Starting /dee2/code/volunteer_pipeline.sh SRR11389866 current disk space = 1544522678272 free memory = 1604094020 SRR11389866 SRAfilesize fb5f4f9c4af57cac17c9798959fdd76a SRR11389866.sra SRR11389866.sra file validated SRR11389866 is paired end SRR11389866 is conventional basespace SRR11389866 read1 length is 38-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389866_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.22625 32.0 32.0 32.0 32.0 32.0 2 31.378 32.0 32.0 32.0 32.0 32.0 3 31.22175 32.0 32.0 32.0 32.0 32.0 4 31.407 32.0 32.0 32.0 32.0 32.0 5 31.50575 32.0 32.0 32.0 32.0 32.0 6 34.2875 36.0 36.0 36.0 32.0 36.0 7 34.42375 36.0 36.0 36.0 32.0 36.0 8 34.245 36.0 36.0 36.0 32.0 36.0 9 34.4465 36.0 36.0 36.0 32.0 36.0 10-11 34.451625 36.0 36.0 36.0 32.0 36.0 12-13 34.300625 36.0 36.0 36.0 32.0 36.0 14-15 34.343500000000006 36.0 36.0 36.0 32.0 36.0 16-17 34.323875 36.0 36.0 36.0 32.0 36.0 18-19 34.21775 36.0 36.0 36.0 32.0 36.0 20-21 34.072 36.0 36.0 36.0 32.0 36.0 22-23 34.008375 36.0 36.0 36.0 32.0 36.0 24-25 33.8605 36.0 36.0 36.0 32.0 36.0 26-27 33.76575 36.0 36.0 36.0 32.0 36.0 28-29 33.729749999999996 36.0 36.0 36.0 29.5 36.0 30-31 33.76225 36.0 36.0 36.0 29.5 36.0 32-33 33.645375 36.0 36.0 36.0 27.0 36.0 34-35 33.506249999999994 36.0 36.0 36.0 27.0 36.0 36-37 33.47725 36.0 36.0 36.0 27.0 36.0 38-39 33.5254340460115 36.0 36.0 36.0 27.0 36.0 40-41 33.40147536884221 36.0 36.0 36.0 27.0 36.0 42-43 33.37034258564641 36.0 36.0 36.0 27.0 36.0 44-45 33.302980947838265 36.0 36.0 36.0 24.0 36.0 46-47 33.10992996498249 36.0 36.0 36.0 20.5 36.0 48-49 32.808904452226116 36.0 34.0 36.0 17.5 36.0 50-51 32.97298649324662 36.0 36.0 36.0 21.0 36.0 52-53 32.88494247123562 36.0 36.0 36.0 17.5 36.0 54-55 32.79014507253627 36.0 36.0 36.0 17.5 36.0 56-57 32.83041520760381 36.0 32.0 36.0 14.0 36.0 58-59 32.762756378189096 36.0 34.0 36.0 14.0 36.0 60-61 32.221735867933965 36.0 32.0 36.0 14.0 36.0 62-63 32.13806903451726 36.0 32.0 36.0 14.0 36.0 64-65 32.00775581686264 36.0 32.0 36.0 14.0 36.0 66-67 31.66675006254691 36.0 32.0 36.0 14.0 36.0 68-69 31.539027111384854 36.0 32.0 36.0 14.0 36.0 70-71 31.792370419356487 36.0 32.0 36.0 14.0 36.0 72-73 31.655133596478247 36.0 32.0 36.0 14.0 36.0 74-75 31.22553912223391 36.0 32.0 36.0 14.0 36.0 76 30.17709090909091 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 6.0 25 10.0 26 25.0 27 57.0 28 102.0 29 144.0 30 251.0 31 376.0 32 554.0 33 819.0 34 1158.0 35 492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.725 10.625 11.025 39.625 2 26.625 12.125 35.35 25.900000000000002 3 26.575 17.25 21.175 35.0 4 30.2 24.15 18.375 27.275 5 29.099999999999998 26.924999999999997 23.275000000000002 20.7 6 24.89292013101537 30.284706475182666 23.532375913328295 21.289997480473673 7 17.375 25.324999999999996 36.199999999999996 21.099999999999998 8 19.625 22.625 30.8 26.950000000000003 9 20.8 19.0 33.074999999999996 27.125 10-11 23.0375 28.525 23.1125 25.324999999999996 12-13 25.424999999999997 22.8 24.7375 27.037499999999998 14-15 23.4875 24.65 25.587500000000002 26.275 16-17 23.9125 24.712500000000002 25.2125 26.1625 18-19 24.55 24.337500000000002 24.7875 26.325 20-21 24.837500000000002 24.6 24.2 26.3625 22-23 25.2125 25.025 24.4125 25.35 24-25 24.2625 24.875 24.625 26.237500000000004 26-27 24.0375 24.5125 25.525 25.924999999999997 28-29 24.95 24.775 23.962500000000002 26.3125 30-31 24.9125 24.337500000000002 24.325 26.424999999999997 32-33 24.0125 24.0625 25.650000000000002 26.275 34-35 24.65 24.4125 24.3125 26.625 36-37 24.75 24.8625 24.85 25.5375 38-39 24.66558319789974 24.278034754344294 24.603075384423054 26.453306663332913 40-41 24.19657371514318 25.28448168063024 24.19657371514318 26.32237088908341 42-43 24.634054797948206 25.059426998623795 23.633179031652695 26.6733391717753 44-45 24.78429411029136 25.259472302113295 24.096536201075402 25.859697386519947 46-47 25.0 24.96248124062031 24.212106053026513 25.82541270635318 48-49 24.062031015507753 24.024512256128062 24.599799899949975 27.313656828414207 50-51 25.0 24.187093546773387 24.79989994997499 26.013006503251624 52-53 25.025012506253123 24.462231115557778 24.949974987493746 25.56278139069535 54-55 24.68734367183592 23.574287143571787 25.050025012506254 26.688344172086044 56-57 23.899449724862432 24.79989994997499 23.999499749874936 27.301150575287643 58-59 25.050025012506254 23.92446223111556 24.524762381190595 26.500750375187593 60-61 24.512256128064035 24.274637318659327 24.349674837418707 26.863431715857928 62-63 25.437718859429715 24.212106053026513 23.524262131065534 26.825912956478238 64-65 23.505128846634975 25.66925193895422 24.96872654490868 25.856892669502123 66-67 24.20565424068051 24.305729296972732 24.768576432324245 26.720040030022517 68-69 24.524524524524523 24.637137137137138 24.14914914914915 26.68918918918919 70-71 24.94365138993238 24.430252942649634 24.33007763586276 26.296018031555224 72-73 25.647147524503644 24.227192762000502 24.001005277707968 26.124654435787885 74-75 25.347636074692094 21.096543504171635 25.48006886505099 28.075751556085287 76 28.836363636363636 0.0 33.27272727272727 37.89090909090909 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 2.0 24 1.5 25 1.5 26 4.5 27 10.0 28 14.0 29 14.5 30 15.0 31 23.0 32 35.5 33 40.5 34 44.0 35 65.5 36 83.0 37 88.0 38 89.5 39 113.5 40 147.5 41 165.0 42 179.5 43 209.0 44 232.0 45 220.5 46 206.5 47 201.5 48 212.0 49 196.5 50 168.0 51 174.5 52 180.5 53 167.0 54 152.5 55 125.0 56 102.0 57 96.5 58 87.0 59 92.5 60 100.0 61 98.0 62 93.5 63 90.5 64 90.5 65 88.5 66 79.0 67 67.5 68 60.5 69 57.5 70 54.0 71 49.5 72 60.0 73 56.5 74 34.5 75 29.5 76 30.5 77 24.5 78 20.5 79 20.0 80 15.5 81 12.0 82 10.0 83 7.5 84 6.5 85 2.5 86 1.0 87 2.0 88 1.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.775 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.012503125781445362 42-43 0.06251562890722681 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 2.0 69 1.0 70 2.0 71 3.0 72 20.0 73 66.0 74 255.0 75 898.0 76 2750.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389866 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389866_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83925 32.0 32.0 32.0 32.0 32.0 2 30.617 32.0 32.0 32.0 32.0 32.0 3 30.56675 32.0 32.0 32.0 32.0 32.0 4 30.7505 32.0 32.0 32.0 32.0 32.0 5 30.53725 32.0 32.0 32.0 32.0 32.0 6 33.65225 36.0 36.0 36.0 32.0 36.0 7 33.8395 36.0 36.0 36.0 32.0 36.0 8 33.66225 36.0 36.0 36.0 32.0 36.0 9 33.88075 36.0 36.0 36.0 32.0 36.0 10-11 33.618125 36.0 36.0 36.0 26.5 36.0 12-13 33.731125 36.0 36.0 36.0 32.0 36.0 14-15 33.65575 36.0 36.0 36.0 32.0 36.0 16-17 33.584875 36.0 36.0 36.0 32.0 36.0 18-19 33.366125 36.0 36.0 36.0 24.0 36.0 20-21 33.4585 36.0 36.0 36.0 27.0 36.0 22-23 33.253875 36.0 36.0 36.0 24.0 36.0 24-25 33.281875 36.0 36.0 36.0 20.5 36.0 26-27 33.216750000000005 36.0 36.0 36.0 17.5 36.0 28-29 33.19625 36.0 36.0 36.0 21.0 36.0 30-31 33.213 36.0 36.0 36.0 21.0 36.0 32-33 32.968500000000006 36.0 36.0 36.0 14.0 36.0 34-35 33.02175 36.0 36.0 36.0 14.0 36.0 36-37 32.48010012515645 36.0 34.0 36.0 14.0 36.0 38-39 32.788852208224725 36.0 36.0 36.0 14.0 36.0 40-41 32.66474712068103 36.0 36.0 36.0 14.0 36.0 42-43 32.72158237356034 36.0 34.0 36.0 14.0 36.0 44-45 32.50556196804598 36.0 34.0 36.0 14.0 36.0 46-47 32.752066115702476 36.0 36.0 36.0 14.0 36.0 48-49 32.27973954420236 36.0 32.0 36.0 14.0 36.0 50-51 31.945529676934633 36.0 32.0 36.0 14.0 36.0 52-53 31.922364137240173 36.0 32.0 36.0 14.0 36.0 54-55 32.028299524167295 36.0 32.0 36.0 14.0 36.0 56-57 31.994740796393693 36.0 32.0 36.0 14.0 36.0 58-59 31.545454545454547 36.0 32.0 36.0 14.0 36.0 60-61 31.541322314049587 36.0 32.0 36.0 14.0 36.0 62-63 31.126846982218883 36.0 32.0 36.0 14.0 36.0 64-65 31.298847695390783 36.0 32.0 36.0 14.0 36.0 66-67 31.12299599198397 36.0 32.0 36.0 14.0 36.0 68-69 31.004243390313576 36.0 29.5 36.0 14.0 36.0 70-71 31.040968773148716 36.0 32.0 36.0 14.0 36.0 72-73 30.7119959687617 36.0 27.0 36.0 14.0 36.0 74-75 30.78016933181949 36.0 27.0 36.0 14.0 36.0 76 29.678267308404294 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 5.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 7.0 17 4.0 18 8.0 19 5.0 20 2.0 21 6.0 22 9.0 23 18.0 24 28.0 25 46.0 26 57.0 27 82.0 28 152.0 29 203.0 30 284.0 31 397.0 32 548.0 33 720.0 34 1001.0 35 408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.608815426997246 19.93488605058853 10.568494866015527 35.887803656398695 2 28.32456799398948 24.718256949661907 29.451540195341845 17.50563486100676 3 24.62424849699399 27.78056112224449 20.99198396793587 26.603206412825653 4 30.688360450563202 30.78848560700876 17.471839799749684 21.051314142678347 5 29.011264080100123 34.16770963704631 17.972465581977474 18.848560700876096 6 23.35419274092616 34.86858573216521 19.874843554443054 21.90237797246558 7 22.54509018036072 17.13426853707415 34.09318637274549 26.22745490981964 8 23.684210526315788 22.080200501253135 24.736842105263158 29.49874686716792 9 24.786967418546364 19.473684210526315 27.719298245614034 28.020050125313283 10-11 27.425630726747833 28.30425505208987 20.358980795782603 23.911133425379692 12-13 27.202007528230865 21.417816813048933 23.927227101631114 27.452948557089087 14-15 26.22188717175525 24.04824726724463 24.47543661263978 25.254428948360346 16-17 28.130101720457112 23.49616978525681 22.99384654024865 25.379881954037426 18-19 27.236180904522612 23.5678391959799 23.241206030150753 25.95477386934673 20-21 27.159718734304374 25.025113008538426 23.32998493219488 24.485183324962332 22-23 27.839839337266227 24.789757750721726 22.31705786368771 25.05334504832434 24-25 27.30807827395886 24.97491219267436 22.742097340692425 24.97491219267436 26-27 26.18241124074771 25.153682097603813 23.13386024338226 25.530046418266217 28-29 27.358253888610136 24.04666332162569 23.05569493226292 25.539387857501257 30-31 27.27272727272727 24.727272727272727 23.072100313479623 24.927899686520377 32-33 26.692577733199595 25.20060180541625 23.13189568706118 24.974924774322968 34-35 27.476799598695763 24.793077501881115 22.23476297968397 25.49535991973915 36-37 26.73105870546914 24.899648770697443 23.36929252383342 25.0 38-39 26.749435665914223 24.818159016804614 22.89942312515676 25.532982192124404 40-41 26.743602609131962 24.560963371801304 23.218765679879578 25.476668339187153 42-43 26.837220968146475 24.454477050413846 23.08753448708302 25.62076749435666 44-45 27.083333333333332 24.661144578313255 23.50652610441767 24.748995983935743 46-47 27.411868021578222 24.25040772801405 23.66077029230962 24.676953958098107 48-49 26.26629889669007 24.63640922768305 23.044132397191575 26.053159478435305 50-51 27.35139202407825 24.253824931025832 23.012289942312517 25.382493102583396 52-53 27.568042142230027 24.570425184999372 22.46331368368243 25.39821898908817 54-55 27.645951035781547 24.97175141242938 22.674199623352166 24.708097928436914 56-57 27.119708579324204 24.280869237532972 23.439266423816104 25.16015575932672 58-59 27.83362653933149 24.3151545614476 23.13395325458658 24.71726564463433 60-61 27.358372063811082 24.180379349327975 23.15035799522673 25.310890591634216 62-63 26.662476429918293 25.103708359522315 23.733500942803268 24.500314267756128 64-65 27.117366172405127 24.23975873335009 22.882633827594873 25.760241266649913 66-67 25.746924428822492 24.679889530504646 24.579462716545315 24.993723324127544 68-69 26.514486391571555 24.921610435218863 23.541954095070864 25.021949078138718 70-71 27.356004517505333 23.917681013928973 23.491027732463294 25.235286736102395 72-73 27.605740181268885 23.72860020140987 23.72860020140987 24.93705941591138 74-75 27.481323372465315 21.47812166488794 25.040021344717182 26.000533617929563 76 28.041543026706233 0.0 33.90207715133531 38.05637982195846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 1.0 3 1.0 4 1.0 5 1.0 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 2.5 19 3.5 20 5.5 21 5.5 22 3.5 23 6.0 24 10.0 25 9.5 26 9.5 27 10.5 28 9.5 29 9.5 30 14.0 31 19.5 32 27.5 33 34.5 34 39.5 35 51.5 36 66.5 37 78.0 38 90.5 39 114.5 40 147.0 41 167.5 42 177.0 43 190.5 44 197.0 45 189.0 46 186.5 47 203.0 48 206.5 49 185.0 50 176.5 51 159.0 52 140.5 53 138.5 54 127.0 55 122.0 56 116.5 57 120.0 58 126.5 59 120.0 60 103.0 61 97.0 62 102.0 63 95.0 64 94.0 65 94.5 66 92.0 67 90.5 68 84.0 69 80.5 70 73.0 71 63.0 72 57.5 73 53.5 74 45.5 75 36.5 76 39.0 77 40.0 78 32.0 79 24.5 80 19.0 81 13.5 82 9.5 83 6.0 84 5.0 85 3.5 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.2 4 0.125 5 0.125 6 0.125 7 0.2 8 0.25 9 0.25 10-11 0.41250000000000003 12-13 0.375 14-15 0.5125000000000001 16-17 0.46249999999999997 18-19 0.5 20-21 0.44999999999999996 22-23 0.41250000000000003 24-25 0.35000000000000003 26-27 0.36250000000000004 28-29 0.35000000000000003 30-31 0.3125 32-33 0.3 34-35 0.325 36-37 0.22528160200250313 38-39 0.1877581674802854 40-41 0.20030045067601399 42-43 0.17526289434151227 44-45 0.23788656566921246 46-47 0.18782870022539444 48-49 0.12521913348359628 50-51 0.15026296018031557 52-53 0.16278487352867518 54-55 0.26296018031555224 56-57 0.31304783370899075 58-59 0.3506135737540696 60-61 0.31304783370899075 62-63 0.3881793137991485 64-65 0.3256513026052104 66-67 0.22545090180360722 68-69 0.1252661906551422 70-71 0.12532898859506206 72-73 0.1257229067136032 74-75 0.1332267519317879 76 0.18511662347278787 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 1.0 71 5.0 72 14.0 73 72.0 74 290.0 75 907.0 76 2701.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458016 spots for SRR11389866.sra Written 1458016 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra Read 1458012 spots for SRR11389866.sra Written 1458012 spots for SRR11389866.sra SRR ids: ['SRR11389866.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uwps0l4i SRR11389866.sra spots: 29160244 blocks: [[1, 1458012], [1458013, 2916024], [2916025, 4374036], [4374037, 5832048], [5832049, 7290060], [7290061, 8748072], [8748073, 10206084], [10206085, 11664096], [11664097, 13122108], [13122109, 14580120], [14580121, 16038132], [16038133, 17496144], [17496145, 18954156], [18954157, 20412168], [20412169, 21870180], [21870181, 23328192], [23328193, 24786204], [24786205, 26244216], [26244217, 27702228], [27702229, 29160244]] SRR11389866 file size 5562897 SRR11389866 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389866 SRR11389866_1.fastq SRR11389866_2.fastq Input file: SRR11389866_1.fastq Paired file: SRR11389866_2.fastq trimmed: SRR11389866-trimmed-pair1.fastq, SRR11389866-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:31:57 2024 >> started Sat Dec 7 08:32:24 2024 >> done (26.482s) 29160244 read pairs processed; of these: 255 ( 0.00%) short read pairs filtered out after trimming by size control 13063 ( 0.04%) empty read pairs filtered out after trimming by size control 29146926 (99.95%) read pairs available; of these: 7278 ( 0.02%) trimmed read pairs available after processing 29139648 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 15 0.00% 23 8 0.00% 24 6 0.00% 25 9 0.00% 26 15 0.00% 27 8 0.00% 28 8 0.00% 29 11 0.00% 30 9 0.00% 31 14 0.00% 32 12 0.00% 33 18 0.00% 34 14 0.00% 35 165 0.00% 36 192 0.00% 37 187 0.00% 38 232 0.00% 39 235 0.00% 40 299 0.00% 41 284 0.00% 42 318 0.00% 43 358 0.00% 44 399 0.00% 45 447 0.00% 46 484 0.00% 47 436 0.00% 48 497 0.00% 49 594 0.00% 50 650 0.00% 51 653 0.00% 52 767 0.00% 53 798 0.00% 54 880 0.00% 55 1017 0.00% 56 1103 0.00% 57 1274 0.00% 58 1281 0.00% 59 1471 0.01% 60 1564 0.01% 61 1573 0.01% 62 1752 0.01% 63 2010 0.01% 64 2164 0.01% 65 2323 0.01% 66 2615 0.01% 67 2898 0.01% 68 2889 0.01% 69 3387 0.01% 70 4403 0.02% 71 6980 0.02% 72 23981 0.08% 73 235087 0.81% 74 2075305 7.12% 75 12953512 44.44% 76 13809302 47.38% 29146926 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=23 prefix-density=0.16 prefix-fanout=2.2 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=287.07 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=17.5 sequence=CCGCCGCCGCGCCACTGCCCGCCGGCGCCG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=119.68 fanout-score-rank=13 prefix-density=1.01 prefix-fanout=18.8 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=518.40 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=18.2 sequence=GGCGGCGGCAGGAAGATGAGCCACAACGCGTACGAGCGCGACCGCCGCAAGCAGCTCAACGAGCTCTACTCCTCCCTCCGCTCCCTCCTCCCCGACGCCGACCACACAAAGAAGCTGAGCATCCCGATCACGGTGTCGCGGGTGCTAAAGTACATCCCGGAGCTGCAGAAGGAGGTGGACGGGCTGGAGAGGAAGAAGGAGGAGCTCACGCGCGCCAATTGCAAGCCGGGAGTGATCGCCATGAAGGACCAGAACGTGGCCCCTGTTGTCTCCGCGACCTGCCTCGACGACAAGGATATCATGGTTCAGGTCAGCTTGCTCAGCGGCATGGCGGCAGCGGCGGCGCT SRR11389866 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:32:51 Started mapping on | Dec 07 08:32:51 Finished on | Dec 07 08:34:49 Mapping speed, Million of reads per hour | 889.23 Number of input reads | 29146926 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 26507933 Uniquely mapped reads % | 90.95% Average mapped length | 150.17 Number of splices: Total | 12239775 Number of splices: Annotated (sjdb) | 11566104 Number of splices: GT/AG | 12054618 Number of splices: GC/AG | 160666 Number of splices: AT/AC | 4966 Number of splices: Non-canonical | 19525 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1303661 % of reads mapped to multiple loci | 4.47% Number of reads mapped to too many loci | 92083 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1335332 1335332 1335332 N_multimapping 1303661 1303661 1303661 N_noFeature 993520 25729525 1253495 N_ambiguous 698741 3352 194481 UnstrandedReadsAssigned:24815672 PositiveStrandReadsAssigned:775056 NegativeStrandReadsAssigned:25059957 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389866 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389866-trimmed-pair1.fastq SRR11389866-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,146,926 reads, 26,126,144 reads pseudoaligned [quant] estimated average fragment length: 211.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52973 SRR11389866.ke.tsv 35125 SRR11389866.se.tsv 88098 total ==> SRR11389866.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.111 0 0 PNS24247 1044 833.822 130.704 8.60745 PNS24249 1928 1717.82 400.741 12.8099 PNS24246 1044 833.822 130.704 8.60745 PNS24248 1044 833.822 130.704 8.60745 PNS24244 1471 1260.82 113.147 4.92774 PNS24243 293 100.829 0 0 KQK14069 1603 1392.82 33372.6 1315.69 KQK14071 474 266.931 2173.92 447.202 ==> SRR11389866.se.tsv <== BRADI_1g14170v3 37920 BRADI_1g53295v3 38 BRADI_1g59795v3 523 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 309 BRADI_1g74790v3 243 BRADI_1g09890v3 0 BRADI_1g77505v3 559 BRADI_1g48960v3 0 SRR11389866 completed mapping pipeline successfully