Starting /dee2/code/volunteer_pipeline.sh SRR11389865 current disk space = 1544527368192 free memory = 1600912820 SRR11389865 SRAfilesize 486233d75dc018e4bd0f3b90b1221587 SRR11389865.sra SRR11389865.sra file validated SRR11389865 is paired end SRR11389865 is conventional basespace SRR11389865 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.154 32.0 32.0 32.0 32.0 32.0 2 31.38475 32.0 32.0 32.0 32.0 32.0 3 31.228 32.0 32.0 32.0 32.0 32.0 4 31.3265 32.0 32.0 32.0 32.0 32.0 5 31.3795 32.0 32.0 32.0 32.0 32.0 6 34.2485 36.0 36.0 36.0 32.0 36.0 7 34.43 36.0 36.0 36.0 32.0 36.0 8 34.35925 36.0 36.0 36.0 32.0 36.0 9 34.447 36.0 36.0 36.0 32.0 36.0 10-11 34.250375 36.0 36.0 36.0 32.0 36.0 12-13 34.386375 36.0 36.0 36.0 32.0 36.0 14-15 34.404875000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.359875 36.0 36.0 36.0 32.0 36.0 18-19 34.226749999999996 36.0 36.0 36.0 32.0 36.0 20-21 34.217875 36.0 36.0 36.0 32.0 36.0 22-23 34.01625 36.0 36.0 36.0 32.0 36.0 24-25 34.05675 36.0 36.0 36.0 32.0 36.0 26-27 33.684625 36.0 36.0 36.0 29.5 36.0 28-29 33.622125 36.0 36.0 36.0 29.5 36.0 30-31 33.7175 36.0 36.0 36.0 29.5 36.0 32-33 33.623625000000004 36.0 36.0 36.0 29.5 36.0 34-35 33.670125 36.0 36.0 36.0 29.5 36.0 36-37 33.5615 36.0 36.0 36.0 27.0 36.0 38-39 33.50725 36.0 36.0 36.0 27.0 36.0 40-41 33.429874999999996 36.0 36.0 36.0 27.0 36.0 42-43 33.462625 36.0 36.0 36.0 27.0 36.0 44-45 33.215125 36.0 36.0 36.0 27.0 36.0 46-47 33.338875 36.0 36.0 36.0 24.0 36.0 48-49 32.8545 36.0 36.0 36.0 17.5 36.0 50-51 33.07114278569642 36.0 36.0 36.0 17.5 36.0 52-53 32.94809745457876 36.0 36.0 36.0 17.5 36.0 54-55 32.82878939469735 36.0 36.0 36.0 14.0 36.0 56-57 32.85655327663832 36.0 34.0 36.0 14.0 36.0 58-59 32.81586189642232 36.0 32.0 36.0 14.0 36.0 60-61 32.48648986740055 36.0 32.0 36.0 14.0 36.0 62-63 32.187265449086816 36.0 32.0 36.0 14.0 36.0 64-65 32.24507466560882 36.0 32.0 36.0 14.0 36.0 66-67 31.80029344112573 36.0 32.0 36.0 14.0 36.0 68-69 31.785439893256658 36.0 32.0 36.0 14.0 36.0 70-71 31.835878818227343 36.0 32.0 36.0 14.0 36.0 72-73 31.7367108565687 36.0 32.0 36.0 14.0 36.0 74-75 31.190232125473017 36.0 32.0 36.0 14.0 36.0 76 30.17102396514161 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 15.0 25 20.0 26 32.0 27 55.0 28 83.0 29 152.0 30 223.0 31 331.0 32 540.0 33 812.0 34 1200.0 35 533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.849999999999994 9.85 11.25 38.05 2 28.375 11.65 33.725 26.25 3 25.674999999999997 18.5 19.925 35.9 4 31.525 25.575 17.724999999999998 25.174999999999997 5 29.4 28.499999999999996 21.4 20.7 6 23.80593262946204 31.196581196581196 24.107591754650578 20.889894419306184 7 18.125 24.224999999999998 35.875 21.775 8 20.875 22.2 31.35 25.575 9 21.675 19.2 33.25 25.874999999999996 10-11 23.625 29.25 22.575 24.55 12-13 24.5 21.8125 25.7 27.987499999999997 14-15 24.25 23.474999999999998 26.4625 25.8125 16-17 24.85 24.0125 24.6625 26.474999999999998 18-19 24.7875 23.2625 24.099999999999998 27.85 20-21 24.525 24.4 25.924999999999997 25.15 22-23 24.875 24.7 25.0125 25.412499999999998 24-25 24.775 24.3 24.25 26.674999999999997 26-27 24.875 24.5625 24.0 26.5625 28-29 24.474999999999998 24.5625 24.275 26.687499999999996 30-31 23.7875 24.075 23.7125 28.425 32-33 24.762500000000003 24.45 24.275 26.5125 34-35 25.412499999999998 24.087500000000002 24.7375 25.7625 36-37 25.2 24.099999999999998 24.0125 26.687499999999996 38-39 25.087500000000002 24.05 24.099999999999998 26.7625 40-41 24.3875 24.3 24.474999999999998 26.8375 42-43 24.2375 24.1125 25.3125 26.337500000000002 44-45 25.4875 23.825 24.375 26.3125 46-47 26.724999999999998 23.05 24.025 26.200000000000003 48-49 24.837500000000002 24.3125 24.875 25.974999999999998 50-51 24.60615153788447 24.293573393348336 24.318579644911228 26.78169542385596 52-53 25.05939727397774 23.608853319995 24.796798799549833 26.53495060647743 54-55 25.100050025012504 23.836918459229615 24.19959979989995 26.863431715857928 56-57 24.424712356178087 23.499249624812407 24.662331165582792 27.41370685342671 58-59 24.68101075806855 24.64348261195897 24.10557918438829 26.56992744558419 60-61 24.931198398799097 24.69352014010508 23.317488116087066 27.057793345008758 62-63 24.49337002752064 24.430823117338004 24.568426319739807 26.507380535401552 64-65 24.834229951207305 25.197047416489426 23.833354184911798 26.135368447391468 66-67 24.452509072706796 23.726692529095235 24.665248404455014 27.155549993742962 68-69 25.735386155964452 24.095631493303294 24.25835523845287 25.910627112279382 70-71 25.7135703555333 24.56184276414622 24.04857285928893 25.676014021031545 72-73 26.121372031662272 23.709008669430833 23.231561753989194 26.938057544917704 74-75 25.688194812069874 20.698782424563262 25.92641609317099 27.686606670195875 76 28.86710239651416 0.0 33.66013071895425 37.47276688453159 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 2.0 20 4.0 21 5.0 22 3.5 23 3.0 24 5.0 25 6.0 26 5.5 27 6.0 28 9.0 29 12.5 30 21.5 31 23.5 32 32.5 33 50.0 34 53.0 35 56.5 36 76.5 37 96.5 38 105.5 39 123.5 40 147.0 41 171.5 42 188.0 43 210.5 44 220.5 45 207.0 46 208.0 47 204.5 48 200.5 49 199.5 50 183.5 51 159.5 52 142.0 53 132.5 54 124.5 55 112.5 56 111.5 57 115.0 58 107.5 59 110.0 60 110.0 61 99.5 62 95.0 63 100.5 64 101.0 65 86.5 66 80.5 67 90.0 68 84.0 69 70.0 70 62.5 71 56.0 72 55.0 73 50.0 74 46.5 75 46.5 76 41.0 77 29.5 78 22.5 79 20.5 80 18.0 81 13.5 82 6.0 83 4.0 84 3.5 85 2.0 86 1.5 87 2.0 88 1.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5499999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 1.0 69 0.0 70 0.0 71 6.0 72 17.0 73 64.0 74 258.0 75 895.0 76 2754.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389865 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389865_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7115 32.0 32.0 32.0 32.0 32.0 2 30.6005 32.0 32.0 32.0 32.0 32.0 3 30.50875 32.0 32.0 32.0 32.0 32.0 4 30.3085 32.0 32.0 32.0 21.0 32.0 5 30.39225 32.0 32.0 32.0 32.0 32.0 6 33.52625 36.0 36.0 36.0 21.0 36.0 7 33.559 36.0 36.0 36.0 21.0 36.0 8 33.58 36.0 36.0 36.0 32.0 36.0 9 33.5785 36.0 36.0 36.0 32.0 36.0 10-11 33.455875000000006 36.0 36.0 36.0 21.0 36.0 12-13 33.5955 36.0 36.0 36.0 32.0 36.0 14-15 33.337875 36.0 36.0 36.0 21.0 36.0 16-17 33.349625 36.0 36.0 36.0 21.0 36.0 18-19 33.02375 36.0 36.0 36.0 14.0 36.0 20-21 33.13475 36.0 36.0 36.0 17.5 36.0 22-23 33.015874999999994 36.0 36.0 36.0 17.5 36.0 24-25 32.95425 36.0 36.0 36.0 17.5 36.0 26-27 32.967375 36.0 36.0 36.0 14.0 36.0 28-29 32.831625 36.0 36.0 36.0 14.0 36.0 30-31 33.063125 36.0 36.0 36.0 17.5 36.0 32-33 32.738 36.0 36.0 36.0 14.0 36.0 34-35 32.695 36.0 36.0 36.0 14.0 36.0 36-37 32.41016016016016 36.0 34.0 36.0 14.0 36.0 38-39 32.35535535535536 36.0 32.0 36.0 14.0 36.0 40-41 32.50387887887888 36.0 34.0 36.0 14.0 36.0 42-43 32.387512512512515 36.0 32.0 36.0 14.0 36.0 44-45 32.05955955955956 36.0 32.0 36.0 14.0 36.0 46-47 32.26677516274411 36.0 32.0 36.0 14.0 36.0 48-49 32.24536805207812 36.0 32.0 36.0 14.0 36.0 50-51 31.7862509391435 36.0 32.0 36.0 14.0 36.0 52-53 31.61700962656593 36.0 32.0 36.0 14.0 36.0 54-55 31.58992985971944 36.0 32.0 36.0 14.0 36.0 56-57 31.5313126252505 36.0 32.0 36.0 14.0 36.0 58-59 31.213981458281133 36.0 32.0 36.0 14.0 36.0 60-61 31.217489351039838 36.0 32.0 36.0 14.0 36.0 62-63 30.84828363818592 36.0 29.5 36.0 14.0 36.0 64-65 30.988847431784173 36.0 32.0 36.0 14.0 36.0 66-67 30.72013651576924 36.0 27.0 36.0 14.0 36.0 68-69 30.791915700724637 36.0 27.0 36.0 14.0 36.0 70-71 30.72795290162169 36.0 27.0 36.0 14.0 36.0 72-73 30.359237874052827 36.0 27.0 36.0 14.0 36.0 74-75 30.60913635559394 36.0 27.0 36.0 14.0 36.0 76 29.159881569207993 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 4.0 17 10.0 18 4.0 19 4.0 20 2.0 21 6.0 22 10.0 23 31.0 24 24.0 25 67.0 26 85.0 27 114.0 28 163.0 29 213.0 30 310.0 31 429.0 32 564.0 33 771.0 34 867.0 35 311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.06758448060075 18.64831038798498 10.688360450563204 36.59574468085106 2 28.782565130260522 25.325651302605213 27.655310621242485 18.236472945891784 3 27.805611222444888 26.87875751503006 19.76452905811623 25.551102204408814 4 30.43804755944931 32.540675844806 16.896120150187734 20.125156445556946 5 31.23123123123123 32.30730730730731 17.842842842842842 18.61861861861862 6 23.473473473473476 33.50850850850851 20.895895895895897 22.12212212212212 7 22.57257257257257 17.117117117117118 32.907907907907905 27.402402402402405 8 24.30538172715895 20.926157697121404 25.53191489361702 29.236545682102626 9 24.64312546957175 21.21212121212121 27.222639619333833 26.922113698973206 10-11 27.203209226526265 27.566754418954492 19.292967280932682 25.93706907358656 12-13 27.71371270995237 21.5968914514916 23.238906994234142 27.450488844321885 14-15 26.527795206424898 24.331785669469195 23.917681013928973 25.222738110176934 16-17 27.766624843161857 23.801756587202007 22.622333751568384 25.809284818067752 18-19 26.78459415380755 23.76113411115293 22.80767783214151 26.646593902898 20-21 27.906685062084534 24.169070613319953 22.488398344412392 25.43584598018312 22-23 27.335423197492165 24.413793103448274 22.570532915360502 25.68025078369906 24-25 27.017543859649123 24.837092731829575 23.032581453634084 25.112781954887218 26-27 26.29072681704261 24.14786967418546 23.972431077694235 25.588972431077693 28-29 27.809094325441563 23.925842415132156 22.322435174746335 25.942628084679946 30-31 25.974188698158123 24.282671344443052 23.93183811552437 25.81130184187445 32-33 26.54390579982463 25.341350369535263 22.760866842039334 25.353876988600778 34-35 27.304609218436877 24.02304609218437 22.870741482965933 25.80160320641283 36-37 26.954887218045116 24.135338345864664 23.308270676691727 25.601503759398497 38-39 27.211225256827866 23.841142570784264 23.039338511651213 25.90829366073666 40-41 27.994987468671678 24.260651629072683 22.355889724310778 25.38847117794486 42-43 26.565631262525052 24.298597194388776 22.682865731462925 26.452905811623246 44-45 27.214634757549177 24.320260618970053 22.879338428768325 25.585766194712438 46-47 27.380952380952383 24.461152882205514 23.1203007518797 25.03759398496241 48-49 27.31029301277235 24.217380415727526 22.852491860756324 25.6198347107438 50-51 27.352462097481517 24.833980704172408 22.929457461470992 24.88409973687508 52-53 27.807017543859647 24.210526315789473 22.593984962406015 25.38847117794486 54-55 26.088593299033757 24.783536202785793 23.767097502823443 25.360772995357006 56-57 27.293261387878026 25.360772995357006 21.884803614004266 25.461162002760695 58-59 27.696170747018208 23.377275580665412 22.988072818581294 25.93848085373509 60-61 27.21908349026993 24.168236032642813 22.623979912115505 25.98870056497175 62-63 26.978146194423513 24.039186134137154 22.93393619693544 26.048731474503896 64-65 28.431495667462016 23.49616978525681 22.34082632173804 25.731508225543138 66-67 27.29668674698795 24.058734939759034 22.57781124497992 26.066767068273094 68-69 26.63656884875846 24.128417356408328 23.325808878856282 25.909204915976925 70-71 27.63768661397566 23.986952703550372 22.857859741563168 25.517500940910804 72-73 26.461305390733493 23.646004292387325 23.70912763539957 26.18356268147961 74-75 27.995191665553627 20.836115934286095 24.495792707359424 26.672899692800854 76 30.803406145871897 0.0 31.284709366901147 37.911884487226956 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 3.0 21 4.0 22 3.5 23 5.5 24 8.0 25 7.5 26 8.5 27 10.5 28 11.5 29 12.5 30 16.5 31 23.0 32 25.0 33 26.0 34 34.0 35 44.0 36 66.5 37 83.5 38 89.5 39 118.5 40 138.5 41 150.0 42 167.5 43 185.5 44 194.0 45 181.5 46 175.5 47 181.0 48 189.0 49 178.0 50 157.5 51 154.5 52 141.5 53 125.5 54 125.5 55 128.5 56 134.0 57 130.5 58 125.0 59 122.0 60 114.5 61 114.5 62 120.0 63 112.0 64 99.5 65 98.0 66 97.5 67 93.5 68 90.0 69 78.0 70 81.5 71 94.0 72 79.0 73 62.5 74 56.5 75 52.0 76 45.5 77 36.0 78 24.0 79 17.0 80 14.5 81 11.0 82 6.0 83 2.5 84 3.5 85 2.5 86 1.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.2 3 0.2 4 0.125 5 0.1 6 0.1 7 0.1 8 0.125 9 0.17500000000000002 10-11 0.2875 12-13 0.27499999999999997 14-15 0.3875 16-17 0.375 18-19 0.36250000000000004 20-21 0.3375 22-23 0.3125 24-25 0.25 26-27 0.25 28-29 0.21250000000000002 30-31 0.2375 32-33 0.21250000000000002 34-35 0.2 36-37 0.15015015015015015 38-39 0.12512512512512514 40-41 0.15015015015015015 42-43 0.10010010010010009 44-45 0.13763763763763764 46-47 0.10015022533800699 48-49 0.025037556334501748 50-51 0.06260956674179814 52-53 0.06261740763932373 54-55 0.187875751503006 56-57 0.187875751503006 58-59 0.21297920320721622 60-61 0.21297920320721622 62-63 0.25056376847907796 64-65 0.22553564716200977 66-67 0.13786188745456826 68-69 0.037608123354644606 70-71 0.02508466072996363 72-73 0.03785966683493185 74-75 0.026705835224996664 76 0.03700962250185048 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 2.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 1.0 71 10.0 72 28.0 73 77.0 74 253.0 75 916.0 76 2702.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020125 spots for SRR11389865.sra Written 1020125 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra Read 1020107 spots for SRR11389865.sra Written 1020107 spots for SRR11389865.sra SRR ids: ['SRR11389865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zl4qm21u SRR11389865.sra spots: 20402158 blocks: [[1, 1020107], [1020108, 2040214], [2040215, 3060321], [3060322, 4080428], [4080429, 5100535], [5100536, 6120642], [6120643, 7140749], [7140750, 8160856], [8160857, 9180963], [9180964, 10201070], [10201071, 11221177], [11221178, 12241284], [12241285, 13261391], [13261392, 14281498], [14281499, 15301605], [15301606, 16321712], [16321713, 17341819], [17341820, 18361926], [18361927, 19382033], [19382034, 20402158]] SRR11389865 file size 3885010 SRR11389865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389865 SRR11389865_1.fastq SRR11389865_2.fastq Input file: SRR11389865_1.fastq Paired file: SRR11389865_2.fastq trimmed: SRR11389865-trimmed-pair1.fastq, SRR11389865-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:30:10 2024 >> started Sat Dec 7 08:30:28 2024 >> done (17.914s) 20402158 read pairs processed; of these: 173 ( 0.00%) short read pairs filtered out after trimming by size control 22655 ( 0.11%) empty read pairs filtered out after trimming by size control 20379330 (99.89%) read pairs available; of these: 5669 ( 0.03%) trimmed read pairs available after processing 20373661 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 3 0.00% 22 7 0.00% 23 8 0.00% 24 9 0.00% 25 2 0.00% 26 9 0.00% 27 11 0.00% 28 11 0.00% 29 5 0.00% 30 7 0.00% 31 9 0.00% 32 12 0.00% 33 9 0.00% 34 12 0.00% 35 160 0.00% 36 151 0.00% 37 182 0.00% 38 225 0.00% 39 262 0.00% 40 317 0.00% 41 333 0.00% 42 386 0.00% 43 406 0.00% 44 442 0.00% 45 491 0.00% 46 483 0.00% 47 553 0.00% 48 624 0.00% 49 660 0.00% 50 710 0.00% 51 756 0.00% 52 856 0.00% 53 971 0.00% 54 997 0.00% 55 1110 0.01% 56 1291 0.01% 57 1396 0.01% 58 1492 0.01% 59 1629 0.01% 60 1778 0.01% 61 1896 0.01% 62 2046 0.01% 63 2281 0.01% 64 2604 0.01% 65 2785 0.01% 66 3074 0.02% 67 3447 0.02% 68 3551 0.02% 69 3847 0.02% 70 4884 0.02% 71 6677 0.03% 72 18666 0.09% 73 165379 0.81% 74 1435329 7.04% 75 8978516 44.06% 76 9725559 47.72% 20379330 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.20 prefix-fanout=2.2 sequence=TAAGACCAAAATG criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=278.94 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=17.1 sequence=CCGCCGCCGCGCCACTGCCCGCCGGCGCCG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=112.95 fanout-score-rank=12 prefix-density=1.04 prefix-fanout=18.5 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=514.98 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=18.2 sequence=GGCGGCGGCAGGAAGATGAGCCACAACGCGTACGAGCGCGACCGCCGCAAGCAGCTCAACGAGCTCTACTCCTCCCTCCGCTCCCTCCTCCCCGACGCCGACCACACAAAGAAGCTGAGCATCCCGATCACGGTGTCGCGGGTGCTAAAGTACATCCCGGAGCTGCAGAAGGAGGTGGACGGGCTGGAGAGGAAGAAGGAGGAGCTCACGCGCGCCAATTGCAAGCCGGGAGTGATCGCCATGAAGGACCAGAACGTGGCCCCTGTTGTCTCCGCGACCTGCCTCGACGACAAGGATATCATGGTTCAGGTCAGCTTGCTCAGCGGCATGGCGGCAGCGGCGGCG SRR11389865 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:30:56 Started mapping on | Dec 07 08:30:56 Finished on | Dec 07 08:32:47 Mapping speed, Million of reads per hour | 660.95 Number of input reads | 20379330 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18479420 Uniquely mapped reads % | 90.68% Average mapped length | 150.12 Number of splices: Total | 8460579 Number of splices: Annotated (sjdb) | 7998258 Number of splices: GT/AG | 8333502 Number of splices: GC/AG | 110530 Number of splices: AT/AC | 3271 Number of splices: Non-canonical | 13276 Mismatch rate per base, % | 0.96% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 955591 % of reads mapped to multiple loci | 4.69% Number of reads mapped to too many loci | 42593 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944319 944319 944319 N_multimapping 955591 955591 955591 N_noFeature 671536 17936146 850567 N_ambiguous 503916 2512 151667 UnstrandedReadsAssigned:17303968 PositiveStrandReadsAssigned:540762 NegativeStrandReadsAssigned:17477186 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389865 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389865-trimmed-pair1.fastq SRR11389865-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,379,330 reads, 18,364,631 reads pseudoaligned [quant] estimated average fragment length: 199.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR11389865.ke.tsv 35125 SRR11389865.se.tsv 88098 total ==> SRR11389865.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.536 0 0 PNS24247 1044 845.306 67.3206 6.17721 PNS24249 1928 1729.31 264.701 11.8725 PNS24246 1044 845.306 67.3206 6.17721 PNS24248 1044 845.306 67.3206 6.17721 PNS24244 1471 1272.31 68.3369 4.16603 PNS24243 293 110.134 1 0.704267 KQK14069 1603 1404.31 23258.5 1284.63 KQK14071 474 278.372 1632.56 454.884 ==> SRR11389865.se.tsv <== BRADI_1g14170v3 26172 BRADI_1g53295v3 31 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 230 BRADI_1g74790v3 225 BRADI_1g09890v3 0 BRADI_1g77505v3 425 BRADI_1g48960v3 0 SRR11389865 completed mapping pipeline successfully