Starting /dee2/code/volunteer_pipeline.sh SRR11389864 current disk space = 1544527306752 free memory = 1601550100 SRR11389864 SRAfilesize 3b98041bdd10ee53080b2d8b105ee750 SRR11389864.sra SRR11389864.sra file validated SRR11389864 is paired end SRR11389864 is conventional basespace SRR11389864 read1 length is 47-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.276 32.0 32.0 32.0 32.0 32.0 2 31.437 32.0 32.0 32.0 32.0 32.0 3 31.22875 32.0 32.0 32.0 32.0 32.0 4 31.342 32.0 32.0 32.0 32.0 32.0 5 31.48375 32.0 32.0 32.0 32.0 32.0 6 34.2565 36.0 36.0 36.0 32.0 36.0 7 34.4265 36.0 36.0 36.0 32.0 36.0 8 34.27025 36.0 36.0 36.0 32.0 36.0 9 34.3975 36.0 36.0 36.0 32.0 36.0 10-11 34.354124999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.369375 36.0 36.0 36.0 32.0 36.0 14-15 34.344125 36.0 36.0 36.0 32.0 36.0 16-17 34.290499999999994 36.0 36.0 36.0 32.0 36.0 18-19 34.21 36.0 36.0 36.0 32.0 36.0 20-21 34.24625 36.0 36.0 36.0 32.0 36.0 22-23 34.10125 36.0 36.0 36.0 32.0 36.0 24-25 33.9435 36.0 36.0 36.0 32.0 36.0 26-27 33.84225 36.0 36.0 36.0 32.0 36.0 28-29 33.7255 36.0 36.0 36.0 29.5 36.0 30-31 33.675 36.0 36.0 36.0 29.5 36.0 32-33 33.728875 36.0 36.0 36.0 29.5 36.0 34-35 33.630250000000004 36.0 36.0 36.0 32.0 36.0 36-37 33.54625 36.0 36.0 36.0 29.5 36.0 38-39 33.334500000000006 36.0 36.0 36.0 24.0 36.0 40-41 33.348625 36.0 36.0 36.0 23.0 36.0 42-43 33.359875 36.0 36.0 36.0 27.0 36.0 44-45 33.341375 36.0 36.0 36.0 27.0 36.0 46-47 33.329625 36.0 36.0 36.0 27.0 36.0 48-49 32.87581237480455 36.0 36.0 36.0 17.5 36.0 50-51 33.123936968484244 36.0 36.0 36.0 24.0 36.0 52-53 32.797773886943475 36.0 36.0 36.0 17.5 36.0 54-55 32.835022464947755 36.0 36.0 36.0 17.5 36.0 56-57 32.81010758068551 36.0 32.0 36.0 14.0 36.0 58-59 32.790718038528894 36.0 32.0 36.0 14.0 36.0 60-61 32.32174130597949 36.0 32.0 36.0 14.0 36.0 62-63 32.27895921941456 36.0 32.0 36.0 14.0 36.0 64-65 32.11518917661337 36.0 32.0 36.0 14.0 36.0 66-67 31.819241001677735 36.0 32.0 36.0 14.0 36.0 68-69 31.60768845479589 36.0 32.0 36.0 14.0 36.0 70-71 31.811748496993985 36.0 32.0 36.0 14.0 36.0 72-73 31.794227061223992 36.0 32.0 36.0 14.0 36.0 74-75 31.24972381432245 36.0 32.0 36.0 14.0 36.0 76 30.15188024826579 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 5.0 25 12.0 26 35.0 27 44.0 28 106.0 29 170.0 30 239.0 31 301.0 32 531.0 33 877.0 34 1195.0 35 485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.225 9.75 10.975 40.050000000000004 2 27.35 11.774999999999999 35.225 25.650000000000002 3 26.125 17.075000000000003 21.4 35.4 4 32.0 24.575 17.625 25.8 5 30.2 28.4 22.1 19.3 6 24.163100931286184 30.430405235338537 22.8794361943116 22.52705763906368 7 18.224999999999998 24.15 35.625 22.0 8 20.474999999999998 22.45 30.7 26.375 9 20.7 20.200000000000003 32.65 26.450000000000003 10-11 24.0125 29.349999999999998 22.3625 24.275 12-13 24.95 22.6 25.137500000000003 27.3125 14-15 24.075 24.9 25.45 25.575 16-17 24.525 24.775 24.775 25.924999999999997 18-19 24.65 24.55 24.462500000000002 26.337500000000002 20-21 25.5125 24.7375 24.2625 25.4875 22-23 25.324999999999996 24.7875 24.5 25.387500000000003 24-25 24.1875 24.875 23.5625 27.375 26-27 24.275 25.025 24.375 26.325 28-29 24.637500000000003 23.7875 24.5625 27.0125 30-31 24.9875 23.775 24.3875 26.85 32-33 24.15 24.1125 25.0625 26.674999999999997 34-35 25.5375 23.65 24.5 26.3125 36-37 23.6625 24.625 24.962500000000002 26.75 38-39 24.775 24.75 25.05 25.424999999999997 40-41 24.85621405351338 24.793698424606152 23.680920230057513 26.669167291822955 42-43 25.250125062531264 24.974987493746873 23.686843421710854 26.088044022011005 44-45 24.90311288911114 24.37804725590699 24.20302537817227 26.515814476809602 46-47 25.412499999999998 23.3125 24.1375 27.1375 48-49 25.62210829060898 24.559209703638864 23.633862698511944 26.184819307240215 50-51 24.824912456228116 24.674837418709355 23.724362181090545 26.775887943971988 52-53 24.574787393696848 24.312156078039017 23.874437218609305 27.238619309654826 54-55 24.940587867417136 23.151969981238274 24.915572232645403 26.991869918699184 56-57 24.906179634726044 24.430823117338004 23.91793845384038 26.745058794095574 58-59 24.25569176882662 24.093069802351764 24.580935701776333 27.070302727045288 60-61 24.505879409557167 24.505879409557167 23.367525644233176 27.62071553665249 62-63 24.91868901676257 24.64348261195897 24.193144858643983 26.244683512634477 64-65 25.63813813813814 23.96146146146146 24.01151151151151 26.38888888888889 66-67 24.345975716610337 24.058079859807236 24.4085617724371 27.187382651145324 68-69 25.444527923866765 23.491109441522664 24.793388429752067 26.270974204858504 70-71 25.313126252505008 24.03557114228457 23.634769539078157 27.016533066132265 72-73 24.45952740070387 24.09502262443439 23.919054801407743 27.526395173454 74-75 25.31813361611877 20.360551431601273 25.768822905620357 28.552492046659594 76 27.163198247535597 0.0 35.15881708652793 37.67798466593648 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 3.5 23 4.5 24 5.0 25 7.0 26 6.5 27 8.5 28 12.5 29 15.5 30 18.5 31 23.0 32 30.0 33 36.5 34 46.0 35 60.5 36 74.5 37 84.5 38 104.5 39 134.0 40 143.5 41 153.5 42 173.0 43 202.0 44 214.5 45 204.5 46 209.0 47 207.0 48 194.0 49 181.5 50 181.5 51 176.0 52 160.0 53 144.0 54 131.0 55 124.0 56 115.0 57 104.5 58 98.5 59 102.5 60 104.0 61 105.0 62 107.0 63 108.0 64 95.0 65 90.5 66 89.0 67 80.5 68 83.5 69 81.5 70 68.5 71 53.0 72 49.5 73 47.5 74 39.0 75 32.0 76 30.0 77 25.0 78 19.0 79 14.5 80 11.0 81 8.5 82 8.5 83 11.0 84 8.0 85 2.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.05 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 47 1.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 2.0 65 0.0 66 1.0 67 1.0 68 0.0 69 1.0 70 0.0 71 4.0 72 20.0 73 71.0 74 250.0 75 908.0 76 2739.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.6818181818181818 1.35 3 0.12626262626262627 0.375 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389864 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.709 32.0 32.0 32.0 32.0 32.0 2 30.63275 32.0 32.0 32.0 32.0 32.0 3 30.37125 32.0 32.0 32.0 32.0 32.0 4 30.423 32.0 32.0 32.0 32.0 32.0 5 30.555 32.0 32.0 32.0 32.0 32.0 6 33.494 36.0 36.0 36.0 21.0 36.0 7 33.73775 36.0 36.0 36.0 32.0 36.0 8 33.70575 36.0 36.0 36.0 32.0 36.0 9 33.628 36.0 36.0 36.0 32.0 36.0 10-11 33.653125 36.0 36.0 36.0 32.0 36.0 12-13 33.533249999999995 36.0 36.0 36.0 26.5 36.0 14-15 33.3765 36.0 36.0 36.0 21.0 36.0 16-17 33.370125 36.0 36.0 36.0 21.0 36.0 18-19 33.30825 36.0 36.0 36.0 24.0 36.0 20-21 33.211625 36.0 36.0 36.0 21.0 36.0 22-23 33.128125 36.0 36.0 36.0 21.0 36.0 24-25 33.082750000000004 36.0 36.0 36.0 17.5 36.0 26-27 33.16675 36.0 36.0 36.0 17.5 36.0 28-29 33.1145 36.0 36.0 36.0 17.5 36.0 30-31 32.893875 36.0 36.0 36.0 14.0 36.0 32-33 32.76775 36.0 36.0 36.0 14.0 36.0 34-35 32.845375 36.0 36.0 36.0 14.0 36.0 36-37 32.37546933667083 36.0 34.0 36.0 14.0 36.0 38-39 32.45882352941177 36.0 32.0 36.0 14.0 36.0 40-41 32.48397997496871 36.0 34.0 36.0 14.0 36.0 42-43 32.41101376720901 36.0 32.0 36.0 14.0 36.0 44-45 32.3459324155194 36.0 34.0 36.0 14.0 36.0 46-47 32.27008760951189 36.0 32.0 36.0 14.0 36.0 48-49 32.19043296976519 36.0 32.0 36.0 14.0 36.0 50-51 31.763461056849486 36.0 32.0 36.0 14.0 36.0 52-53 31.569747057350362 36.0 32.0 36.0 14.0 36.0 54-55 31.758544261074114 36.0 32.0 36.0 14.0 36.0 56-57 31.622244488977955 36.0 32.0 36.0 14.0 36.0 58-59 31.2477768742195 36.0 32.0 36.0 14.0 36.0 60-61 31.121272863943872 36.0 32.0 36.0 14.0 36.0 62-63 31.001753946379353 36.0 32.0 36.0 14.0 36.0 64-65 30.87165406446279 36.0 29.5 36.0 14.0 36.0 66-67 30.802456756079216 36.0 29.5 36.0 14.0 36.0 68-69 30.910230692076226 36.0 29.5 36.0 14.0 36.0 70-71 30.647064892862637 36.0 27.0 36.0 14.0 36.0 72-73 30.597207617121672 36.0 27.0 36.0 14.0 36.0 74-75 30.532990320408103 36.0 27.0 36.0 14.0 36.0 76 29.190755685986794 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 6.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 4.0 18 4.0 19 4.0 20 13.0 21 4.0 22 13.0 23 22.0 24 35.0 25 50.0 26 70.0 27 111.0 28 143.0 29 221.0 30 298.0 31 441.0 32 543.0 33 794.0 34 923.0 35 289.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.14128256513026 19.31362725450902 10.395791583166334 37.14929859719439 2 29.233466933867735 23.12124248496994 30.410821643286575 17.234468937875754 3 24.799599198396795 26.92885771543086 19.614228456913825 28.65731462925852 4 28.575006260956677 32.75732531930879 17.48059103431004 21.187077385424494 5 29.111389236545683 32.015018773466835 19.349186483103882 19.524405506883603 6 22.703379224030037 34.71839799749687 20.275344180225282 22.302878598247812 7 21.587778612572002 17.15502128725269 35.91284748309542 25.344352617079892 8 23.790423665078965 21.659563800451238 24.868388067184757 29.681624467285033 9 24.473420260782348 20.68706118355065 26.429287863590773 28.410230692076226 10-11 27.587504704554007 27.1107765650483 20.59967381758876 24.702044912808933 12-13 27.07314013298206 21.86676703048551 23.19658763015933 27.8635052063731 14-15 26.93708401356273 24.073841517016202 24.588722843149565 24.400351626271505 16-17 27.536413862380716 23.819688598694125 22.76494224008036 25.8789552988448 18-19 26.83906603063018 23.41200100426814 23.512427818227465 26.23650514687422 20-21 26.49347389558233 24.359939759036145 23.1425702811245 26.00401606425703 22-23 28.20577164366374 23.98996235884567 22.19573400250941 25.60853199498118 24-25 26.580531861515304 24.25990968389363 23.2940291018565 25.865529352734573 26-27 27.834922227797293 24.611138986452584 22.44104365278475 25.11289513296538 28-29 26.611487333834965 23.5766240280913 23.325808878856282 26.486079759217457 30-31 27.016179606170827 24.244324595509845 23.02771855010661 25.71177724821272 32-33 26.733542319749215 24.438871473354233 22.808777429467085 26.01880877742947 34-35 27.27614747930775 24.37923250564334 22.485578128918988 25.859041886129923 36-37 27.483692925238334 23.645258404415454 22.99297541394882 25.878073256397393 38-39 27.706007776244828 24.53279819390443 22.9650068982817 24.796187131569045 40-41 27.204314561645553 24.3446632384297 22.8270412642669 25.623980935657848 42-43 26.595611285266457 23.473354231974923 23.523510971786834 26.407523510971785 44-45 26.99448068238836 24.29754139488209 23.532363271450073 25.175614651279478 46-47 28.229245046400802 24.128417356408328 22.37271131176323 25.269626285427638 48-49 27.630753794054936 23.504327103975918 23.140599523391447 25.7243195785777 50-51 26.33295696901267 24.338226069501946 22.94567808305106 26.383138878434327 52-53 26.74695772174131 23.786225065863757 23.309496926358047 26.157320286036885 54-55 27.45762711864407 24.40677966101695 22.360326428123038 25.775266792215945 56-57 25.951513628941086 24.594900138173596 23.652807436251727 25.80077879663359 58-59 26.55111780959558 24.302938960060285 23.411203215272543 25.734740015071587 60-61 27.455413212760615 23.72519467470485 23.260487314745042 25.5589047977895 62-63 26.426237748177932 24.377984418195524 23.18421713998492 26.011560693641616 64-65 27.5251256281407 24.635678391959797 22.701005025125628 25.13819095477387 66-67 27.480532529515195 24.466214518965085 22.896257221803566 25.156995729716154 68-69 27.209944751381215 25.26368658965344 22.564038171772978 24.962330487192368 70-71 26.564463433023374 23.259612968082433 23.83764765016336 26.33827594873084 72-73 26.606894809950752 23.550953403207476 23.32365197625963 26.518499810582146 74-75 27.662424648359007 20.522438044206297 24.96985934360348 26.84527796383121 76 29.448529411764707 0.0 34.705882352941174 35.845588235294116 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 2.0 3 2.0 4 0.0 5 2.0 6 2.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 1.0 21 2.0 22 3.0 23 4.5 24 6.0 25 4.0 26 5.0 27 9.5 28 12.5 29 12.0 30 13.0 31 20.0 32 27.5 33 33.5 34 35.0 35 49.5 36 68.0 37 78.5 38 89.5 39 114.5 40 140.5 41 156.5 42 173.0 43 172.5 44 178.5 45 192.0 46 195.5 47 188.0 48 177.0 49 166.0 50 152.5 51 145.5 52 143.0 53 138.5 54 134.5 55 128.0 56 131.5 57 141.0 58 138.0 59 137.0 60 138.5 61 123.5 62 108.5 63 110.5 64 112.0 65 113.5 66 97.5 67 80.0 68 86.0 69 81.5 70 74.0 71 75.0 72 66.5 73 60.5 74 52.5 75 41.5 76 36.5 77 27.5 78 18.0 79 14.5 80 16.0 81 11.5 82 7.0 83 9.0 84 5.5 85 1.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.17500000000000002 5 0.125 6 0.125 7 0.17500000000000002 8 0.27499999999999997 9 0.3 10-11 0.36250000000000004 12-13 0.36250000000000004 14-15 0.46249999999999997 16-17 0.44999999999999996 18-19 0.42500000000000004 20-21 0.4 22-23 0.375 24-25 0.35000000000000003 26-27 0.35000000000000003 28-29 0.325 30-31 0.3375 32-33 0.3125 34-35 0.325 36-37 0.22528160200250313 38-39 0.2127659574468085 40-41 0.2127659574468085 42-43 0.18773466833541927 44-45 0.22528160200250313 46-47 0.2002503128911139 48-49 0.175284837861525 50-51 0.18782870022539444 52-53 0.18782870022539444 54-55 0.25046963055729493 56-57 0.2880761523046092 58-59 0.26305900037579855 60-61 0.25056376847907796 62-63 0.3006765221748935 64-65 0.2506265664160401 66-67 0.2005515166708448 68-69 0.15045135406218654 70-71 0.150564617314931 72-73 0.1513050056739377 74-75 0.16049217600641968 76 0.22010271460014674 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 2.0 65 0.0 66 0.0 67 1.0 68 0.0 69 1.0 70 4.0 71 8.0 72 19.0 73 79.0 74 277.0 75 874.0 76 2726.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09067946451124 98.075 2 0.8335438241980297 1.6500000000000001 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036583 spots for SRR11389864.sra Written 1036583 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra Read 1036578 spots for SRR11389864.sra Written 1036578 spots for SRR11389864.sra SRR ids: ['SRR11389864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nn254wnt SRR11389864.sra spots: 20731565 blocks: [[1, 1036578], [1036579, 2073156], [2073157, 3109734], [3109735, 4146312], [4146313, 5182890], [5182891, 6219468], [6219469, 7256046], [7256047, 8292624], [8292625, 9329202], [9329203, 10365780], [10365781, 11402358], [11402359, 12438936], [12438937, 13475514], [13475515, 14512092], [14512093, 15548670], [15548671, 16585248], [16585249, 17621826], [17621827, 18658404], [18658405, 19694982], [19694983, 20731565]] SRR11389864 file size 3948735 SRR11389864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389864 SRR11389864_1.fastq SRR11389864_2.fastq Input file: SRR11389864_1.fastq Paired file: SRR11389864_2.fastq trimmed: SRR11389864-trimmed-pair1.fastq, SRR11389864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:29:56 2024 >> started Sat Dec 7 08:30:13 2024 >> done (17.374s) 20731565 read pairs processed; of these: 170 ( 0.00%) short read pairs filtered out after trimming by size control 8685 ( 0.04%) empty read pairs filtered out after trimming by size control 20722710 (99.96%) read pairs available; of these: 5072 ( 0.02%) trimmed read pairs available after processing 20717638 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 6 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 8 0.00% 29 7 0.00% 30 5 0.00% 31 10 0.00% 32 4 0.00% 33 7 0.00% 34 15 0.00% 35 138 0.00% 36 149 0.00% 37 161 0.00% 38 177 0.00% 39 199 0.00% 40 229 0.00% 41 257 0.00% 42 297 0.00% 43 302 0.00% 44 329 0.00% 45 342 0.00% 46 369 0.00% 47 424 0.00% 48 427 0.00% 49 466 0.00% 50 488 0.00% 51 566 0.00% 52 604 0.00% 53 674 0.00% 54 672 0.00% 55 846 0.00% 56 909 0.00% 57 958 0.00% 58 1024 0.00% 59 1145 0.01% 60 1194 0.01% 61 1208 0.01% 62 1324 0.01% 63 1538 0.01% 64 1659 0.01% 65 1808 0.01% 66 1946 0.01% 67 2240 0.01% 68 2164 0.01% 69 2618 0.01% 70 3265 0.02% 71 4897 0.02% 72 19466 0.09% 73 170911 0.82% 74 1437740 6.94% 75 9127307 44.04% 76 9929185 47.91% 20722710 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=157.71 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=16.6 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=29 prefix-density=0.41 prefix-fanout=2.1 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=165.84 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=25.1 sequence=CGGCGGCGGCGCC SRR11389864 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:30:52 Started mapping on | Dec 07 08:30:52 Finished on | Dec 07 08:32:20 Mapping speed, Million of reads per hour | 847.75 Number of input reads | 20722710 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18640101 Uniquely mapped reads % | 89.95% Average mapped length | 150.15 Number of splices: Total | 8349372 Number of splices: Annotated (sjdb) | 7952166 Number of splices: GT/AG | 8227877 Number of splices: GC/AG | 106801 Number of splices: AT/AC | 3077 Number of splices: Non-canonical | 11617 Mismatch rate per base, % | 0.99% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1161744 % of reads mapped to multiple loci | 5.61% Number of reads mapped to too many loci | 38320 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 920865 920865 920865 N_multimapping 1161744 1161744 1161744 N_noFeature 608572 18165669 742379 N_ambiguous 471025 2223 139933 UnstrandedReadsAssigned:17560504 PositiveStrandReadsAssigned:472209 NegativeStrandReadsAssigned:17757789 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389864-trimmed-pair1.fastq SRR11389864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,722,710 reads, 18,831,824 reads pseudoaligned [quant] estimated average fragment length: 215.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR11389864.ke.tsv 35125 SRR11389864.se.tsv 88098 total ==> SRR11389864.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.017 57.3567 5.8117 PNS24247 1044 829.753 29.3802 2.59044 PNS24249 1928 1713.75 196.861 8.40384 PNS24246 1044 829.753 29.3802 2.59044 PNS24248 1044 829.753 29.3802 2.59044 PNS24244 1471 1256.75 22.642 1.31805 PNS24243 293 97.886 0 0 KQK14069 1603 1388.75 6384.52 336.333 KQK14071 474 262.608 433.801 120.851 ==> SRR11389864.se.tsv <== BRADI_1g14170v3 7380 BRADI_1g53295v3 17 BRADI_1g59795v3 311 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 316 BRADI_1g74790v3 191 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR11389864 completed mapping pipeline successfully