Starting /dee2/code/volunteer_pipeline.sh SRR11389861 current disk space = 1544534065152 free memory = 1602217480 SRR11389861 SRAfilesize 088d59314fbc8f9fb88b963f8a2defaa SRR11389861.sra SRR11389861.sra file validated SRR11389861 is paired end SRR11389861 is conventional basespace SRR11389861 read1 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14525 32.0 32.0 32.0 32.0 32.0 2 31.3665 32.0 32.0 32.0 32.0 32.0 3 31.14475 32.0 32.0 32.0 32.0 32.0 4 31.42 32.0 32.0 32.0 32.0 32.0 5 31.324 32.0 32.0 32.0 32.0 32.0 6 34.0315 36.0 36.0 36.0 32.0 36.0 7 34.1915 36.0 36.0 36.0 32.0 36.0 8 34.2345 36.0 36.0 36.0 32.0 36.0 9 34.3285 36.0 36.0 36.0 32.0 36.0 10-11 34.304375 36.0 36.0 36.0 32.0 36.0 12-13 34.36 36.0 36.0 36.0 32.0 36.0 14-15 34.164 36.0 36.0 36.0 32.0 36.0 16-17 34.176375 36.0 36.0 36.0 32.0 36.0 18-19 34.087875 36.0 36.0 36.0 32.0 36.0 20-21 34.036375 36.0 36.0 36.0 32.0 36.0 22-23 33.92075 36.0 36.0 36.0 32.0 36.0 24-25 33.8225 36.0 36.0 36.0 32.0 36.0 26-27 33.627875 36.0 36.0 36.0 29.5 36.0 28-29 33.421875 36.0 36.0 36.0 27.0 36.0 30-31 33.563500000000005 36.0 36.0 36.0 27.0 36.0 32-33 33.516625000000005 36.0 36.0 36.0 27.0 36.0 34-35 33.518875 36.0 36.0 36.0 27.0 36.0 36-37 33.403999999999996 36.0 36.0 36.0 27.0 36.0 38-39 33.190875 36.0 36.0 36.0 24.0 36.0 40-41 33.224374999999995 36.0 36.0 36.0 27.0 36.0 42-43 33.2115 36.0 36.0 36.0 24.0 36.0 44-45 33.059 36.0 36.0 36.0 20.5 36.0 46-47 33.00875 36.0 34.0 36.0 17.5 36.0 48-49 32.7055 36.0 34.0 36.0 14.0 36.0 50-51 32.75031339084771 36.0 34.0 36.0 14.0 36.0 52-53 32.67632872427093 36.0 34.0 36.0 14.0 36.0 54-55 32.70495495495496 36.0 34.0 36.0 14.0 36.0 56-57 32.808433433433436 36.0 34.0 36.0 14.0 36.0 58-59 32.676551551551555 36.0 32.0 36.0 14.0 36.0 60-61 32.086086086086084 36.0 32.0 36.0 14.0 36.0 62-63 32.07394844782204 36.0 32.0 36.0 14.0 36.0 64-65 31.941372997238282 36.0 32.0 36.0 14.0 36.0 66-67 31.637991485098922 36.0 32.0 36.0 14.0 36.0 68-69 31.54560012720833 36.0 32.0 36.0 14.0 36.0 70-71 31.71963683399261 36.0 32.0 36.0 14.0 36.0 72-73 31.487927487728975 36.0 32.0 36.0 14.0 36.0 74-75 30.999087586459584 36.0 29.5 36.0 14.0 36.0 76 29.962724014336917 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 10.0 25 19.0 26 32.0 27 52.0 28 88.0 29 187.0 30 293.0 31 363.0 32 548.0 33 840.0 34 1152.0 35 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 10.174999999999999 9.225 41.275 2 29.275000000000002 10.075000000000001 36.35 24.3 3 26.450000000000003 16.150000000000002 19.6 37.8 4 33.2 22.7 17.1 27.0 5 31.900000000000002 24.375 21.85 21.875 6 24.671717171717173 29.141414141414142 22.146464646464647 24.04040404040404 7 19.975 22.8 35.025 22.2 8 21.475 19.925 29.825000000000003 28.775000000000002 9 21.125 18.175 32.875 27.825 10-11 25.45 26.5 22.1375 25.912499999999998 12-13 26.275 20.8875 23.225 29.612500000000004 14-15 26.450000000000003 22.900000000000002 24.6125 26.0375 16-17 27.425 22.35 22.15 28.075 18-19 27.3125 22.2125 22.875 27.6 20-21 27.0125 22.8125 23.8875 26.2875 22-23 26.1 23.4125 23.3125 27.175 24-25 26.55 22.5875 22.3625 28.499999999999996 26-27 26.3125 23.2375 23.125 27.325 28-29 27.05 22.662499999999998 22.662499999999998 27.625 30-31 26.25 22.8875 22.8625 28.000000000000004 32-33 26.7625 23.1125 22.6 27.525 34-35 27.125 22.5625 23.125 27.187499999999996 36-37 25.9875 22.4625 23.4625 28.0875 38-39 25.674999999999997 22.2 23.3875 28.7375 40-41 26.64083010376297 23.052881610201275 23.22790348793599 27.078384798099762 42-43 26.81005377016381 22.19582343378767 22.5834688008003 28.410653995248218 44-45 26.8125 22.7375 22.6375 27.8125 46-47 28.549999999999997 22.787499999999998 22.0125 26.650000000000002 48-49 26.875 22.7125 22.25 28.1625 50-51 26.078259782472806 22.802850356294538 22.777847230903863 28.34104263032879 52-53 27.11122231952959 22.38208432378331 22.069310646815964 28.43738270987114 54-55 26.726726726726728 22.785285285285287 23.1981981981982 27.289789789789793 56-57 27.45245245245245 22.535035035035033 22.25975975975976 27.75275275275275 58-59 27.27727727727728 23.0980980980981 23.085585585585587 26.539039039039036 60-61 27.32732732732733 21.97197197197197 21.984484484484483 28.716216216216218 62-63 27.205606307095483 22.387686146915282 22.913277437116754 27.49343010887248 64-65 27.44116174261392 22.84677015523285 21.782674011016525 27.929394091136707 66-67 26.82193839218633 22.852491860756324 22.514400200350615 27.811169546706736 68-69 26.027054108216436 23.04609218436874 22.77054108216433 28.1563126252505 70-71 27.275006267234897 22.699924793181246 22.3614941087992 27.66357483078466 72-73 26.34428913235109 22.654577509129833 22.881249212945473 28.119884145573604 74-75 27.616008509506713 18.77409918893764 23.853211009174313 29.75668129238133 76 31.86379928315412 0.0 28.602150537634408 39.53405017921147 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 2.0 26 1.5 27 2.5 28 6.5 29 10.0 30 13.0 31 15.0 32 18.5 33 20.0 34 24.0 35 34.0 36 54.0 37 70.5 38 80.5 39 96.0 40 99.5 41 125.0 42 151.0 43 147.0 44 154.5 45 169.0 46 169.0 47 166.0 48 165.0 49 158.5 50 155.0 51 150.5 52 140.0 53 135.0 54 139.5 55 130.5 56 122.5 57 122.0 58 120.5 59 139.0 60 155.5 61 145.0 62 133.0 63 133.0 64 125.5 65 126.0 66 131.5 67 129.0 68 128.0 69 115.0 70 97.5 71 92.0 72 78.0 73 64.5 74 62.0 75 57.5 76 45.5 77 32.5 78 24.0 79 22.5 80 20.5 81 15.0 82 10.5 83 4.0 84 2.5 85 3.5 86 3.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0375 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 1.0 51 2.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 4.0 71 7.0 72 19.0 73 59.0 74 283.0 75 829.0 76 2790.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80922219407144 97.5 2 1.064099315936154 2.1 3 0.10134279199391943 0.3 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389861 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.992 32.0 32.0 32.0 32.0 32.0 2 30.77625 32.0 32.0 32.0 32.0 32.0 3 30.54875 32.0 32.0 32.0 32.0 32.0 4 30.583 32.0 32.0 32.0 32.0 32.0 5 30.609 32.0 32.0 32.0 32.0 32.0 6 33.80775 36.0 36.0 36.0 32.0 36.0 7 34.0855 36.0 36.0 36.0 32.0 36.0 8 33.804 36.0 36.0 36.0 32.0 36.0 9 33.82225 36.0 36.0 36.0 32.0 36.0 10-11 33.687375 36.0 36.0 36.0 32.0 36.0 12-13 33.815875 36.0 36.0 36.0 32.0 36.0 14-15 33.538250000000005 36.0 36.0 36.0 26.5 36.0 16-17 33.5895 36.0 36.0 36.0 32.0 36.0 18-19 33.393874999999994 36.0 36.0 36.0 24.0 36.0 20-21 33.482875 36.0 36.0 36.0 27.0 36.0 22-23 33.26375 36.0 36.0 36.0 24.0 36.0 24-25 33.386125 36.0 36.0 36.0 27.0 36.0 26-27 33.297124999999994 36.0 36.0 36.0 24.0 36.0 28-29 33.28175 36.0 36.0 36.0 24.0 36.0 30-31 33.2235 36.0 36.0 36.0 21.0 36.0 32-33 32.9745 36.0 36.0 36.0 14.0 36.0 34-35 33.033625 36.0 36.0 36.0 14.0 36.0 36-37 32.67292762334085 36.0 36.0 36.0 14.0 36.0 38-39 32.63786626596544 36.0 36.0 36.0 14.0 36.0 40-41 32.567117455547205 36.0 34.0 36.0 14.0 36.0 42-43 32.735846693386776 36.0 34.0 36.0 14.0 36.0 44-45 32.47595190380761 36.0 34.0 36.0 14.0 36.0 46-47 32.66482965931864 36.0 36.0 36.0 14.0 36.0 48-49 32.515280561122246 36.0 34.0 36.0 14.0 36.0 50-51 32.14755102161226 36.0 32.0 36.0 14.0 36.0 52-53 31.95999247428925 36.0 32.0 36.0 14.0 36.0 54-55 32.00100300902708 36.0 32.0 36.0 14.0 36.0 56-57 31.887036108324978 36.0 32.0 36.0 14.0 36.0 58-59 31.45354488974825 36.0 32.0 36.0 14.0 36.0 60-61 31.59443190368698 36.0 32.0 36.0 14.0 36.0 62-63 31.120786874955243 36.0 32.0 36.0 14.0 36.0 64-65 31.144898837699014 36.0 32.0 36.0 14.0 36.0 66-67 31.06839859437751 36.0 32.0 36.0 14.0 36.0 68-69 31.077348318436982 36.0 32.0 36.0 14.0 36.0 70-71 31.002971264102236 36.0 32.0 36.0 14.0 36.0 72-73 30.775111461051843 36.0 27.0 36.0 14.0 36.0 74-75 31.03617641336589 36.0 32.0 36.0 14.0 36.0 76 29.45893549524145 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 4.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 3.0 16 6.0 17 2.0 18 2.0 19 6.0 20 3.0 21 5.0 22 10.0 23 18.0 24 23.0 25 43.0 26 67.0 27 107.0 28 132.0 29 185.0 30 288.0 31 388.0 32 516.0 33 758.0 34 1010.0 35 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.38095238095238 18.646616541353385 8.771929824561402 40.20050125313283 2 29.523809523809526 23.609022556390975 27.89473684210526 18.972431077694235 3 26.49122807017544 26.14035087719298 16.99248120300752 30.37593984962406 4 29.9173139564019 29.366073665747933 16.311701327987972 24.40491104986219 5 32.53193087903832 30.753819183571252 16.9045830202855 19.809666917104934 6 24.91860756323566 32.73228149261207 18.281993488605057 24.06711745554721 7 24.141388819252946 16.846327400350965 31.160691902732513 27.851591877663573 8 23.915768362998246 19.4785660566558 24.241664577588367 32.36400100275758 9 24.33517310587055 20.597089814350227 24.310085298544905 30.75765178123432 10-11 28.600150791656194 25.33299824076401 18.635335511435034 27.431515456144762 12-13 27.751256281407034 20.41457286432161 21.94723618090452 29.886934673366834 14-15 26.53241032095658 22.441787287602267 23.57457520453115 27.451227186910003 16-17 28.690071725179312 21.39172014596703 21.832137913678118 28.08607021517554 18-19 27.469485340380018 21.66855417138543 22.750723543475527 28.11123694475903 20-21 27.74144869215292 22.723843058350102 21.906438631790746 27.628269617706238 22-23 28.569632981397685 23.102061337355455 21.279537456008043 27.048768225238813 24-25 28.314917127071826 23.681567051732795 21.057257659467606 26.946258161727776 26-27 28.585782466716907 22.19291635267521 21.61517206731977 27.60612911328812 28-29 27.429073562641225 23.16093396936982 21.328144614612103 28.08184785337685 30-31 27.918654280692945 22.972633693196084 21.102184283203616 28.006527742907355 32-33 27.522590361445783 23.31827309236948 21.536144578313255 27.622991967871485 34-35 28.05674114988702 23.43710770775797 20.863670600050213 27.6424805423048 36-37 27.36749560411957 23.034413463953783 21.32629992464205 28.2717910072846 38-39 27.839839337266227 22.58064516129032 22.17898832684825 27.400527174595208 40-41 28.13912606730286 22.50125565042692 21.64741336012054 27.712204922149674 42-43 27.56024096385542 22.728413654618475 21.900100401606426 27.81124497991968 44-45 27.624309392265197 23.54344550477147 21.433952787543948 27.398292315419386 46-47 28.48355510921416 22.88476023098167 20.888777303540046 27.742907356264123 48-49 28.329571106094807 21.419613744670176 21.8209179834462 28.429897165788816 50-51 27.72339357429719 22.326807228915662 22.188755020080322 27.76104417670683 52-53 27.55589047977895 22.305953278070838 20.93695051494599 29.201205727204222 54-55 28.248019117092188 21.858885674757893 21.267765060998617 28.625330147151303 56-57 28.2154543166373 22.892021142713315 21.193053108482253 27.699471432167126 58-59 27.835830290822106 22.93843635905829 20.773007679717992 28.452725670401612 60-61 27.71205638056884 22.62773722627737 21.38182733450793 28.278379058645857 62-63 29.381378354542022 21.74625173239259 21.947839233967496 26.924530679097895 64-65 28.467061342738383 21.652601083259857 21.992694293991686 27.887643280010078 66-67 27.201811776547558 22.244589833920482 21.917463512833418 28.636134876698538 68-69 26.923076923076923 22.976370035193565 21.74459527400704 28.355957767722472 70-71 27.55281690140845 22.28370221327968 21.265090543259557 28.898390342052316 72-73 28.018223234624145 21.867881548974943 22.513287775246773 27.60060744115414 74-75 27.21569674319274 19.901227976508277 22.610784837159635 30.272290443139347 76 31.09777620896576 0.0 31.09777620896576 37.80444758206848 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 4.0 2 0.5 3 0.5 4 1.0 5 1.0 6 1.0 7 1.5 8 1.5 9 2.0 10 2.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 2.5 24 3.5 25 5.5 26 6.0 27 4.0 28 4.0 29 4.5 30 6.5 31 11.5 32 16.5 33 22.0 34 27.5 35 40.0 36 57.5 37 69.0 38 72.5 39 83.5 40 100.5 41 116.0 42 128.5 43 126.5 44 129.5 45 152.0 46 166.5 47 148.0 48 133.5 49 133.0 50 133.5 51 132.0 52 129.5 53 125.0 54 117.5 55 120.0 56 136.5 57 157.5 58 165.5 59 160.0 60 162.5 61 162.5 62 156.5 63 149.5 64 139.0 65 135.0 66 135.5 67 133.5 68 121.5 69 105.5 70 108.0 71 117.5 72 108.0 73 91.0 74 70.5 75 59.0 76 47.5 77 38.5 78 28.0 79 18.5 80 17.0 81 11.5 82 7.0 83 4.0 84 1.5 85 2.0 86 3.0 87 1.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 4.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.25 4 0.22499999999999998 5 0.17500000000000002 6 0.17500000000000002 7 0.27499999999999997 8 0.27499999999999997 9 0.35000000000000003 10-11 0.525 12-13 0.5 14-15 0.6875 16-17 0.6625 18-19 0.6625 20-21 0.6 22-23 0.5499999999999999 24-25 0.44999999999999996 26-27 0.475 28-29 0.42500000000000004 30-31 0.42500000000000004 32-33 0.4 34-35 0.42500000000000004 36-37 0.30052592036063114 38-39 0.23791635361883295 40-41 0.27548209366391185 42-43 0.2004008016032064 44-45 0.250501002004008 46-47 0.22545090180360722 48-49 0.125250501002004 50-51 0.18789928598271327 52-53 0.188040616773223 54-55 0.31344032096288865 56-57 0.37612838515546637 58-59 0.4012539184952978 60-61 0.3511412089290193 62-63 0.4515238931393453 64-65 0.38895859473023836 66-67 0.25100401606425704 68-69 0.12553351744915892 70-71 0.10050251256281408 72-73 0.11376564277588168 74-75 0.10666666666666667 76 0.14099400775467041 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 2.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 4.0 71 10.0 72 25.0 73 70.0 74 246.0 75 790.0 76 2837.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39080459770115 96.3 2 1.277139208173691 2.5 3 0.28097062579821197 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02554278416347382 0.17500000000000002 8 0.02554278416347382 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782838 spots for SRR11389861.sra Written 1782838 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra Read 1782835 spots for SRR11389861.sra Written 1782835 spots for SRR11389861.sra SRR ids: ['SRR11389861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__zl5iusq SRR11389861.sra spots: 35656703 blocks: [[1, 1782835], [1782836, 3565670], [3565671, 5348505], [5348506, 7131340], [7131341, 8914175], [8914176, 10697010], [10697011, 12479845], [12479846, 14262680], [14262681, 16045515], [16045516, 17828350], [17828351, 19611185], [19611186, 21394020], [21394021, 23176855], [23176856, 24959690], [24959691, 26742525], [26742526, 28525360], [28525361, 30308195], [30308196, 32091030], [32091031, 33873865], [33873866, 35656703]] SRR11389861 file size 6805357 SRR11389861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389861 SRR11389861_1.fastq SRR11389861_2.fastq Input file: SRR11389861_1.fastq Paired file: SRR11389861_2.fastq trimmed: SRR11389861-trimmed-pair1.fastq, SRR11389861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:28:05 2024 >> started Sat Dec 7 08:28:34 2024 >> done (29.217s) 35656703 read pairs processed; of these: 284 ( 0.00%) short read pairs filtered out after trimming by size control 40169 ( 0.11%) empty read pairs filtered out after trimming by size control 35616250 (99.89%) read pairs available; of these: 16177 ( 0.05%) trimmed read pairs available after processing 35600073 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 4 0.00% 23 10 0.00% 24 16 0.00% 25 19 0.00% 26 13 0.00% 27 14 0.00% 28 27 0.00% 29 23 0.00% 30 29 0.00% 31 34 0.00% 32 27 0.00% 33 35 0.00% 34 33 0.00% 35 507 0.00% 36 601 0.00% 37 692 0.00% 38 733 0.00% 39 822 0.00% 40 1054 0.00% 41 1135 0.00% 42 1173 0.00% 43 1320 0.00% 44 1501 0.00% 45 1516 0.00% 46 1546 0.00% 47 1797 0.01% 48 1831 0.01% 49 1992 0.01% 50 2315 0.01% 51 2427 0.01% 52 2708 0.01% 53 2975 0.01% 54 3200 0.01% 55 3640 0.01% 56 3917 0.01% 57 4214 0.01% 58 4714 0.01% 59 4974 0.01% 60 5280 0.01% 61 5642 0.02% 62 6272 0.02% 63 6929 0.02% 64 7488 0.02% 65 8001 0.02% 66 8859 0.02% 67 9619 0.03% 68 9645 0.03% 69 10807 0.03% 70 12743 0.04% 71 16678 0.05% 72 38945 0.11% 73 272586 0.77% 74 2272804 6.38% 75 14983409 42.07% 76 17886933 50.22% 35616250 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=5.75 fanout-score-rank=8 prefix-density=0.62 prefix-fanout=4.2 sequence=AGGTTCTCGAGGGGACCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=38 fanout-score=9.43 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=2.4 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=3.1 sequence=TGGGCCATGCTCGGCGC criterion=fanout-score sequence-density=0.22 sequence-density-rank=16 fanout-score=80.02 fanout-score-rank=1 prefix-density=1.28 prefix-fanout=13.9 sequence=GCCGCCGCCGCCTCCACCGTCTCCGGCCTCGCCGGCGCCACCCTGGCCCGCCGGCCAGCCTTCTCTACCAACTTCACGACGGGTGGCCGGGTGTCAGCGAGGAACCCCTTGATGACGAGGAACCTGGAGAGGAACGGCAGGAT SRR11389861 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:29:07 Started mapping on | Dec 07 08:29:08 Finished on | Dec 07 08:31:12 Mapping speed, Million of reads per hour | 1034.02 Number of input reads | 35616250 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 33451515 Uniquely mapped reads % | 93.92% Average mapped length | 150.27 Number of splices: Total | 14242322 Number of splices: Annotated (sjdb) | 13669287 Number of splices: GT/AG | 14054221 Number of splices: GC/AG | 166766 Number of splices: AT/AC | 3565 Number of splices: Non-canonical | 17770 Mismatch rate per base, % | 0.85% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 883099 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 69920 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1281636 1281636 1281636 N_multimapping 883099 883099 883099 N_noFeature 709127 32655030 915250 N_ambiguous 748522 2827 162032 UnstrandedReadsAssigned:31993866 PositiveStrandReadsAssigned:793658 NegativeStrandReadsAssigned:32374233 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389861-trimmed-pair1.fastq SRR11389861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,616,250 reads, 32,890,704 reads pseudoaligned [quant] estimated average fragment length: 200.384 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR11389861.ke.tsv 35125 SRR11389861.se.tsv 88098 total ==> SRR11389861.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 736.781 0 0 PNS24247 1044 844.616 48.4962 2.29189 PNS24249 1928 1728.62 200.187 4.62258 PNS24246 1044 844.616 48.4962 2.29189 PNS24248 1044 844.616 48.4962 2.29189 PNS24244 1471 1271.62 25.324 0.794919 PNS24243 293 111.114 0 0 KQK14069 1603 1403.62 9776.11 278.012 KQK14071 474 277.096 813.566 117.195 ==> SRR11389861.se.tsv <== BRADI_1g14170v3 11501 BRADI_1g53295v3 14 BRADI_1g59795v3 690 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 296 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 349 BRADI_1g48960v3 0 SRR11389861 completed mapping pipeline successfully