.0 29.5 36.0 24-25 33.525999999999996 36.0 36.0 36.0 27.0 36.0 26-27 33.43325 36.0 36.0 36.0 27.0 36.0 28-29 33.455 36.0 36.0 36.0 27.0 36.0 30-31 33.324124999999995 36.0 36.0 36.0 24.0 36.0 32-33 33.218875 36.0 36.0 36.0 17.5 36.0 34-35 33.021625 36.0 36.0 36.0 14.0 36.0 36-37 33.134125 36.0 36.0 36.0 21.0 36.0 38-39 33.341750000000005 36.0 36.0 36.0 27.0 36.0 40-41 33.054249999999996 36.0 36.0 36.0 14.0 36.0 42-43 32.771375 36.0 36.0 36.0 14.0 36.0 44-45 32.8635 36.0 36.0 36.0 14.0 36.0 46-47 32.5385 36.0 32.0 36.0 14.0 36.0 48-49 32.563500000000005 36.0 32.0 36.0 14.0 36.0 50-51 32.45075 36.0 32.0 36.0 14.0 36.0 52-53 32.14675 36.0 32.0 36.0 14.0 36.0 54-55 32.204125000000005 36.0 32.0 36.0 14.0 36.0 56-57 31.929250000000003 36.0 32.0 36.0 14.0 36.0 58-59 31.829 36.0 32.0 36.0 14.0 36.0 60-61 32.13164447361841 36.0 32.0 36.0 14.0 36.0 62-63 31.865091272818205 36.0 32.0 36.0 14.0 36.0 64-65 31.812078019504877 36.0 32.0 36.0 14.0 36.0 66-67 31.495373843460865 36.0 32.0 36.0 14.0 36.0 68-69 31.734242121060532 36.0 32.0 36.0 14.0 36.0 70-71 31.44684480193687 36.0 32.0 36.0 14.0 36.0 72-73 31.381463565210233 36.0 32.0 36.0 14.0 36.0 74-75 31.485355183313395 36.0 32.0 36.0 14.0 36.0 76 29.84469558877142 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 4.0 23 16.0 24 16.0 25 38.0 26 59.0 27 118.0 28 160.0 29 214.0 30 280.0 31 365.0 32 472.0 33 645.0 34 932.0 35 679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.775 9.075 14.649999999999999 29.5 2 29.15 9.675 29.849999999999998 31.324999999999996 3 28.125 15.299999999999999 21.05 35.525 4 31.5 21.975 20.4 26.125 5 29.5 24.7 23.25 22.55 6 24.15 29.049999999999997 26.025 20.775 7 18.325 26.35 34.5 20.825 8 20.724999999999998 25.5 29.4 24.375 9 19.775000000000002 21.3 33.25 25.674999999999997 10-11 23.025000000000002 29.7125 23.3625 23.9 12-13 23.8125 25.174999999999997 25.0625 25.95 14-15 24.337500000000002 25.0625 25.7625 24.837500000000002 16-17 24.075 25.650000000000002 24.7875 25.4875 18-19 23.8125 24.474999999999998 26.387500000000003 25.324999999999996 20-21 24.3 24.8625 25.587500000000002 25.25 22-23 23.8875 25.124999999999996 25.85 25.137500000000003 24-25 23.325000000000003 24.8125 25.2375 26.625 26-27 24.0 25.6125 24.887500000000003 25.5 28-29 24.4125 25.2375 24.962500000000002 25.387500000000003 30-31 24.3625 25.337500000000002 24.7375 25.5625 32-33 24.1125 24.825 25.275 25.7875 34-35 24.637500000000003 25.4875 24.625 25.25 36-37 24.087500000000002 25.337500000000002 25.05 25.525 38-39 24.85 24.2 25.362499999999997 25.587500000000002 40-41 24.9375 25.45 24.8 24.8125 42-43 24.425 23.9875 26.025 25.5625 44-45 23.7 24.825 24.875 26.6 46-47 24.625 25.0 23.5125 26.8625 48-49 23.7625 24.9375 23.9375 27.3625 50-51 24.099999999999998 24.887500000000003 24.85 26.1625 52-53 25.137500000000003 24.025 24.425 26.4125 54-55 24.4875 25.7375 23.25 26.525 56-57 23.8125 25.0375 24.5 26.650000000000002 58-59 24.675 25.2125 23.75 26.3625 60-61 24.1780222527816 24.603075384423054 25.053131641455185 26.16577072134017 62-63 25.081270317579396 24.143535883970994 24.456114028507127 26.319079769942487 64-65 24.8062015503876 24.256064016004 24.656164041010253 26.281570392598148 66-67 25.18129532383096 23.980995248812203 25.51887971992998 25.318829707426854 68-69 24.899949974987493 23.611805902951478 24.299649824912457 27.188594297148573 70-71 24.524524524524523 23.323323323323322 24.93743743743744 27.214714714714717 72-73 25.72614107883817 23.85263422607821 24.405884571859676 26.01534012322394 74-75 24.930674765614683 22.17087019675162 25.47207183414763 27.426383203486072 76 27.050674444039373 0.0 36.34706525701786 36.60226029894276 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 5.0 2 1.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 2.5 19 3.0 20 4.0 21 6.5 22 5.0 23 2.5 24 2.5 25 5.0 26 7.0 27 8.5 28 12.0 29 13.5 30 19.0 31 24.5 32 26.5 33 36.5 34 45.5 35 52.5 36 75.5 37 103.5 38 112.5 39 128.0 40 157.0 41 172.5 42 174.5 43 198.5 44 222.5 45 204.0 46 192.5 47 195.0 48 202.0 49 188.5 50 158.0 51 148.0 52 144.5 53 145.5 54 139.5 55 141.5 56 143.5 57 135.0 58 135.0 59 139.0 60 134.5 61 129.5 62 131.5 63 111.5 64 83.0 65 67.5 66 63.5 67 64.0 68 59.0 69 51.0 70 51.5 71 51.5 72 38.5 73 29.5 74 26.5 75 25.5 76 25.0 77 22.0 78 16.5 79 12.0 80 9.0 81 5.5 82 4.0 83 4.5 84 2.5 85 1.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 1.0 70 2.0 71 8.0 72 21.0 73 57.0 74 245.0 75 921.0 76 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.73604322099305 94.975 2 1.9037818368922048 3.6999999999999997 3 0.20581425263699513 0.6 4 0.07718034473887317 0.3 5 0.05145356315924878 0.25 6 0.0 0.0 7 0.02572678157962439 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 5 0.125 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389860 read2 length is 67-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 67-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.50925 32.0 32.0 32.0 32.0 32.0 2 30.1205 32.0 32.0 32.0 21.0 32.0 3 29.89275 32.0 32.0 32.0 21.0 32.0 4 30.06575 32.0 32.0 32.0 21.0 32.0 5 30.076 32.0 32.0 32.0 21.0 32.0 6 33.0715 36.0 36.0 36.0 21.0 36.0 7 33.198 36.0 36.0 36.0 21.0 36.0 8 33.2785 36.0 36.0 36.0 21.0 36.0 9 33.06475 36.0 36.0 36.0 21.0 36.0 10-11 32.905375 36.0 36.0 36.0 17.5 36.0 12-13 32.848749999999995 36.0 36.0 36.0 14.0 36.0 14-15 32.881 36.0 36.0 36.0 14.0 36.0 16-17 32.792 36.0 36.0 36.0 17.5 36.0 18-19 32.8665 36.0 36.0 36.0 17.5 36.0 20-21 32.552 36.0 36.0 36.0 14.0 36.0 22-23 32.60025 36.0 34.0 36.0 14.0 36.0 24-25 32.40025 36.0 32.0 36.0 14.0 36.0 26-27 32.586375000000004 36.0 34.0 36.0 14.0 36.0 28-29 32.286375 36.0 34.0 36.0 14.0 36.0 30-31 32.355875 36.0 32.0 36.0 14.0 36.0 32-33 32.260875 36.0 34.0 36.0 14.0 36.0 34-35 32.082375 36.0 32.0 36.0 14.0 36.0 36-37 32.052625 36.0 32.0 36.0 14.0 36.0 38-39 32.03075 36.0 32.0 36.0 14.0 36.0 40-41 31.636875 36.0 32.0 36.0 14.0 36.0 42-43 31.807875000000003 36.0 32.0 36.0 14.0 36.0 44-45 31.758375 36.0 32.0 36.0 14.0 36.0 46-47 31.709874999999997 36.0 32.0 36.0 14.0 36.0 48-49 31.597499999999997 36.0 32.0 36.0 14.0 36.0 50-51 31.6075 36.0 32.0 36.0 14.0 36.0 52-53 31.420875000000002 36.0 32.0 36.0 14.0 36.0 54-55 31.347 36.0 32.0 36.0 14.0 36.0 56-57 30.87475 36.0 29.5 36.0 14.0 36.0 58-59 30.9525 36.0 32.0 36.0 14.0 36.0 60-61 30.79825 36.0 29.5 36.0 14.0 36.0 62-63 30.814 36.0 29.5 36.0 14.0 36.0 64-65 30.572875 36.0 27.0 36.0 14.0 36.0 66-67 30.496875000000003 36.0 27.0 36.0 14.0 36.0 68-69 30.43613494262768 36.0 27.0 36.0 14.0 36.0 70-71 30.353622217258582 36.0 27.0 36.0 14.0 36.0 72-73 30.38326716703819 36.0 27.0 36.0 14.0 36.0 74-75 30.479470020873457 36.0 27.0 36.0 14.0 36.0 76 28.82069970845481 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 8.0 16 15.0 17 17.0 18 12.0 19 8.0 20 7.0 21 7.0 22 18.0 23 25.0 24 37.0 25 76.0 26 102.0 27 164.0 28 212.0 29 305.0 30 328.0 31 401.0 32 487.0 33 604.0 34 791.0 35 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 15.925 13.700000000000001 35.449999999999996 2 32.225 21.6 23.974999999999998 22.2 3 29.049999999999997 25.825 19.825 25.3 4 31.574999999999996 30.075000000000003 17.075000000000003 21.275 5 30.575000000000003 31.175000000000004 18.35 19.900000000000002 6 25.174999999999997 34.8 19.625 20.4 7 24.525 19.225 29.975 26.275 8 26.55 22.7 22.825 27.925 9 24.425 22.825 26.950000000000003 25.8 10-11 29.349999999999998 26.05 19.662499999999998 24.9375 12-13 26.200000000000003 23.1875 24.0625 26.55 14-15 26.55 24.6625 23.75 25.0375 16-17 27.8625 23.75 21.975 26.4125 18-19 25.9875 23.8375 24.224999999999998 25.95 20-21 27.8625 24.5125 23.150000000000002 24.474999999999998 22-23 27.35 24.099999999999998 22.95 25.6 24-25 26.187500000000004 24.125 24.2625 25.424999999999997 26-27 26.825 25.112499999999997 23.625 24.4375 28-29 27.187499999999996 24.474999999999998 22.225 26.1125 30-31 27.05 24.7875 22.425 25.7375 32-33 26.974999999999998 25.25 22.912499999999998 24.8625 34-35 27.425 24.4375 22.5875 25.55 36-37 26.35 25.75 22.7125 25.1875 38-39 27.025 25.0 23.125 24.85 40-41 27.737499999999997 24.212500000000002 21.65 26.400000000000002 42-43 26.137500000000003 24.7375 23.400000000000002 25.724999999999998 44-45 27.1375 25.362499999999997 22.5875 24.9125 46-47 26.950000000000003 25.9625 21.712500000000002 25.374999999999996 48-49 26.5375 24.4375 24.025 25.0 50-51 26.987499999999997 24.4875 22.6 25.924999999999997 52-53 27.900000000000002 24.2875 22.162499999999998 25.650000000000002 54-55 27.375 24.4875 23.35 24.7875 56-57 27.5625 24.349999999999998 22.412499999999998 25.674999999999997 58-59 27.8625 24.0375 22.0625 26.0375 60-61 26.0625 25.2625 23.9125 24.762500000000003 62-63 25.85 25.0625 23.7375 25.35 64-65 27.3 24.337500000000002 22.1 26.2625 66-67 27.325 24.3125 22.8125 25.55 68-69 26.841776110068793 24.878048780487806 23.739837398373982 24.54033771106942 70-71 27.012141694830394 24.55876830642133 22.631117786957066 25.797972211791215 72-73 26.34625062908908 24.647710115752393 22.99949672873679 26.00654252642174 74-75 26.487701666225867 21.766728378735785 25.601692673895794 26.14387728114255 76 29.11807580174927 0.0 32.5801749271137 38.30174927113703 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 4.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 3.0 20 4.5 21 5.5 22 5.5 23 5.0 24 5.5 25 7.0 26 7.0 27 5.5 28 6.0 29 9.0 30 17.0 31 23.5 32 23.5 33 27.5 34 40.5 35 56.5 36 72.0 37 84.0 38 98.5 39 128.5 40 138.5 41 143.5 42 157.5 43 161.0 44 177.5 45 175.5 46 161.5 47 170.5 48 176.5 49 166.0 50 149.0 51 132.0 52 124.0 53 133.5 54 143.5 55 142.0 56 140.5 57 140.0 58 147.0 59 159.5 60 174.5 61 154.0 62 117.5 63 107.0 64 104.5 65 103.0 66 91.0 67 83.0 68 77.0 69 71.0 70 67.5 71 64.0 72 60.0 73 56.0 74 51.5 75 43.0 76 32.5 77 26.5 78 21.0 79 15.5 80 13.5 81 8.0 82 3.5 83 4.5 84 4.0 85 2.0 86 3.0 87 3.0 88 1.5 89 1.0 90 1.5 91 1.5 92 1.0 93 2.5 94 2.5 95 0.5 96 0.0 97 0.0 98 1.0 99 5.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 67 2.0 68 1.0 69 1.0 70 3.0 71 7.0 72 24.0 73 56.0 74 250.0 75 912.0 76 2744.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02462801436634 95.525 2 1.616213442791175 3.15 3 0.23088763468445359 0.675 4 0.1026167265264238 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02565418163160595 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725586 spots for SRR11389860.sra Written 725586 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra Read 725583 spots for SRR11389860.sra Written 725583 spots for SRR11389860.sra SRR ids: ['SRR11389860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kdqdzo99 SRR11389860.sra spots: 14511663 blocks: [[1, 725583], [725584, 1451166], [1451167, 2176749], [2176750, 2902332], [2902333, 3627915], [3627916, 4353498], [4353499, 5079081], [5079082, 5804664], [5804665, 6530247], [6530248, 7255830], [7255831, 7981413], [7981414, 8706996], [8706997, 9432579], [9432580, 10158162], [10158163, 10883745], [10883746, 11609328], [11609329, 12334911], [12334912, 13060494], [13060495, 13786077], [13786078, 14511663]] SRR11389860 file size 2757183 SRR11389860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389860 SRR11389860_1.fastq SRR11389860_2.fastq Input file: SRR11389860_1.fastq Paired file: SRR11389860_2.fastq trimmed: SRR11389860-trimmed-pair1.fastq, SRR11389860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:25:13 2024 >> started Sat Dec 7 08:25:30 2024 >> done (17.102s) 14511663 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 26895 ( 0.19%) empty read pairs filtered out after trimming by size control 14484757 (99.81%) read pairs available; of these: 16693 ( 0.12%) trimmed read pairs available after processing 14468064 (99.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 5 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 7 0.00% 32 7 0.00% 33 7 0.00% 34 2 0.00% 35 102 0.00% 36 128 0.00% 37 155 0.00% 38 169 0.00% 39 200 0.00% 40 234 0.00% 41 320 0.00% 42 350 0.00% 43 376 0.00% 44 406 0.00% 45 423 0.00% 46 500 0.00% 47 526 0.00% 48 601 0.00% 49 638 0.00% 50 692 0.00% 51 721 0.00% 52 797 0.01% 53 927 0.01% 54 966 0.01% 55 1051 0.01% 56 1142 0.01% 57 1274 0.01% 58 1420 0.01% 59 1453 0.01% 60 1567 0.01% 61 1658 0.01% 62 1669 0.01% 63 1835 0.01% 64 2022 0.01% 65 2246 0.02% 66 2386 0.02% 67 2611 0.02% 68 2820 0.02% 69 3178 0.02% 70 3548 0.02% 71 4777 0.03% 72 14513 0.10% 73 116480 0.80% 74 970645 6.70% 75 6299587 43.49% 76 7037592 48.59% 14484757 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=42.26 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=15 prefix-density=0.78 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=29.57 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389860 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:25:58 Started mapping on | Dec 07 08:25:58 Finished on | Dec 07 08:27:15 Mapping speed, Million of reads per hour | 677.21 Number of input reads | 14484757 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 12460578 Uniquely mapped reads % | 86.03% Average mapped length | 150.07 Number of splices: Total | 5645060 Number of splices: Annotated (sjdb) | 5414485 Number of splices: GT/AG | 5572038 Number of splices: GC/AG | 65281 Number of splices: AT/AC | 1638 Number of splices: Non-canonical | 6103 Mismatch rate per base, % | 0.97% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1132374 % of reads mapped to multiple loci | 7.82% Number of reads mapped to too many loci | 12566 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891805 891805 891805 N_multimapping 1132374 1132374 1132374 N_noFeature 336414 12166308 420920 N_ambiguous 309548 1199 108695 UnstrandedReadsAssigned:11814616 PositiveStrandReadsAssigned:293071 NegativeStrandReadsAssigned:11930963 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389860-trimmed-pair1.fastq SRR11389860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,484,757 reads, 13,215,496 reads pseudoaligned [quant] estimated average fragment length: 212.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52973 SRR11389860.ke.tsv 35125 SRR11389860.se.tsv 88098 total ==> SRR11389860.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 725.087 0 0 PNS24247 1044 832.948 8.60466 1.0343 PNS24249 1928 1716.95 79.197 4.6183 PNS24246 1044 832.948 8.60466 1.0343 PNS24248 1044 832.948 8.60466 1.0343 PNS24244 1471 1259.95 26.9891 2.1447 PNS24243 293 102.865 0 0 KQK14069 1603 1391.95 208.596 15.0042 KQK14071 474 265.72 23.639 8.90711 ==> SRR11389860.se.tsv <== BRADI_1g14170v3 236 BRADI_1g53295v3 5 BRADI_1g59795v3 92 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 147 BRADI_1g74790v3 154 BRADI_1g09890v3 0 BRADI_1g77505v3 91 BRADI_1g48960v3 0 SRR11389860 completed mapping pipeline successfully