Starting /dee2/code/volunteer_pipeline.sh SRR11389867 current disk space = 1544468402176 free memory = 1600753076 SRR11389867 SRAfilesize 48ee104424a8e12616de9bbe213d9753 SRR11389867.sra SRR11389867.sra file validated SRR11389867 is paired end SRR11389867 is conventional basespace SRR11389867 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27625 32.0 32.0 32.0 32.0 32.0 2 31.3555 32.0 32.0 32.0 32.0 32.0 3 31.204 32.0 32.0 32.0 32.0 32.0 4 31.35825 32.0 32.0 32.0 32.0 32.0 5 31.43775 32.0 32.0 32.0 32.0 32.0 6 34.23475 36.0 36.0 36.0 32.0 36.0 7 34.3615 36.0 36.0 36.0 32.0 36.0 8 34.238 36.0 36.0 36.0 32.0 36.0 9 34.372 36.0 36.0 36.0 32.0 36.0 10-11 34.2755 36.0 36.0 36.0 32.0 36.0 12-13 34.314125000000004 36.0 36.0 36.0 32.0 36.0 14-15 34.3595 36.0 36.0 36.0 32.0 36.0 16-17 34.284125 36.0 36.0 36.0 32.0 36.0 18-19 34.21225 36.0 36.0 36.0 32.0 36.0 20-21 34.24275 36.0 36.0 36.0 32.0 36.0 22-23 34.064625 36.0 36.0 36.0 32.0 36.0 24-25 34.033625 36.0 36.0 36.0 32.0 36.0 26-27 33.745875 36.0 36.0 36.0 32.0 36.0 28-29 33.6435 36.0 36.0 36.0 29.5 36.0 30-31 33.634 36.0 36.0 36.0 29.5 36.0 32-33 33.643375 36.0 36.0 36.0 29.5 36.0 34-35 33.54575 36.0 36.0 36.0 27.0 36.0 36-37 33.4472368092023 36.0 36.0 36.0 27.0 36.0 38-39 33.473743435858964 36.0 36.0 36.0 27.0 36.0 40-41 33.38684671167792 36.0 36.0 36.0 27.0 36.0 42-43 33.34192096048024 36.0 36.0 36.0 27.0 36.0 44-45 33.14657328664332 36.0 36.0 36.0 21.0 36.0 46-47 33.15007503751876 36.0 36.0 36.0 20.5 36.0 48-49 32.825662831415706 36.0 36.0 36.0 14.0 36.0 50-51 32.8835667833917 36.0 36.0 36.0 14.0 36.0 52-53 32.7583791895948 36.0 34.0 36.0 17.5 36.0 54-55 32.98986993496749 36.0 36.0 36.0 21.0 36.0 56-57 32.689719859929966 36.0 32.0 36.0 14.0 36.0 58-59 32.850512884663495 36.0 34.0 36.0 14.0 36.0 60-61 32.04803602702027 36.0 32.0 36.0 14.0 36.0 62-63 32.028028028028025 36.0 32.0 36.0 14.0 36.0 64-65 32.035030681495016 36.0 32.0 36.0 14.0 36.0 66-67 31.659696563377498 36.0 32.0 36.0 14.0 36.0 68-69 31.700726270974208 36.0 32.0 36.0 14.0 36.0 70-71 31.694581456145375 36.0 32.0 36.0 14.0 36.0 72-73 31.722085318604393 36.0 32.0 36.0 14.0 36.0 74-75 31.348690083505083 36.0 32.0 36.0 14.0 36.0 76 30.345566860465116 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 16.0 26 26.0 27 74.0 28 97.0 29 146.0 30 246.0 31 357.0 32 537.0 33 841.0 34 1176.0 35 475.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.50962740685171 10.05251312828207 10.202550637659416 41.2353088272068 2 28.782195548887223 11.75293823455864 33.35833958489622 26.106526631657918 3 26.65666416604151 17.75443860965241 19.854963740935233 35.73393348337085 4 29.80745186296574 25.156289072268066 18.35458864716179 26.6816704176044 5 29.857464366091524 27.60690172543136 21.43035758939735 21.10527631907977 6 23.949685534591193 29.358490566037737 23.9748427672956 22.71698113207547 7 17.75443860965241 24.256064016004 35.75893973493373 22.230557639409852 8 21.155288822205552 20.78019504876219 30.55763940985246 27.506876719179797 9 20.705176294073517 19.754938734683673 32.55813953488372 26.981745436359088 10-11 24.356089022255563 28.244561140285075 22.693173293323333 24.706176544136035 12-13 25.30632658164541 22.380595148787197 25.068767191797946 27.24431107776944 14-15 24.18104526131533 23.50587646911728 25.55638909727432 26.756689172293076 16-17 24.85621405351338 24.63115778944736 24.593648412103025 25.918979744936234 18-19 24.36859214803701 23.355838959739934 25.23130782695674 27.04426106526632 20-21 24.93123280820205 24.656164041010253 24.3935983995999 26.019004751187797 22-23 24.731182795698924 23.680920230057513 25.10627656914228 26.481620405101275 24-25 24.656164041010253 23.080770192548137 24.63115778944736 27.631907976994246 26-27 24.74368592148037 24.518629657414355 24.168542135533883 26.569142285571395 28-29 25.656414103525883 23.80595148787197 23.818454613653415 26.71917979494874 30-31 24.3935983995999 24.58114528632158 24.23105776444111 26.79419854963741 32-33 25.84396099024756 24.493623405851466 23.95598899724931 25.70642660665166 34-35 25.081270317579396 24.056014003500874 24.15603900975244 26.70667666916729 36-37 24.55613903475869 24.268567141785446 23.905976494123532 27.26931732933233 38-39 24.23105776444111 25.481370342585645 24.48112028007002 25.806451612903224 40-41 24.731182795698924 24.793698424606152 24.01850462615654 26.456614153538382 42-43 24.430823117338004 23.2424318238679 24.505879409557167 27.820865649236925 44-45 24.149574787393696 24.12456228114057 25.087543771885944 26.638319159579787 46-47 25.76288144072036 24.499749874937468 23.58679339669835 26.150575287643825 48-49 25.025012506253123 24.224612306153077 23.449224612306153 27.301150575287643 50-51 25.237618809404704 23.724362181090545 24.96248124062031 26.075537768884445 52-53 25.200100050025014 23.999499749874936 24.77488744372186 26.025512756378188 54-55 24.862431215607803 23.17408704352176 24.81240620310155 27.151075537768882 56-57 24.537268634317158 24.062031015507753 23.84942471235618 27.55127563781891 58-59 24.843632724543408 24.130597948461347 23.73029772329247 27.295471603702776 60-61 25.056292219164373 24.468351263447584 23.229922441831373 27.24543407555667 62-63 25.100100100100097 24.46196196196196 23.723723723723726 26.714214214214216 64-65 25.941684394944314 24.152171192591666 24.05205856588662 25.8540858465774 66-67 25.178414924251907 23.613371729059722 23.788656566921247 27.419556779767124 68-69 25.507137490608567 23.6038066616579 24.64312546957175 26.245930378161788 70-71 26.37183663242295 23.803558005512404 23.327486845402152 26.49711851666249 72-73 25.06914759869248 23.510183555443803 24.67940658788031 26.741262257983404 74-75 26.776968894771674 20.23825281270682 25.771012574454005 27.213765718067506 76 28.59738372093023 0.0 34.01162790697674 37.39098837209303 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 2.5 23 4.0 24 6.5 25 8.0 26 8.0 27 11.5 28 16.0 29 17.0 30 19.0 31 22.5 32 28.5 33 35.5 34 52.5 35 63.5 36 72.0 37 89.0 38 95.5 39 112.0 40 133.5 41 157.5 42 173.0 43 185.5 44 198.5 45 207.0 46 216.5 47 195.0 48 172.0 49 172.5 50 174.5 51 162.0 52 148.5 53 146.0 54 138.5 55 125.0 56 125.0 57 123.0 58 114.0 59 108.0 60 105.5 61 113.0 62 113.5 63 102.5 64 100.0 65 102.0 66 93.5 67 86.5 68 87.5 69 81.5 70 68.0 71 64.5 72 67.0 73 54.5 74 41.0 75 39.5 76 34.0 77 27.0 78 19.5 79 12.5 80 11.0 81 12.0 82 6.5 83 1.5 84 3.5 85 2.5 86 1.0 87 1.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.625 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.02501250625312656 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 1.0 65 1.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 6.0 72 14.0 73 66.0 74 253.0 75 899.0 76 2752.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389867 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389867_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.822 32.0 32.0 32.0 32.0 32.0 2 30.516 32.0 32.0 32.0 32.0 32.0 3 30.37075 32.0 32.0 32.0 32.0 32.0 4 30.16275 32.0 32.0 32.0 21.0 32.0 5 30.266 32.0 32.0 32.0 21.0 32.0 6 33.4355 36.0 36.0 36.0 21.0 36.0 7 33.522 36.0 36.0 36.0 27.0 36.0 8 33.455 36.0 36.0 36.0 21.0 36.0 9 33.33275 36.0 36.0 36.0 21.0 36.0 10-11 33.430499999999995 36.0 36.0 36.0 21.0 36.0 12-13 33.301249999999996 36.0 36.0 36.0 21.0 36.0 14-15 33.22775 36.0 36.0 36.0 21.0 36.0 16-17 33.168375 36.0 36.0 36.0 21.0 36.0 18-19 33.04075 36.0 36.0 36.0 14.0 36.0 20-21 32.965375 36.0 36.0 36.0 17.5 36.0 22-23 32.950125 36.0 36.0 36.0 17.5 36.0 24-25 32.878874999999994 36.0 34.0 36.0 14.0 36.0 26-27 32.834 36.0 36.0 36.0 14.0 36.0 28-29 32.857 36.0 36.0 36.0 14.0 36.0 30-31 32.76025 36.0 36.0 36.0 14.0 36.0 32-33 32.44175 36.0 32.0 36.0 14.0 36.0 34-35 32.516375 36.0 32.0 36.0 14.0 36.0 36-37 32.2119279819955 36.0 32.0 36.0 14.0 36.0 38-39 32.199588791645134 36.0 32.0 36.0 14.0 36.0 40-41 32.163331665832914 36.0 32.0 36.0 14.0 36.0 42-43 32.23667901075957 36.0 32.0 36.0 14.0 36.0 44-45 31.91303803803804 36.0 32.0 36.0 14.0 36.0 46-47 32.037912912912915 36.0 32.0 36.0 14.0 36.0 48-49 31.88188188188188 36.0 32.0 36.0 14.0 36.0 50-51 31.575075075075077 36.0 32.0 36.0 14.0 36.0 52-53 31.496996996996998 36.0 32.0 36.0 14.0 36.0 54-55 31.54266766766767 36.0 32.0 36.0 14.0 36.0 56-57 31.37625125125125 36.0 32.0 36.0 14.0 36.0 58-59 31.020275344180227 36.0 32.0 36.0 14.0 36.0 60-61 30.891113892365457 36.0 32.0 36.0 14.0 36.0 62-63 30.663244867300953 36.0 27.0 36.0 14.0 36.0 64-65 30.655436604694167 36.0 27.0 36.0 14.0 36.0 66-67 30.360846693386772 36.0 27.0 36.0 14.0 36.0 68-69 30.57164328657315 36.0 27.0 36.0 14.0 36.0 70-71 30.405855847421996 36.0 27.0 36.0 14.0 36.0 72-73 30.118363387878365 36.0 27.0 36.0 14.0 36.0 74-75 30.362958656160572 36.0 27.0 36.0 14.0 36.0 76 29.06720528828498 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 6.0 5 2.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 4.0 16 4.0 17 3.0 18 3.0 19 7.0 20 6.0 21 11.0 22 22.0 23 21.0 24 34.0 25 66.0 26 88.0 27 127.0 28 164.0 29 237.0 30 324.0 31 438.0 32 561.0 33 722.0 34 891.0 35 253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.29997498123593 19.21441080810608 11.408556417312985 36.077057793345006 2 29.854854854854857 24.724724724724727 26.901901901901905 18.51851851851852 3 25.682102628285357 28.410513141426787 20.175219023779725 25.732165206508135 4 28.646484863647736 32.47435576682512 16.962722041531148 21.916437327995997 5 30.83270817704426 31.657914478619652 19.35483870967742 18.154538634658664 6 21.655413853463365 35.90897724431108 20.10502625656414 22.330582645661416 7 24.024024024024023 16.066066066066064 32.95795795795796 26.95195195195195 8 25.0751503006012 21.067134268537075 24.67434869739479 29.183366733466933 9 24.367009275507645 20.330910002506894 27.14966156931562 28.152419152669843 10-11 27.458605117912693 27.822378324134473 19.618665328650277 25.100351229302557 12-13 27.32062217762168 20.735072754641244 24.422980431510286 27.521324636226797 14-15 27.16777512862342 24.01807002133266 22.78830468063747 26.02585016940645 16-17 26.600552347476775 23.587747928696963 22.796886768767262 27.014812955059003 18-19 27.289836888331244 23.26223337515684 22.785445420326223 26.662484316185697 20-21 28.10539523212045 24.140526976160604 22.923462986198242 24.830614805520703 22-23 27.61606022584693 24.291091593475535 22.647427854454204 25.44542032622334 24-25 26.163301141352065 23.5168694343409 23.26602282704126 27.053806597265773 26-27 26.693426994480685 24.422980431510286 22.77972905168088 26.103863522328147 28-29 27.213443691998997 24.868322046651617 22.15951843491347 25.758715826435918 30-31 26.919217260411436 25.01254390366282 22.027094831911693 26.04114400401405 32-33 27.07549535991974 24.341610233258088 22.34762979683973 26.235264609982444 34-35 27.552044143466265 24.028091296714322 22.523200401304237 25.896664158515176 36-37 27.496236828901154 23.620170597089814 22.930255895634723 25.95333667837431 38-39 27.59312680295999 24.771102470839082 23.052803210836572 24.582967515364356 40-41 27.39932254422281 23.648224814954208 23.309496926358047 25.64295571446494 42-43 28.143036386449182 23.362609786700126 22.32120451693852 26.17314930991217 44-45 27.836345381526108 23.606927710843372 23.481425702811247 25.07530120481928 46-47 27.083333333333332 24.272088353413654 22.289156626506024 26.35542168674699 48-49 27.43917732631051 24.01555053925257 21.83345874090795 26.71181339352897 50-51 27.754077791718945 24.052697616060225 21.90715181932246 26.28607277289837 52-53 27.462049930999875 23.635679337598795 22.857859741563168 26.044410989838163 54-55 26.688425809691186 24.366055736881748 22.909866934471506 26.03565151895556 56-57 26.358729760261078 25.241621689469063 23.710305008158656 24.68934354211121 58-59 27.46107483676544 23.920140632847815 22.614264188849827 26.004520341536917 60-61 25.916624811652433 23.995479658463083 22.865394274234053 27.222501255650428 62-63 28.095955790002513 24.50389349409696 22.243154986184376 25.156995729716154 64-65 27.89850521291295 23.728174852405477 22.45949001381736 25.913829920864213 66-67 26.972361809045225 24.42211055276382 22.688442211055275 25.917085427135678 68-69 27.077579713783578 24.441375847351242 22.796886768767262 25.684157670097918 70-71 27.860821504836075 23.590001256123603 23.22572541138048 25.32345182765984 72-73 25.820292781423525 24.11660777385159 23.245835436648157 26.81726400807673 74-75 27.870829425164146 20.755728259413107 23.38201795524588 27.991424360176875 76 28.77671333824613 0.0 33.235077376565954 37.988209285187914 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 1.0 4 2.0 5 2.5 6 2.0 7 1.5 8 2.0 9 1.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 2.0 17 2.0 18 1.5 19 3.0 20 3.0 21 3.0 22 3.0 23 3.0 24 6.5 25 7.5 26 6.5 27 9.5 28 14.5 29 15.5 30 14.5 31 19.5 32 26.5 33 30.5 34 41.5 35 55.0 36 65.5 37 79.5 38 92.5 39 116.5 40 135.0 41 136.0 42 150.0 43 168.0 44 171.0 45 179.0 46 188.0 47 185.0 48 185.5 49 175.5 50 162.0 51 152.0 52 131.5 53 120.5 54 126.0 55 131.5 56 122.5 57 119.5 58 123.5 59 132.5 60 134.0 61 119.5 62 118.0 63 125.0 64 118.5 65 110.5 66 111.0 67 106.0 68 93.5 69 76.0 70 80.0 71 89.5 72 78.5 73 63.0 74 51.0 75 43.0 76 32.0 77 28.5 78 29.5 79 23.0 80 16.5 81 12.0 82 8.5 83 5.5 84 7.0 85 6.5 86 2.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.1 3 0.125 4 0.075 5 0.025 6 0.025 7 0.1 8 0.2 9 0.27499999999999997 10-11 0.35000000000000003 12-13 0.35000000000000003 14-15 0.3875 16-17 0.42500000000000004 18-19 0.375 20-21 0.375 22-23 0.375 24-25 0.3375 26-27 0.35000000000000003 28-29 0.325 30-31 0.35000000000000003 32-33 0.325 34-35 0.325 36-37 0.3250812703175794 38-39 0.3001125422033262 40-41 0.312656328164082 42-43 0.2877517828099587 44-45 0.3003003003003003 46-47 0.3003003003003003 48-49 0.22522522522522523 50-51 0.2752752752752753 52-53 0.2627627627627628 54-55 0.3253253253253253 56-57 0.3128128128128128 58-59 0.3254067584480601 60-61 0.3254067584480601 62-63 0.3254882323485228 64-65 0.325528984599975 66-67 0.30060120240480964 68-69 0.22545090180360722 70-71 0.22559217947111165 72-73 0.23920433085735868 74-75 0.24060954417858574 76 0.3305178112376056 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 1.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 3.0 71 4.0 72 25.0 73 70.0 74 297.0 75 869.0 76 2723.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171780 spots for SRR11389867.sra Written 1171780 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra Read 1171779 spots for SRR11389867.sra Written 1171779 spots for SRR11389867.sra SRR ids: ['SRR11389867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_u4to6a SRR11389867.sra spots: 23435581 blocks: [[1, 1171779], [1171780, 2343558], [2343559, 3515337], [3515338, 4687116], [4687117, 5858895], [5858896, 7030674], [7030675, 8202453], [8202454, 9374232], [9374233, 10546011], [10546012, 11717790], [11717791, 12889569], [12889570, 14061348], [14061349, 15233127], [15233128, 16404906], [16404907, 17576685], [17576686, 18748464], [18748465, 19920243], [19920244, 21092022], [21092023, 22263801], [22263802, 23435581]] SRR11389867 file size 4466402 SRR11389867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389867 SRR11389867_1.fastq SRR11389867_2.fastq Input file: SRR11389867_1.fastq Paired file: SRR11389867_2.fastq trimmed: SRR11389867-trimmed-pair1.fastq, SRR11389867-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:34:49 2024 >> started Sat Dec 7 08:35:07 2024 >> done (18.435s) 23435581 read pairs processed; of these: 196 ( 0.00%) short read pairs filtered out after trimming by size control 18379 ( 0.08%) empty read pairs filtered out after trimming by size control 23417006 (99.92%) read pairs available; of these: 7404 ( 0.03%) trimmed read pairs available after processing 23409602 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 18 0.00% 21 4 0.00% 22 21 0.00% 23 17 0.00% 24 17 0.00% 25 21 0.00% 26 24 0.00% 27 18 0.00% 28 27 0.00% 29 26 0.00% 30 35 0.00% 31 27 0.00% 32 29 0.00% 33 28 0.00% 34 35 0.00% 35 167 0.00% 36 185 0.00% 37 204 0.00% 38 217 0.00% 39 300 0.00% 40 330 0.00% 41 326 0.00% 42 350 0.00% 43 419 0.00% 44 417 0.00% 45 465 0.00% 46 490 0.00% 47 528 0.00% 48 616 0.00% 49 614 0.00% 50 658 0.00% 51 720 0.00% 52 804 0.00% 53 928 0.00% 54 951 0.00% 55 1004 0.00% 56 1189 0.01% 57 1329 0.01% 58 1470 0.01% 59 1614 0.01% 60 1697 0.01% 61 1703 0.01% 62 1898 0.01% 63 2085 0.01% 64 2325 0.01% 65 2557 0.01% 66 2719 0.01% 67 3111 0.01% 68 2939 0.01% 69 3389 0.01% 70 4504 0.02% 71 6340 0.03% 72 21278 0.09% 73 188532 0.81% 74 1612521 6.89% 75 10241567 43.74% 76 11301187 48.26% 23417006 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.39 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=136.09 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=17.4 sequence=CCGCCGCCGCCGG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=156.30 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=17.8 sequence=GCCGCCGCCACCCT SRR11389867 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:35:35 Started mapping on | Dec 07 08:35:35 Finished on | Dec 07 08:37:13 Mapping speed, Million of reads per hour | 860.22 Number of input reads | 23417006 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 20944515 Uniquely mapped reads % | 89.44% Average mapped length | 150.13 Number of splices: Total | 8887664 Number of splices: Annotated (sjdb) | 8459929 Number of splices: GT/AG | 8760033 Number of splices: GC/AG | 111306 Number of splices: AT/AC | 2998 Number of splices: Non-canonical | 13327 Mismatch rate per base, % | 1.00% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1205724 % of reads mapped to multiple loci | 5.15% Number of reads mapped to too many loci | 64609 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1266767 1266767 1266767 N_multimapping 1205724 1205724 1205724 N_noFeature 753246 20384245 939572 N_ambiguous 514107 2560 150458 UnstrandedReadsAssigned:19677162 PositiveStrandReadsAssigned:557710 NegativeStrandReadsAssigned:19854485 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389867 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389867-trimmed-pair1.fastq SRR11389867-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,417,006 reads, 20,916,987 reads pseudoaligned [quant] estimated average fragment length: 214.04 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR11389867.ke.tsv 35125 SRR11389867.se.tsv 88098 total ==> SRR11389867.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.144 0 0 PNS24247 1044 830.96 49.7626 4.01876 PNS24249 1928 1714.96 368.946 14.437 PNS24246 1044 830.96 49.7626 4.01876 PNS24248 1044 830.96 49.7626 4.01876 PNS24244 1471 1257.96 18.7664 1.00111 PNS24243 293 98.6182 0 0 KQK14069 1603 1389.96 4379.07 211.421 KQK14071 474 263.995 133.062 33.824 ==> SRR11389867.se.tsv <== BRADI_1g14170v3 4537 BRADI_1g53295v3 23 BRADI_1g59795v3 347 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 220 BRADI_1g74790v3 308 BRADI_1g09890v3 0 BRADI_1g77505v3 330 BRADI_1g48960v3 0 SRR11389867 completed mapping pipeline successfully