Starting /dee2/code/volunteer_pipeline.sh SRR11389862 current disk space = 1544525852672 free memory = 1603923660 SRR11389862 SRAfilesize fc7d638179bdcf13198987e6bf5f8962 SRR11389862.sra SRR11389862.sra file validated SRR11389862 is paired end SRR11389862 is conventional basespace SRR11389862 read1 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.234 32.0 32.0 32.0 32.0 32.0 2 31.30725 32.0 32.0 32.0 32.0 32.0 3 31.11575 32.0 32.0 32.0 32.0 32.0 4 31.3295 32.0 32.0 32.0 32.0 32.0 5 31.41625 32.0 32.0 32.0 32.0 32.0 6 34.20925 36.0 36.0 36.0 32.0 36.0 7 34.579 36.0 36.0 36.0 32.0 36.0 8 34.2415 36.0 36.0 36.0 32.0 36.0 9 34.34075 36.0 36.0 36.0 32.0 36.0 10-11 34.35875 36.0 36.0 36.0 32.0 36.0 12-13 34.269 36.0 36.0 36.0 32.0 36.0 14-15 34.181375 36.0 36.0 36.0 32.0 36.0 16-17 34.242625000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.141875 36.0 36.0 36.0 32.0 36.0 20-21 34.089875000000006 36.0 36.0 36.0 32.0 36.0 22-23 33.965125 36.0 36.0 36.0 32.0 36.0 24-25 33.82525 36.0 36.0 36.0 32.0 36.0 26-27 33.651875000000004 36.0 36.0 36.0 29.5 36.0 28-29 33.660375 36.0 36.0 36.0 29.5 36.0 30-31 33.55575 36.0 36.0 36.0 27.0 36.0 32-33 33.61125 36.0 36.0 36.0 27.0 36.0 34-35 33.52725 36.0 36.0 36.0 27.0 36.0 36-37 33.477875 36.0 36.0 36.0 27.0 36.0 38-39 33.337875 36.0 36.0 36.0 27.0 36.0 40-41 33.341125 36.0 36.0 36.0 20.5 36.0 42-43 33.34675 36.0 36.0 36.0 27.0 36.0 44-45 33.148625 36.0 36.0 36.0 21.0 36.0 46-47 33.170874999999995 36.0 36.0 36.0 24.0 36.0 48-49 32.833625 36.0 36.0 36.0 17.5 36.0 50-51 32.92975 36.0 36.0 36.0 17.5 36.0 52-53 32.86024999999999 36.0 36.0 36.0 21.0 36.0 54-55 32.4926918292073 36.0 32.0 36.0 14.0 36.0 56-57 32.81400275638086 36.0 32.0 36.0 14.0 36.0 58-59 32.64010507880911 36.0 32.0 36.0 14.0 36.0 60-61 32.04716037027771 36.0 32.0 36.0 14.0 36.0 62-63 31.931690196576362 36.0 32.0 36.0 14.0 36.0 64-65 31.81906906906907 36.0 32.0 36.0 14.0 36.0 66-67 31.72147147147147 36.0 32.0 36.0 14.0 36.0 68-69 31.57882882882883 36.0 32.0 36.0 14.0 36.0 70-71 31.5878818227341 36.0 32.0 36.0 14.0 36.0 72-73 31.499350917214326 36.0 32.0 36.0 14.0 36.0 74-75 31.073072956748675 36.0 32.0 36.0 14.0 36.0 76 30.14722822174226 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 3.0 24 8.0 25 18.0 26 22.0 27 61.0 28 108.0 29 169.0 30 246.0 31 371.0 32 548.0 33 832.0 34 1182.0 35 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35 9.55 10.4 40.699999999999996 2 27.224999999999998 11.525 35.199999999999996 26.05 3 25.2 17.525 21.175 36.1 4 30.275000000000002 26.174999999999997 17.925 25.624999999999996 5 29.125 26.950000000000003 22.2 21.725 6 24.344096871846617 29.036326942482344 23.385469223007064 23.234106962663976 7 16.675 24.575 35.85 22.900000000000002 8 19.925 22.225 30.45 27.400000000000002 9 20.525 19.15 32.800000000000004 27.525 10-11 24.575 28.449999999999996 22.5625 24.4125 12-13 24.337500000000002 22.675 25.525 27.462500000000002 14-15 24.15 24.3125 25.25 26.2875 16-17 25.074999999999996 24.3875 23.5625 26.974999999999998 18-19 24.0625 24.2875 24.825 26.825 20-21 25.124999999999996 23.7875 25.0 26.087500000000002 22-23 24.775 24.725 24.3 26.200000000000003 24-25 23.9875 24.3875 24.4125 27.212500000000002 26-27 23.1875 25.724999999999998 24.637500000000003 26.450000000000003 28-29 24.762500000000003 24.712500000000002 23.45 27.075 30-31 24.625 23.625 24.837500000000002 26.9125 32-33 24.775 24.2875 24.2375 26.700000000000003 34-35 24.4 24.4875 23.7875 27.325 36-37 24.325 24.4875 24.762500000000003 26.424999999999997 38-39 24.349999999999998 23.974999999999998 24.887500000000003 26.787499999999998 40-41 24.72809101137642 24.815601950243778 23.465433179147393 26.990873859232405 42-43 25.29066133266658 23.627953494186773 24.803100387548444 26.2782847855982 44-45 24.32804100512564 24.090511313914238 25.453181647705964 26.128266033254157 46-47 25.137500000000003 24.55 24.2375 26.075 48-49 25.174999999999997 23.9 23.525 27.400000000000002 50-51 24.762500000000003 24.15 24.75 26.337500000000002 52-53 25.0125 24.1875 23.8375 26.9625 54-55 24.978122265283158 24.0780097512189 24.04050506313289 26.903362920365048 56-57 24.349674837418707 23.911955977988995 23.724362181090545 28.01400700350175 58-59 25.143857893420062 24.468351263447584 24.568426319739807 25.819364523392547 60-61 25.74430823117338 24.26820115086315 23.642732049036777 26.344758568926697 62-63 25.572375828850248 24.721631427499062 23.4204929313149 26.285499812335793 64-65 25.613113113113112 23.973973973973976 23.94894894894895 26.463963963963966 66-67 25.55055055055055 24.624624624624623 23.76126126126126 26.063563563563562 68-69 24.86236236236236 23.623623623623622 24.94994994994995 26.564064064064063 70-71 25.97646469704557 23.685528292438658 23.673009514271406 26.664997496244368 72-73 24.754963558683084 24.013571249057552 24.36541844684594 26.86604674541342 74-75 26.227115945874235 21.119660387370658 25.669938975855665 26.983284690899445 76 27.789776817854573 0.0 34.12526997840173 38.0849532037437 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 2.0 24 4.0 25 5.5 26 5.0 27 8.0 28 12.0 29 11.0 30 17.0 31 24.0 32 29.5 33 36.5 34 37.5 35 48.0 36 75.0 37 94.0 38 112.0 39 123.0 40 134.5 41 171.5 42 185.5 43 194.0 44 209.5 45 217.0 46 218.0 47 210.0 48 206.5 49 187.0 50 173.0 51 168.5 52 152.5 53 143.0 54 139.0 55 132.0 56 122.5 57 113.5 58 105.0 59 101.0 60 107.0 61 107.5 62 102.5 63 91.5 64 84.0 65 92.5 66 86.0 67 74.0 68 74.0 69 75.0 70 67.0 71 60.5 72 63.0 73 49.5 74 31.5 75 25.0 76 30.0 77 33.0 78 26.0 79 22.5 80 17.0 81 8.5 82 5.0 83 5.0 84 3.5 85 2.0 86 1.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8999999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0125 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 2.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 2.0 70 0.0 71 5.0 72 20.0 73 60.0 74 280.0 75 851.0 76 2778.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.025 0.0 0.0 53 0.0 0.0 0.025 0.0 0.0 54 0.0 0.0 0.025 0.0 0.0 55 0.0 0.0 0.025 0.0 0.0 56 0.0 0.0 0.025 0.0 0.0 57 0.0 0.0 0.025 0.0 0.0 58 0.0 0.0 0.025 0.0 0.0 59 0.0 0.0 0.025 0.0 0.0 60 0.0 0.0 0.025 0.0 0.0 61 0.0 0.0 0.025 0.0 0.0 62 0.0 0.0 0.025 0.0 0.0 63 0.0 0.0 0.025 0.0 0.0 64 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389862 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3795 32.0 32.0 32.0 27.0 32.0 2 30.11425 32.0 32.0 32.0 21.0 32.0 3 29.7335 32.0 32.0 32.0 14.0 32.0 4 29.7445 32.0 32.0 32.0 21.0 32.0 5 29.80675 32.0 32.0 32.0 21.0 32.0 6 32.83225 36.0 36.0 36.0 21.0 36.0 7 33.0805 36.0 36.0 36.0 21.0 36.0 8 32.8125 36.0 32.0 36.0 21.0 36.0 9 32.76425 36.0 32.0 36.0 14.0 36.0 10-11 32.681625 36.0 32.0 36.0 14.0 36.0 12-13 32.589125 36.0 34.0 36.0 14.0 36.0 14-15 32.4375 36.0 32.0 36.0 14.0 36.0 16-17 32.563500000000005 36.0 32.0 36.0 14.0 36.0 18-19 32.074875 36.0 32.0 36.0 14.0 36.0 20-21 32.262625 36.0 32.0 36.0 14.0 36.0 22-23 32.239999999999995 36.0 32.0 36.0 14.0 36.0 24-25 32.254875 36.0 32.0 36.0 14.0 36.0 26-27 32.2085 36.0 32.0 36.0 14.0 36.0 28-29 32.0535 36.0 32.0 36.0 14.0 36.0 30-31 31.9715 36.0 32.0 36.0 14.0 36.0 32-33 31.86575 36.0 32.0 36.0 14.0 36.0 34-35 31.832625 36.0 32.0 36.0 14.0 36.0 36-37 31.44199547476138 36.0 32.0 36.0 14.0 36.0 38-39 31.507273639327813 36.0 32.0 36.0 14.0 36.0 40-41 31.448582894406822 36.0 32.0 36.0 14.0 36.0 42-43 31.446186653286503 36.0 32.0 36.0 14.0 36.0 44-45 31.260662318113397 36.0 32.0 36.0 14.0 36.0 46-47 31.470639899623592 36.0 32.0 36.0 14.0 36.0 48-49 31.21430363864492 36.0 32.0 36.0 14.0 36.0 50-51 30.76474278544542 36.0 29.5 36.0 14.0 36.0 52-53 30.605269761606024 36.0 27.0 36.0 14.0 36.0 54-55 30.74025701299552 36.0 32.0 36.0 14.0 36.0 56-57 30.614289413491274 36.0 27.0 36.0 14.0 36.0 58-59 30.253828772282198 36.0 27.0 36.0 14.0 36.0 60-61 30.171980918905348 36.0 27.0 36.0 14.0 36.0 62-63 29.84283231988084 36.0 27.0 36.0 14.0 36.0 64-65 30.11162732295329 36.0 27.0 36.0 14.0 36.0 66-67 29.697388247112002 36.0 27.0 36.0 14.0 36.0 68-69 29.848317428427926 36.0 27.0 36.0 14.0 36.0 70-71 29.878989695903492 36.0 27.0 36.0 14.0 36.0 72-73 29.449039469433348 36.0 27.0 36.0 14.0 36.0 74-75 29.698343201804583 36.0 27.0 36.0 14.0 36.0 76 28.312072072072073 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 3.0 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 5.0 16 5.0 17 2.0 18 2.0 19 4.0 20 9.0 21 13.0 22 12.0 23 38.0 24 58.0 25 82.0 26 123.0 27 177.0 28 253.0 29 313.0 30 403.0 31 510.0 32 603.0 33 665.0 34 570.0 35 130.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.6847389558233 19.427710843373493 10.642570281124499 36.24497991967871 2 29.89457831325301 24.673694779116463 27.660642570281123 17.771084337349397 3 25.502008032128515 27.86144578313253 20.130522088353413 26.506024096385545 4 30.037641154328732 31.56838143036386 17.063989962358846 21.329987452948558 5 30.616850551654966 32.62286860581745 17.9037111334002 18.85656970912738 6 23.620862587763288 34.25275827482447 19.332998996990973 22.793380140421263 7 22.774015550539254 16.077251065964386 35.96689240030098 25.181840983195386 8 24.11543287327478 20.65244667503137 24.943538268506902 30.288582183186954 9 23.712635016327553 20.89927153981412 26.80231097714142 28.585782466716907 10-11 28.165114523030454 25.975333501132646 20.51346589478983 25.34608608104707 12-13 27.491192752893813 20.986411675893308 23.968293910417714 27.554101660795165 14-15 26.2441728612826 23.850321280080635 23.094368149174752 26.811137709462013 16-17 28.378889028844945 23.831716840911955 21.50144854515682 26.28794558508628 18-19 26.077097505668934 24.011085915847822 23.368606701940035 26.543209876543212 20-21 28.170255635310415 23.447928472484573 22.616798891827226 25.76501700037779 22-23 28.02467581518318 23.92043308573587 23.139871585043434 24.915019514037517 24-25 27.67295597484277 24.60377358490566 22.41509433962264 25.30817610062893 26-27 27.689017486476285 23.86463706126557 22.518555793181534 25.927789659076613 28-29 27.461335345152772 24.292719728404375 22.582673205079846 25.663271721363007 30-31 26.936619718309856 23.365191146881287 23.18913480885312 26.509054325955734 32-33 26.967563490067892 23.81191853155645 23.258737742016596 25.96178023635907 34-35 27.705845380263984 23.557510999371463 23.016970458830922 25.719673161533628 36-37 27.116086026914854 24.688718400201232 22.626084769211417 25.569110803672494 38-39 27.44186046511628 23.683218101822753 23.104965430546827 25.769956002514142 40-41 27.324191722229212 24.11624103660838 22.367593407975846 26.191973833186566 42-43 27.023629964806435 24.296128707893413 23.127199597787833 25.553041729512316 44-45 27.804325955734406 24.72334004024145 22.22082494969819 25.251509054325954 46-47 27.13782696177062 24.245472837022135 22.962776659959758 25.653923541247487 48-49 26.927907560914342 24.08942476764632 23.222808339613163 25.759859331826174 50-51 27.463549522373054 24.32126696832579 22.09653092006033 26.118652589240828 52-53 28.138745758451677 23.840643458589923 22.722131456579113 25.298479326379287 54-55 26.733794839521714 23.738200125865326 23.38577721837634 26.14222781623663 56-57 26.8639798488665 24.811083123425693 22.3551637279597 25.969773299748113 58-59 28.267170762444866 23.67989918084436 23.1758034026465 24.87712665406427 60-61 27.29906777525825 23.406399596875787 23.28042328042328 26.014109347442684 62-63 27.209683520363132 24.29706216113983 22.052704576976424 26.440549741520613 64-65 28.593040847201213 24.00403429147756 21.50781643973777 25.89510842158346 66-67 27.366565961732125 23.615307150050352 22.98590130916415 26.032225579053375 68-69 26.48315736551031 23.893916540975365 23.9693313222725 25.653594771241828 70-71 27.811320754716984 23.245283018867923 23.11949685534591 25.82389937106918 72-73 26.94300518134715 24.01112094022495 23.366611904461013 25.679261973966888 74-75 27.243717590745913 20.050525196117537 24.571200638213003 28.134556574923547 76 30.24178996752075 0.0 32.04619271021292 37.71201732226633 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.5 4 1.5 5 2.5 6 3.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 1.0 23 1.5 24 4.0 25 4.0 26 4.5 27 6.0 28 9.0 29 13.0 30 13.0 31 15.0 32 26.5 33 38.0 34 42.0 35 46.0 36 58.5 37 70.0 38 88.0 39 113.0 40 125.0 41 147.0 42 176.5 43 193.5 44 192.0 45 176.0 46 171.5 47 176.5 48 177.0 49 167.5 50 159.0 51 145.5 52 132.5 53 125.0 54 118.0 55 125.0 56 125.5 57 120.0 58 120.5 59 128.0 60 133.5 61 134.5 62 135.5 63 122.5 64 102.5 65 105.0 66 98.5 67 83.5 68 92.0 69 93.0 70 81.5 71 73.0 72 68.0 73 58.0 74 50.0 75 48.5 76 41.5 77 34.0 78 25.5 79 18.0 80 17.5 81 12.0 82 8.0 83 9.0 84 6.5 85 3.5 86 3.5 87 3.5 88 1.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.4 3 0.4 4 0.375 5 0.3 6 0.3 7 0.325 8 0.375 9 0.475 10-11 0.675 12-13 0.65 14-15 0.7875 16-17 0.7625 18-19 0.775 20-21 0.7374999999999999 22-23 0.7125 24-25 0.625 26-27 0.6375 28-29 0.5875 30-31 0.6 32-33 0.575 34-35 0.5625 36-37 0.3009404388714733 38-39 0.2382743917732631 40-41 0.3135189365437672 42-43 0.2007024586051179 44-45 0.2508780732563974 46-47 0.2258469259723965 48-49 0.10037641154328732 50-51 0.17565872020075282 52-53 0.16311166875784192 54-55 0.3011670222110679 56-57 0.33889795406049955 58-59 0.3891539040923927 60-61 0.35149384885764495 62-63 0.42686754551161327 64-65 0.4018081366147665 66-67 0.25113008538422904 68-69 0.10045203415369162 70-71 0.10052777079668257 72-73 0.12621481761958853 74-75 0.10625581086465667 76 0.14414414414414414 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 12.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 3.0 70 0.0 71 9.0 72 17.0 73 57.0 74 263.0 75 858.0 76 2775.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59718026183283 98.9 2 0.3272910372608258 0.65 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACTGC 15 0.0021118813 69.6125 31 >>END_MODULE Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353288 spots for SRR11389862.sra Written 1353288 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra Read 1353269 spots for SRR11389862.sra Written 1353269 spots for SRR11389862.sra SRR ids: ['SRR11389862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3542uju_ SRR11389862.sra spots: 27065399 blocks: [[1, 1353269], [1353270, 2706538], [2706539, 4059807], [4059808, 5413076], [5413077, 6766345], [6766346, 8119614], [8119615, 9472883], [9472884, 10826152], [10826153, 12179421], [12179422, 13532690], [13532691, 14885959], [14885960, 16239228], [16239229, 17592497], [17592498, 18945766], [18945767, 20299035], [20299036, 21652304], [21652305, 23005573], [23005574, 24358842], [24358843, 25712111], [25712112, 27065399]] SRR11389862 file size 5161097 SRR11389862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389862 SRR11389862_1.fastq SRR11389862_2.fastq Input file: SRR11389862_1.fastq Paired file: SRR11389862_2.fastq trimmed: SRR11389862-trimmed-pair1.fastq, SRR11389862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:29:16 2024 >> started Sat Dec 7 08:29:37 2024 >> done (21.911s) 27065399 read pairs processed; of these: 216 ( 0.00%) short read pairs filtered out after trimming by size control 20031 ( 0.07%) empty read pairs filtered out after trimming by size control 27045152 (99.93%) read pairs available; of these: 8258 ( 0.03%) trimmed read pairs available after processing 27036894 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 5 0.00% 21 5 0.00% 22 6 0.00% 23 9 0.00% 24 7 0.00% 25 8 0.00% 26 10 0.00% 27 11 0.00% 28 14 0.00% 29 7 0.00% 30 7 0.00% 31 10 0.00% 32 9 0.00% 33 13 0.00% 34 14 0.00% 35 220 0.00% 36 226 0.00% 37 235 0.00% 38 286 0.00% 39 349 0.00% 40 411 0.00% 41 472 0.00% 42 453 0.00% 43 500 0.00% 44 568 0.00% 45 632 0.00% 46 630 0.00% 47 720 0.00% 48 730 0.00% 49 854 0.00% 50 938 0.00% 51 995 0.00% 52 1088 0.00% 53 1178 0.00% 54 1311 0.00% 55 1498 0.01% 56 1602 0.01% 57 1808 0.01% 58 1949 0.01% 59 2113 0.01% 60 2292 0.01% 61 2347 0.01% 62 2556 0.01% 63 2861 0.01% 64 3238 0.01% 65 3450 0.01% 66 3904 0.01% 67 4133 0.02% 68 4241 0.02% 69 4731 0.02% 70 5838 0.02% 71 7809 0.03% 72 24207 0.09% 73 217805 0.81% 74 1870705 6.92% 75 11777191 43.55% 76 13085932 48.39% 27045152 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.49 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=3.9 sequence=ACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=164.40 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=18.1 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=17 prefix-density=0.32 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=193.91 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=20.9 sequence=CCGCCGCCGCCTCC SRR11389862 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:30:08 Started mapping on | Dec 07 08:30:09 Finished on | Dec 07 08:32:07 Mapping speed, Million of reads per hour | 825.11 Number of input reads | 27045152 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 24866615 Uniquely mapped reads % | 91.94% Average mapped length | 150.07 Number of splices: Total | 11207811 Number of splices: Annotated (sjdb) | 10716834 Number of splices: GT/AG | 11052835 Number of splices: GC/AG | 135324 Number of splices: AT/AC | 4598 Number of splices: Non-canonical | 15054 Mismatch rate per base, % | 1.09% Deletion rate per base | 0.01% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 947809 % of reads mapped to multiple loci | 3.50% Number of reads mapped to too many loci | 45118 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1230728 1230728 1230728 N_multimapping 947809 947809 947809 N_noFeature 746694 24242771 915199 N_ambiguous 592475 2930 146131 UnstrandedReadsAssigned:23527446 PositiveStrandReadsAssigned:620914 NegativeStrandReadsAssigned:23805285 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389862-trimmed-pair1.fastq SRR11389862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,045,152 reads, 24,635,865 reads pseudoaligned [quant] estimated average fragment length: 214.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR11389862.ke.tsv 35125 SRR11389862.se.tsv 88098 total ==> SRR11389862.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.945 0 0 PNS24247 1044 830.717 44.6706 3.04441 PNS24249 1928 1714.72 289.554 9.56031 PNS24246 1044 830.717 44.6706 3.04441 PNS24248 1044 830.717 44.6706 3.04441 PNS24244 1471 1257.72 63.434 2.85544 PNS24243 293 99.4774 1 0.569129 KQK14069 1603 1389.72 3051.29 124.306 KQK14071 474 263.368 257.57 55.3692 ==> SRR11389862.se.tsv <== BRADI_1g14170v3 3541 BRADI_1g53295v3 19 BRADI_1g59795v3 417 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 391 BRADI_1g74790v3 329 BRADI_1g09890v3 2 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR11389862 completed mapping pipeline successfully