Starting /dee2/code/volunteer_pipeline.sh SRR11389863 current disk space = 1544523538432 free memory = 1597537652 SRR11389863 SRAfilesize 39e6c54b152733fbdc3dd22d1fd11e65 SRR11389863.sra SRR11389863.sra file validated SRR11389863 is paired end SRR11389863 is conventional basespace SRR11389863 read1 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2875 32.0 32.0 32.0 32.0 32.0 2 31.35175 32.0 32.0 32.0 32.0 32.0 3 31.28775 32.0 32.0 32.0 32.0 32.0 4 31.47225 32.0 32.0 32.0 32.0 32.0 5 31.51375 32.0 32.0 32.0 32.0 32.0 6 34.191 36.0 36.0 36.0 32.0 36.0 7 34.5475 36.0 36.0 36.0 32.0 36.0 8 34.52 36.0 36.0 36.0 32.0 36.0 9 34.38225 36.0 36.0 36.0 32.0 36.0 10-11 34.4695 36.0 36.0 36.0 32.0 36.0 12-13 34.370375 36.0 36.0 36.0 32.0 36.0 14-15 34.532624999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.335750000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.247625 36.0 36.0 36.0 32.0 36.0 20-21 34.206875 36.0 36.0 36.0 32.0 36.0 22-23 34.05475 36.0 36.0 36.0 32.0 36.0 24-25 33.990375 36.0 36.0 36.0 32.0 36.0 26-27 33.8305 36.0 36.0 36.0 32.0 36.0 28-29 33.704625 36.0 36.0 36.0 29.5 36.0 30-31 33.757374999999996 36.0 36.0 36.0 32.0 36.0 32-33 33.75025 36.0 36.0 36.0 32.0 36.0 34-35 33.758875 36.0 36.0 36.0 32.0 36.0 36-37 33.75475 36.0 36.0 36.0 32.0 36.0 38-39 33.55375 36.0 36.0 36.0 29.5 36.0 40-41 33.625625 36.0 36.0 36.0 29.5 36.0 42-43 33.515375 36.0 36.0 36.0 29.5 36.0 44-45 33.36 36.0 36.0 36.0 27.0 36.0 46-47 33.3295 36.0 36.0 36.0 24.0 36.0 48-49 33.000875 36.0 36.0 36.0 21.0 36.0 50-51 33.135000000000005 36.0 36.0 36.0 17.5 36.0 52-53 32.9808729989995 36.0 36.0 36.0 21.0 36.0 54-55 32.935967983992 36.0 36.0 36.0 17.5 36.0 56-57 32.98649324662331 36.0 36.0 36.0 14.0 36.0 58-59 32.96985992996498 36.0 36.0 36.0 17.5 36.0 60-61 32.39445396735239 36.0 32.0 36.0 14.0 36.0 62-63 32.20650092786238 36.0 32.0 36.0 14.0 36.0 64-65 32.175262894341515 36.0 32.0 36.0 14.0 36.0 66-67 31.978217325988982 36.0 32.0 36.0 14.0 36.0 68-69 31.897570748810416 36.0 32.0 36.0 14.0 36.0 70-71 31.891935542760955 36.0 32.0 36.0 14.0 36.0 72-73 31.664594689299253 36.0 32.0 36.0 14.0 36.0 74-75 31.39730037600699 36.0 32.0 36.0 14.0 36.0 76 30.26046176046176 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 10.0 25 10.0 26 33.0 27 58.0 28 72.0 29 154.0 30 200.0 31 326.0 32 514.0 33 858.0 34 1248.0 35 513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 10.299999999999999 10.975 40.5 2 28.425 10.925 37.175000000000004 23.474999999999998 3 27.525 17.175 19.925 35.375 4 31.125000000000004 23.65 19.225 26.0 5 29.599999999999998 26.474999999999998 22.825 21.099999999999998 6 24.21264802217183 28.26908541194256 24.691358024691358 22.826908541194253 7 18.625 22.85 37.2 21.325 8 20.075000000000003 21.875 30.15 27.900000000000002 9 21.7 19.3 31.175000000000004 27.825 10-11 24.1375 28.5625 22.9625 24.337500000000002 12-13 25.2125 22.7 24.425 27.6625 14-15 24.575 24.3125 24.7875 26.325 16-17 25.7375 23.05 24.8125 26.400000000000002 18-19 25.324999999999996 23.0125 23.6875 27.975 20-21 24.8125 23.4875 25.112499999999997 26.5875 22-23 24.6125 24.425 24.125 26.8375 24-25 25.35 25.074999999999996 22.975 26.6 26-27 24.525 23.724999999999998 24.875 26.875 28-29 25.374999999999996 24.425 23.8125 26.387500000000003 30-31 24.762500000000003 23.125 24.637500000000003 27.474999999999998 32-33 25.387500000000003 23.025000000000002 24.95 26.637499999999996 34-35 24.85 24.1625 24.5 26.487500000000004 36-37 25.7125 23.3125 24.0125 26.9625 38-39 25.0125 23.724999999999998 24.05 27.212500000000002 40-41 25.378172271533945 23.76547068383548 24.56557069633704 26.290786348293537 42-43 25.818954738684667 23.493373343335833 24.20605151287822 26.481620405101275 44-45 24.95 24.45 23.95 26.650000000000002 46-47 25.45 24.625 23.5875 26.337500000000002 48-49 25.025 24.15 23.4875 27.3375 50-51 25.174999999999997 23.95 23.974999999999998 26.900000000000002 52-53 25.84396099024756 23.593398349587396 23.143285821455365 27.419354838709676 54-55 25.275137568784395 23.649324662331164 23.486743371685844 27.5887943971986 56-57 25.0 23.649324662331164 24.787393696848426 26.563281640820406 58-59 25.48774387193597 23.84942471235618 23.67433716858429 26.988494247123562 60-61 26.710872013011382 23.245339672213188 23.88339797322657 26.160390341548855 62-63 25.359869821003883 23.357116034547502 24.521216672925274 26.761797471523348 64-65 26.051577366049074 23.222333500250375 24.123685528292437 26.602403605408114 66-67 25.63845768652979 22.959439158738107 24.111166750125186 27.290936404606907 68-69 25.65740045078888 23.115452041071876 24.60555972952667 26.62158777861257 70-71 25.53537883531622 23.84470882905448 24.232936756418283 26.38697557921102 72-73 26.298578795120108 23.695132687712235 23.544208275688593 26.462080241479057 74-75 25.95823420565689 19.49510970129527 25.852498017446475 28.694158075601372 76 28.1024531024531 0.0 33.477633477633475 38.41991341991342 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 3.0 25 4.5 26 6.5 27 8.5 28 8.5 29 8.5 30 12.5 31 23.5 32 31.5 33 31.5 34 41.5 35 53.5 36 63.5 37 74.5 38 95.5 39 136.0 40 161.5 41 171.0 42 171.5 43 170.5 44 188.5 45 190.5 46 181.5 47 200.5 48 215.5 49 194.5 50 171.0 51 164.5 52 150.0 53 145.5 54 151.5 55 135.5 56 116.0 57 117.0 58 123.0 59 111.0 60 100.0 61 93.5 62 86.0 63 100.5 64 116.0 65 108.0 66 98.0 67 98.0 68 100.5 69 94.0 70 79.0 71 71.5 72 59.5 73 40.5 74 41.0 75 45.0 76 32.5 77 28.5 78 25.5 79 19.5 80 18.5 81 9.0 82 3.5 83 5.0 84 6.0 85 4.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.775 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 1.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 1.0 71 5.0 72 23.0 73 55.0 74 252.0 75 885.0 76 2772.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389863 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.87375 32.0 32.0 32.0 32.0 32.0 2 30.869 32.0 32.0 32.0 32.0 32.0 3 30.60425 32.0 32.0 32.0 32.0 32.0 4 30.5565 32.0 32.0 32.0 32.0 32.0 5 30.5845 32.0 32.0 32.0 32.0 32.0 6 33.733 36.0 36.0 36.0 32.0 36.0 7 33.83375 36.0 36.0 36.0 32.0 36.0 8 33.75775 36.0 36.0 36.0 32.0 36.0 9 33.867 36.0 36.0 36.0 32.0 36.0 10-11 33.694374999999994 36.0 36.0 36.0 32.0 36.0 12-13 33.691375 36.0 36.0 36.0 32.0 36.0 14-15 33.533874999999995 36.0 36.0 36.0 26.5 36.0 16-17 33.50975 36.0 36.0 36.0 26.5 36.0 18-19 33.334875 36.0 36.0 36.0 24.0 36.0 20-21 33.33175 36.0 36.0 36.0 24.0 36.0 22-23 33.32225 36.0 36.0 36.0 24.0 36.0 24-25 33.307625 36.0 36.0 36.0 27.0 36.0 26-27 33.27175 36.0 36.0 36.0 24.0 36.0 28-29 33.199375 36.0 36.0 36.0 21.0 36.0 30-31 33.116749999999996 36.0 36.0 36.0 17.5 36.0 32-33 32.968875 36.0 36.0 36.0 14.0 36.0 34-35 32.933125000000004 36.0 36.0 36.0 14.0 36.0 36-37 32.552704056084124 36.0 36.0 36.0 14.0 36.0 38-39 32.72796695042564 36.0 36.0 36.0 14.0 36.0 40-41 32.76852779168753 36.0 36.0 36.0 14.0 36.0 42-43 32.649098647971954 36.0 34.0 36.0 14.0 36.0 44-45 32.4672008012018 36.0 36.0 36.0 14.0 36.0 46-47 32.617926890335504 36.0 36.0 36.0 14.0 36.0 48-49 32.3520280420631 36.0 34.0 36.0 14.0 36.0 50-51 32.0378067100651 36.0 32.0 36.0 14.0 36.0 52-53 31.827074404191457 36.0 32.0 36.0 14.0 36.0 54-55 31.995365731462925 36.0 32.0 36.0 14.0 36.0 56-57 31.817259519038075 36.0 32.0 36.0 14.0 36.0 58-59 31.57064128256513 36.0 32.0 36.0 14.0 36.0 60-61 31.56353390139094 36.0 32.0 36.0 14.0 36.0 62-63 31.190705833326415 36.0 32.0 36.0 14.0 36.0 64-65 31.278404815650866 36.0 32.0 36.0 14.0 36.0 66-67 31.1669174818159 36.0 32.0 36.0 14.0 36.0 68-69 31.181384846964377 36.0 32.0 36.0 14.0 36.0 70-71 30.89633728091 36.0 29.5 36.0 14.0 36.0 72-73 30.813516477692023 36.0 27.0 36.0 14.0 36.0 74-75 30.92254078653615 36.0 32.0 36.0 14.0 36.0 76 29.51057622173596 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 6.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 3.0 16 2.0 17 1.0 18 3.0 19 4.0 20 5.0 21 9.0 22 8.0 23 13.0 24 36.0 25 41.0 26 45.0 27 110.0 28 136.0 29 204.0 30 256.0 31 383.0 32 571.0 33 822.0 34 977.0 35 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.116232464929865 19.68937875751503 10.32064128256513 36.87374749498998 2 28.38176352705411 23.321643286573146 30.060120240480963 18.236472945891784 3 26.127254509018037 26.803607214428858 19.08817635270541 27.980961923847698 4 30.861723446893784 30.23547094188377 16.407815631262526 22.49498997995992 5 30.946419629444165 32.22333500250375 18.02704056084126 18.803204807210815 6 24.611917876815223 32.77416124186279 19.379068602904358 23.234852278417627 7 22.957393483709275 16.015037593984964 34.43609022556391 26.591478696741856 8 23.846539618856568 21.36409227683049 25.47642928786359 29.312938816449346 9 24.228743416102333 20.34110860295962 26.787057938299476 28.643090042638576 10-11 27.489639583071707 26.434760768554565 20.494788396333043 25.580811252040686 12-13 27.7373179306881 20.91913611250628 22.702159718734304 28.64138623807132 14-15 26.143790849673206 24.007038712921066 24.44695827048768 25.402212166918048 16-17 27.011060834590246 22.78783308195073 23.114630467571644 27.08647561588738 18-19 26.790650917315904 22.56848454385524 23.699421965317917 26.941442573510933 20-21 27.405174579251444 22.44410952022105 23.31072594825421 26.839989952273296 22-23 26.058018334798444 24.362677382895896 23.1445435137511 26.434760768554565 24-25 26.858362631843296 23.70668006027122 22.827724761426417 26.607232546459063 26-27 25.800376647834273 24.670433145009415 23.465160075329567 26.064030131826744 28-29 27.746390458254865 24.14312617702448 22.234777150031388 25.875706214689266 30-31 27.149491653068907 23.584787247395507 23.132923308648174 26.132797790887413 32-33 27.425630726747833 23.496924814861302 23.19568218902975 25.881762269361115 34-35 27.789632232960965 23.559683695242878 22.731266474206098 25.919417597590062 36-37 26.647420610016315 25.02824149617171 21.563951299108826 26.76038659470315 38-39 26.577989710126744 24.821182080562178 22.574978039904632 26.02585016940645 40-41 25.957072925819002 24.111961842600728 23.170578636877117 26.76038659470315 42-43 26.242469879518072 23.93323293172691 22.35190763052209 27.47238955823293 44-45 26.767106089139986 24.494664155681107 22.58631512868801 26.151914626490896 46-47 28.14108196309778 23.798167440692858 22.36726496799297 25.693485628216393 48-49 27.219157472417248 23.558174523570713 22.63039117352056 26.592276830491475 50-51 27.854454203262236 22.97365119196989 23.98996235884567 25.181932245922205 52-53 26.92355968369524 24.538722229195432 22.34216141584034 26.19555667126898 54-55 27.14824120603015 24.23366834170854 22.56281407035176 26.055276381909547 56-57 27.32872407291012 24.487743557511 22.225015713387805 25.958516656191076 58-59 27.381251570746418 23.762251822065846 22.455390801708973 26.401105805478764 60-61 27.411039859172636 23.462844209732175 22.997610964415944 26.128504966679237 62-63 27.206345209618533 24.28553443283394 23.35389651265265 25.154223844894872 64-65 27.557568893922234 23.44280860702152 23.203724675978357 25.79589782307789 66-67 27.03722334004024 24.459255533199194 22.107645875251507 26.395875251509054 68-69 26.765518974616736 24.17692887660216 23.699421965317917 25.358130183463178 70-71 27.899962297348246 23.325373884629887 22.885509614176197 25.88915420384567 72-73 26.577316980654953 23.947401694272347 22.77152610949551 26.70375521557719 74-75 27.84471218206158 20.562248995983936 23.801874163319948 27.791164658634536 76 31.21345029239766 0.0 32.41959064327485 36.36695906432749 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.5 3 1.0 4 1.0 5 1.5 6 2.0 7 1.5 8 1.0 9 0.5 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 1.5 21 2.0 22 2.5 23 3.0 24 3.0 25 3.5 26 5.5 27 5.5 28 8.0 29 12.0 30 13.5 31 18.5 32 23.5 33 24.0 34 28.5 35 46.5 36 70.5 37 83.5 38 82.0 39 100.5 40 129.0 41 147.0 42 162.5 43 170.5 44 177.5 45 183.0 46 187.0 47 193.5 48 192.5 49 165.5 50 146.5 51 152.0 52 141.5 53 135.5 54 143.0 55 132.5 56 128.0 57 129.5 58 124.0 59 117.5 60 117.0 61 116.5 62 116.5 63 119.5 64 113.0 65 111.0 66 110.0 67 102.5 68 92.5 69 84.0 70 81.5 71 82.5 72 73.5 73 66.0 74 57.5 75 45.0 76 41.5 77 30.0 78 24.0 79 28.5 80 18.0 81 6.5 82 6.5 83 5.0 84 3.5 85 2.0 86 2.0 87 2.5 88 1.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.15 6 0.15 7 0.25 8 0.3 9 0.325 10-11 0.46249999999999997 12-13 0.44999999999999996 14-15 0.5499999999999999 16-17 0.5499999999999999 18-19 0.525 20-21 0.475 22-23 0.46249999999999997 24-25 0.44999999999999996 26-27 0.43750000000000006 28-29 0.43750000000000006 30-31 0.41250000000000003 32-33 0.41250000000000003 34-35 0.41250000000000003 36-37 0.26289434151226837 38-39 0.23785678517776665 40-41 0.26289434151226837 42-43 0.25037556334501754 44-45 0.28793189784677015 46-47 0.26289434151226837 48-49 0.15022533800701052 50-51 0.2253380070105158 52-53 0.23791635361883295 54-55 0.30060120240480964 56-57 0.3632264529058116 58-59 0.3256513026052104 60-61 0.3383458646616541 62-63 0.4012539184952978 64-65 0.33860045146726864 66-67 0.27589666415851516 68-69 0.17561465127947817 70-71 0.15058351110553395 72-73 0.18929833417465927 74-75 0.16038492381716118 76 0.2188183807439825 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 2.0 61 1.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 3.0 71 11.0 72 20.0 73 70.0 74 282.0 75 858.0 76 2742.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36995967741935 98.575 2 0.5544354838709677 1.0999999999999999 3 0.025201612903225805 0.075 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002818 spots for SRR11389863.sra Written 1002818 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra Read 1002809 spots for SRR11389863.sra Written 1002809 spots for SRR11389863.sra SRR ids: ['SRR11389863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1sfugwxm SRR11389863.sra spots: 20056189 blocks: [[1, 1002809], [1002810, 2005618], [2005619, 3008427], [3008428, 4011236], [4011237, 5014045], [5014046, 6016854], [6016855, 7019663], [7019664, 8022472], [8022473, 9025281], [9025282, 10028090], [10028091, 11030899], [11030900, 12033708], [12033709, 13036517], [13036518, 14039326], [14039327, 15042135], [15042136, 16044944], [16044945, 17047753], [17047754, 18050562], [18050563, 19053371], [19053372, 20056189]] SRR11389863 file size 3819238 SRR11389863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389863 SRR11389863_1.fastq SRR11389863_2.fastq Input file: SRR11389863_1.fastq Paired file: SRR11389863_2.fastq trimmed: SRR11389863-trimmed-pair1.fastq, SRR11389863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:29:05 2024 >> started Sat Dec 7 08:29:22 2024 >> done (16.912s) 20056189 read pairs processed; of these: 181 ( 0.00%) short read pairs filtered out after trimming by size control 11759 ( 0.06%) empty read pairs filtered out after trimming by size control 20044249 (99.94%) read pairs available; of these: 5351 ( 0.03%) trimmed read pairs available after processing 20038898 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 12 0.00% 21 5 0.00% 22 13 0.00% 23 9 0.00% 24 11 0.00% 25 10 0.00% 26 9 0.00% 27 18 0.00% 28 10 0.00% 29 16 0.00% 30 11 0.00% 31 15 0.00% 32 13 0.00% 33 23 0.00% 34 22 0.00% 35 176 0.00% 36 177 0.00% 37 203 0.00% 38 232 0.00% 39 209 0.00% 40 280 0.00% 41 264 0.00% 42 358 0.00% 43 329 0.00% 44 348 0.00% 45 434 0.00% 46 375 0.00% 47 442 0.00% 48 504 0.00% 49 562 0.00% 50 587 0.00% 51 643 0.00% 52 759 0.00% 53 740 0.00% 54 796 0.00% 55 929 0.00% 56 994 0.00% 57 1185 0.01% 58 1275 0.01% 59 1327 0.01% 60 1415 0.01% 61 1522 0.01% 62 1587 0.01% 63 1745 0.01% 64 1930 0.01% 65 2257 0.01% 66 2357 0.01% 67 2540 0.01% 68 2616 0.01% 69 2951 0.01% 70 3995 0.02% 71 5388 0.03% 72 17886 0.09% 73 162090 0.81% 74 1385888 6.91% 75 8759079 43.70% 76 9674671 48.27% 20044249 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=162.28 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=18.1 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=14 prefix-density=0.33 prefix-fanout=3.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=166.10 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=25.5 sequence=CGGCGGCGGCGCC SRR11389863 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:29:50 Started mapping on | Dec 07 08:29:50 Finished on | Dec 07 08:31:13 Mapping speed, Million of reads per hour | 869.39 Number of input reads | 20044249 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18393362 Uniquely mapped reads % | 91.76% Average mapped length | 150.16 Number of splices: Total | 8466098 Number of splices: Annotated (sjdb) | 8082282 Number of splices: GT/AG | 8343200 Number of splices: GC/AG | 108535 Number of splices: AT/AC | 3140 Number of splices: Non-canonical | 11223 Mismatch rate per base, % | 0.97% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 860779 % of reads mapped to multiple loci | 4.29% Number of reads mapped to too many loci | 29081 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 790108 790108 790108 N_multimapping 860779 860779 860779 N_noFeature 525053 17937027 648865 N_ambiguous 447384 2240 121989 UnstrandedReadsAssigned:17420925 PositiveStrandReadsAssigned:454095 NegativeStrandReadsAssigned:17622508 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389863-trimmed-pair1.fastq SRR11389863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,044,249 reads, 18,374,026 reads pseudoaligned [quant] estimated average fragment length: 218.746 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR11389863.ke.tsv 35125 SRR11389863.se.tsv 88098 total ==> SRR11389863.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.568 0 0 PNS24247 1044 826.254 46.2983 4.24467 PNS24249 1928 1710.25 149.147 6.60612 PNS24246 1044 826.254 46.2983 4.24467 PNS24248 1044 826.254 46.2983 4.24467 PNS24244 1471 1253.25 39.9584 2.41525 PNS24243 293 96.3904 0 0 KQK14069 1603 1385.25 8284 453.006 KQK14071 474 259.293 563.908 164.744 ==> SRR11389863.se.tsv <== BRADI_1g14170v3 9435 BRADI_1g53295v3 12 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 270 BRADI_1g74790v3 305 BRADI_1g09890v3 0 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR11389863 completed mapping pipeline successfully