Starting /dee2/code/volunteer_pipeline.sh SRR11389868 current disk space = 1544480997376 free memory = 1600555844 SRR11389868 SRAfilesize 4739b16d03bfaf2147685c0fc529d418 SRR11389868.sra SRR11389868.sra file validated SRR11389868 is paired end SRR11389868 is conventional basespace SRR11389868 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.23625 32.0 32.0 32.0 32.0 32.0 2 31.37775 32.0 32.0 32.0 32.0 32.0 3 31.173 32.0 32.0 32.0 32.0 32.0 4 31.29275 32.0 32.0 32.0 32.0 32.0 5 31.40225 32.0 32.0 32.0 32.0 32.0 6 34.12525 36.0 36.0 36.0 32.0 36.0 7 34.392 36.0 36.0 36.0 32.0 36.0 8 34.30425 36.0 36.0 36.0 32.0 36.0 9 34.334 36.0 36.0 36.0 32.0 36.0 10-11 34.19825 36.0 36.0 36.0 32.0 36.0 12-13 34.3475 36.0 36.0 36.0 32.0 36.0 14-15 34.263 36.0 36.0 36.0 32.0 36.0 16-17 34.145250000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.13225 36.0 36.0 36.0 32.0 36.0 20-21 34.0625 36.0 36.0 36.0 32.0 36.0 22-23 34.0195 36.0 36.0 36.0 32.0 36.0 24-25 33.8435 36.0 36.0 36.0 32.0 36.0 26-27 33.648624999999996 36.0 36.0 36.0 29.5 36.0 28-29 33.5475 36.0 36.0 36.0 27.0 36.0 30-31 33.6515 36.0 36.0 36.0 27.0 36.0 32-33 33.585125000000005 36.0 36.0 36.0 29.5 36.0 34-35 33.464 36.0 36.0 36.0 27.0 36.0 36-37 33.412125 36.0 36.0 36.0 27.0 36.0 38-39 33.28575 36.0 36.0 36.0 24.0 36.0 40-41 33.335750000000004 36.0 36.0 36.0 24.0 36.0 42-43 33.433125000000004 36.0 36.0 36.0 27.0 36.0 44-45 33.143375 36.0 36.0 36.0 21.0 36.0 46-47 33.12 36.0 36.0 36.0 20.5 36.0 48-49 32.720749999999995 36.0 34.0 36.0 17.5 36.0 50-51 32.881375000000006 36.0 36.0 36.0 14.0 36.0 52-53 32.746125 36.0 34.0 36.0 17.5 36.0 54-55 32.64241060265066 36.0 36.0 36.0 14.0 36.0 56-57 32.69529882470617 36.0 32.0 36.0 14.0 36.0 58-59 32.7059264816204 36.0 34.0 36.0 14.0 36.0 60-61 32.3361131991352 36.0 32.0 36.0 14.0 36.0 62-63 32.14219609804903 36.0 32.0 36.0 14.0 36.0 64-65 31.886818409204604 36.0 32.0 36.0 14.0 36.0 66-67 31.803151575787894 36.0 32.0 36.0 14.0 36.0 68-69 31.702777082812112 36.0 32.0 36.0 14.0 36.0 70-71 31.595696772579434 36.0 32.0 36.0 14.0 36.0 72-73 31.607553685761232 36.0 32.0 36.0 14.0 36.0 74-75 31.08803593962601 36.0 32.0 36.0 14.0 36.0 76 30.301303538175045 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 8.0 25 14.0 26 33.0 27 71.0 28 103.0 29 169.0 30 222.0 31 354.0 32 550.0 33 886.0 34 1160.0 35 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.625 11.375 10.825 41.175 2 25.900000000000002 11.75 38.275 24.075 3 25.5 16.875 21.575 36.05 4 28.925 25.924999999999997 18.9 26.25 5 28.65 28.475 22.275 20.599999999999998 6 23.392992185530627 29.720191580539453 25.182757751449458 21.704058482480466 7 16.725 24.325 36.9 22.05 8 19.425 22.225 31.65 26.700000000000003 9 19.125 20.0 33.7 27.175 10-11 23.175 29.049999999999997 23.375 24.4 12-13 23.825 23.400000000000002 25.2375 27.537499999999998 14-15 23.375 24.762500000000003 26.400000000000002 25.4625 16-17 23.125 25.2125 25.3 26.3625 18-19 23.95 24.837500000000002 25.15 26.0625 20-21 23.549999999999997 25.087500000000002 24.875 26.487500000000004 22-23 25.224999999999998 24.8625 25.174999999999997 24.7375 24-25 23.375 24.775 25.4875 26.3625 26-27 23.0625 25.162499999999998 25.3125 26.4625 28-29 24.7375 24.2375 24.4375 26.5875 30-31 24.212500000000002 25.074999999999996 25.25 25.4625 32-33 24.3 24.95 24.587500000000002 26.1625 34-35 23.65 24.45 25.8 26.1 36-37 24.2875 24.8 24.925 25.9875 38-39 23.674999999999997 25.387500000000003 24.9875 25.95 40-41 23.3183295823956 25.71892973243311 23.943485871467868 27.019254813703427 42-43 24.59672377141428 25.697136426159812 24.171564336626236 25.534575465799676 44-45 23.990498812351543 24.90311288911114 24.428053506688336 26.67833479184898 46-47 24.25 25.5 24.9375 25.3125 48-49 24.337500000000002 24.95 24.8 25.912499999999998 50-51 24.175 24.625 24.3 26.900000000000002 52-53 25.15 24.962500000000002 23.7 26.187500000000004 54-55 25.531382845711427 24.5311327831958 23.80595148787197 26.131532883220803 56-57 23.99349837459365 24.731182795698924 25.068767191797946 26.206551637909474 58-59 24.23105776444111 25.143785946486624 24.293573393348336 26.331582895723933 60-61 24.071526822558457 24.771789421032885 25.422033262473427 25.734650493935224 62-63 23.861930965482742 24.312156078039017 24.23711855927964 27.5887943971986 64-65 24.387193596798397 24.399699849924964 25.362681340670335 25.850425212606304 66-67 25.012506253126567 24.112056028014006 23.67433716858429 27.201100550275136 68-69 24.78108581436077 24.630973229922443 24.73104828621466 25.856892669502123 70-71 24.768576432324245 24.981235926945207 24.806104578433825 25.444083062296723 72-73 24.9529544599172 24.777317776941413 23.62313386024338 26.646593902898 74-75 24.84406104844061 21.45985401459854 25.79960185799602 27.896483078964827 76 27.672253258845437 0.0 34.8975791433892 37.43016759776536 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 3.0 24 4.5 25 5.0 26 7.5 27 10.5 28 12.5 29 15.5 30 23.5 31 29.0 32 30.0 33 42.0 34 55.0 35 72.5 36 91.5 37 100.0 38 124.0 39 152.5 40 179.0 41 193.0 42 203.5 43 216.5 44 201.5 45 208.0 46 223.0 47 210.0 48 198.5 49 176.0 50 158.0 51 154.0 52 149.0 53 138.5 54 123.5 55 129.0 56 132.5 57 108.5 58 89.5 59 87.0 60 87.5 61 87.5 62 85.0 63 89.0 64 82.0 65 79.5 66 85.5 67 83.0 68 76.0 69 61.0 70 53.5 71 50.0 72 53.0 73 44.5 74 34.0 75 37.0 76 30.5 77 27.0 78 19.5 79 10.0 80 10.0 81 8.5 82 6.5 83 5.0 84 4.0 85 3.0 86 1.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8250000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0375 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 0.0 71 1.0 72 21.0 73 83.0 74 249.0 75 958.0 76 2685.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389868 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389868_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73075 32.0 32.0 32.0 32.0 32.0 2 30.494 32.0 32.0 32.0 32.0 32.0 3 30.28475 32.0 32.0 32.0 21.0 32.0 4 30.34525 32.0 32.0 32.0 21.0 32.0 5 30.492 32.0 32.0 32.0 32.0 32.0 6 33.44975 36.0 36.0 36.0 21.0 36.0 7 33.6425 36.0 36.0 36.0 32.0 36.0 8 33.418 36.0 36.0 36.0 21.0 36.0 9 33.45425 36.0 36.0 36.0 21.0 36.0 10-11 33.574125 36.0 36.0 36.0 32.0 36.0 12-13 33.56425 36.0 36.0 36.0 32.0 36.0 14-15 33.243 36.0 36.0 36.0 21.0 36.0 16-17 33.275 36.0 36.0 36.0 21.0 36.0 18-19 33.001875 36.0 36.0 36.0 14.0 36.0 20-21 33.034375 36.0 36.0 36.0 21.0 36.0 22-23 32.9525 36.0 36.0 36.0 17.5 36.0 24-25 32.89125 36.0 36.0 36.0 14.0 36.0 26-27 32.940625 36.0 36.0 36.0 14.0 36.0 28-29 32.85375 36.0 36.0 36.0 14.0 36.0 30-31 32.88275 36.0 36.0 36.0 14.0 36.0 32-33 32.673249999999996 36.0 36.0 36.0 14.0 36.0 34-35 32.754125 36.0 36.0 36.0 14.0 36.0 36-37 32.32945154019534 36.0 32.0 36.0 14.0 36.0 38-39 32.43676433759079 36.0 34.0 36.0 14.0 36.0 40-41 32.29501627848735 36.0 32.0 36.0 14.0 36.0 42-43 32.38292011019284 36.0 32.0 36.0 14.0 36.0 44-45 32.01903330828951 36.0 32.0 36.0 14.0 36.0 46-47 32.25256699223641 36.0 34.0 36.0 14.0 36.0 48-49 32.01715502128725 36.0 32.0 36.0 14.0 36.0 50-51 31.761332331580267 36.0 32.0 36.0 14.0 36.0 52-53 31.470823941898324 36.0 32.0 36.0 14.0 36.0 54-55 31.691633266533067 36.0 32.0 36.0 14.0 36.0 56-57 31.53006012024048 36.0 32.0 36.0 14.0 36.0 58-59 31.228851150057572 36.0 32.0 36.0 14.0 36.0 60-61 31.253461359487417 36.0 32.0 36.0 14.0 36.0 62-63 30.80827067669173 36.0 32.0 36.0 14.0 36.0 64-65 30.83859649122807 36.0 29.5 36.0 14.0 36.0 66-67 30.73659147869674 36.0 29.5 36.0 14.0 36.0 68-69 30.652043118576085 36.0 27.0 36.0 14.0 36.0 70-71 30.647261825607245 36.0 27.0 36.0 14.0 36.0 72-73 30.17193712523713 36.0 27.0 36.0 14.0 36.0 74-75 30.565412166009853 36.0 27.0 36.0 14.0 36.0 76 29.22864602760164 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 4.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 4.0 17 3.0 18 1.0 19 5.0 20 4.0 21 10.0 22 16.0 23 21.0 24 22.0 25 44.0 26 76.0 27 130.0 28 175.0 29 240.0 30 329.0 31 427.0 32 595.0 33 748.0 34 870.0 35 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.17151454363089 21.013039117352054 10.732196589769307 36.08324974924774 2 28.80080280983442 25.23833416959358 30.983442047165077 14.977420973406923 3 23.889585947302383 29.535759096612296 21.50564617314931 25.06900878293601 4 28.929556279769365 32.31386312358987 16.5455001253447 22.211080471296064 5 29.40145254194841 33.283245679939895 19.233658903080393 18.081642875031303 6 21.387427998998245 34.234911094415224 21.487603305785125 22.890057600801402 7 22.02455524931095 17.21373089451265 35.47982961663743 25.281884239538964 8 23.514665329656555 22.211080471296064 25.018801704687892 29.255452494359492 9 23.97792826686732 21.795836468522698 27.589666415851514 26.63656884875846 10-11 27.0843797086891 28.164239075841284 19.814163736815672 24.937217478653942 12-13 27.203113231232738 22.395179512929953 24.14009540547326 26.261611850364048 14-15 25.018848957024375 24.69213370193516 25.04398089972355 25.245036441316916 16-17 27.41550446035934 23.859781379570297 23.244126146500815 25.480588013569545 18-19 25.656489508732257 24.349792687523557 23.922603342128408 26.071114461615778 20-21 26.287364983672447 24.918362220547603 24.2778196433057 24.516453152474252 22-23 27.36062280261175 24.171270718232044 23.0286288297338 25.439477649422397 24-25 25.991465863453815 24.021084337349397 24.234437751004016 25.75301204819277 26-27 26.534454625329484 23.96134052968495 23.911133425379692 25.593071419605874 28-29 26.543674698795183 25.376506024096386 23.180220883534137 24.899598393574294 30-31 26.841510854561424 25.04705734722048 23.039277199146692 25.0721545990714 32-33 25.95055841385368 25.323127117580626 23.641611243568832 25.08470322499686 34-35 27.334337349397593 24.686244979919678 23.02961847389558 24.949799196787147 36-37 26.374592016068288 24.403715792116497 23.951795129299523 25.26989706251569 38-39 26.3580479237235 24.66440848074269 23.848952452640823 25.128591142892986 40-41 26.63486883394 23.911133425379692 23.96134052968495 25.492657210995358 42-43 25.900363910151835 24.18120215836366 24.469820554649267 25.44861337683524 44-45 26.342871485943775 25.514558232931726 23.531626506024097 24.610943775100402 46-47 27.494039402685406 25.04705734722048 23.716902999121597 23.74200025097252 48-49 26.592276830491475 24.49849548645938 23.332497492477433 25.576730190571716 50-51 27.68226879156732 24.72079307315849 22.58752666583009 25.0094114694441 52-53 27.063989962358846 24.278544542032623 23.751568381430364 24.90589711417817 54-55 27.26017076845806 24.29683576092416 23.88247112004018 24.5605223505776 56-57 26.00175857304359 24.2431855294561 24.079889461122974 25.67516643637734 58-59 26.347531096871467 24.437743435104913 24.95288352808142 24.2618419399422 60-61 26.293969849246228 24.761306532663315 23.14070351758794 25.804020100502512 62-63 26.175509177772188 25.785768166960022 23.862207694241892 24.176514961025898 64-65 27.790346907993968 23.919054801407743 23.102061337355455 25.188536953242835 66-67 26.839989952273296 24.365737251946747 23.31072594825421 25.483546847525744 68-69 26.816413602710504 24.356882921320118 23.578868113941525 25.24783536202786 70-71 26.697627714321577 25.178862809087487 23.01995732396134 25.1035521526296 72-73 26.05846774193548 23.865927419354836 24.584173387096776 25.491431451612907 74-75 27.35623003194888 20.926517571884983 25.212992545260914 26.50425985090522 76 29.323870003735525 0.0 33.13410534180052 37.54202465446395 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 2.0 8 1.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 0.5 16 0.0 17 1.0 18 1.5 19 2.5 20 4.5 21 5.5 22 3.5 23 2.0 24 3.5 25 4.5 26 7.5 27 10.5 28 13.5 29 18.0 30 20.0 31 23.5 32 28.5 33 32.5 34 44.0 35 58.5 36 66.0 37 78.5 38 97.5 39 124.0 40 153.5 41 177.0 42 187.5 43 196.5 44 189.5 45 185.0 46 190.5 47 191.5 48 198.0 49 186.0 50 165.0 51 156.0 52 146.0 53 143.5 54 142.5 55 133.0 56 136.5 57 122.0 58 100.5 59 118.0 60 123.5 61 102.0 62 95.5 63 94.5 64 86.0 65 88.5 66 100.0 67 97.5 68 84.5 69 75.5 70 66.5 71 56.0 72 55.5 73 53.5 74 46.5 75 37.0 76 26.0 77 18.5 78 17.5 79 15.5 80 8.5 81 6.0 82 5.5 83 2.5 84 1.5 85 1.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.35000000000000003 3 0.375 4 0.27499999999999997 5 0.17500000000000002 6 0.17500000000000002 7 0.22499999999999998 8 0.27499999999999997 9 0.325 10-11 0.44999999999999996 12-13 0.42500000000000004 14-15 0.525 16-17 0.5125000000000001 18-19 0.5125000000000001 20-21 0.475 22-23 0.44999999999999996 24-25 0.4 26-27 0.41250000000000003 28-29 0.4 30-31 0.3875 32-33 0.3875 34-35 0.4 36-37 0.25043826696719257 38-39 0.18782870022539444 40-41 0.23791635361883295 42-43 0.2128725269221137 44-45 0.2253944402704733 46-47 0.2128725269221137 48-49 0.12521913348359628 50-51 0.2128725269221137 52-53 0.20035061357375405 54-55 0.250501002004008 56-57 0.2880761523046092 58-59 0.3006388575723412 60-61 0.2631249216890114 62-63 0.3258145363408521 64-65 0.30075187969924816 66-67 0.2255639097744361 68-69 0.11281022812735021 70-71 0.10031347962382445 72-73 0.12584948401711551 74-75 0.10638297872340426 76 0.14919806042521447 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 1.0 70 1.0 71 5.0 72 18.0 73 73.0 74 262.0 75 948.0 76 2681.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6228312798592 99.05000000000001 2 0.3268795574553684 0.65 3 0.0 0.0 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.025144581342720643 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAAGGCCACCATGTCGAGCGGCTGCGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324716 spots for SRR11389868.sra Written 1324716 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra Read 1324700 spots for SRR11389868.sra Written 1324700 spots for SRR11389868.sra SRR ids: ['SRR11389868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__83cl21o SRR11389868.sra spots: 26494016 blocks: [[1, 1324700], [1324701, 2649400], [2649401, 3974100], [3974101, 5298800], [5298801, 6623500], [6623501, 7948200], [7948201, 9272900], [9272901, 10597600], [10597601, 11922300], [11922301, 13247000], [13247001, 14571700], [14571701, 15896400], [15896401, 17221100], [17221101, 18545800], [18545801, 19870500], [19870501, 21195200], [21195201, 22519900], [22519901, 23844600], [23844601, 25169300], [25169301, 26494016]] SRR11389868 file size 5051482 SRR11389868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389868 SRR11389868_1.fastq SRR11389868_2.fastq Input file: SRR11389868_1.fastq Paired file: SRR11389868_2.fastq trimmed: SRR11389868-trimmed-pair1.fastq, SRR11389868-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:38:35 2024 >> started Sat Dec 7 08:39:04 2024 >> done (29.453s) 26494016 read pairs processed; of these: 214 ( 0.00%) short read pairs filtered out after trimming by size control 5854 ( 0.02%) empty read pairs filtered out after trimming by size control 26487948 (99.98%) read pairs available; of these: 10181 ( 0.04%) trimmed read pairs available after processing 26477767 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 8 0.00% 25 5 0.00% 26 10 0.00% 27 12 0.00% 28 15 0.00% 29 11 0.00% 30 15 0.00% 31 19 0.00% 32 29 0.00% 33 12 0.00% 34 12 0.00% 35 227 0.00% 36 224 0.00% 37 252 0.00% 38 271 0.00% 39 309 0.00% 40 333 0.00% 41 365 0.00% 42 408 0.00% 43 459 0.00% 44 514 0.00% 45 603 0.00% 46 555 0.00% 47 613 0.00% 48 714 0.00% 49 742 0.00% 50 887 0.00% 51 903 0.00% 52 1022 0.00% 53 1123 0.00% 54 1096 0.00% 55 1320 0.00% 56 1517 0.01% 57 1664 0.01% 58 1797 0.01% 59 1892 0.01% 60 2092 0.01% 61 2089 0.01% 62 2332 0.01% 63 2520 0.01% 64 2767 0.01% 65 3015 0.01% 66 3361 0.01% 67 3679 0.01% 68 3707 0.01% 69 3976 0.02% 70 5146 0.02% 71 7431 0.03% 72 22633 0.09% 73 216837 0.82% 74 1899783 7.17% 75 11817921 44.62% 76 12468684 47.07% 26487948 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=17 prefix-density=0.17 prefix-fanout=3.1 sequence=TGCCGCACTTGCAGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=163.23 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=19.8 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.03 fanout-score-rank=13 prefix-density=0.23 prefix-fanout=4.3 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=223.14 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=18.4 sequence=GCCGCCGCCACCCT SRR11389868 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:39:34 Started mapping on | Dec 07 08:39:34 Finished on | Dec 07 08:41:35 Mapping speed, Million of reads per hour | 788.07 Number of input reads | 26487948 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 24103370 Uniquely mapped reads % | 91.00% Average mapped length | 150.12 Number of splices: Total | 10578550 Number of splices: Annotated (sjdb) | 10062145 Number of splices: GT/AG | 10428477 Number of splices: GC/AG | 129945 Number of splices: AT/AC | 4713 Number of splices: Non-canonical | 15415 Mismatch rate per base, % | 0.98% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 981028 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 76533 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1403550 1403550 1403550 N_multimapping 981028 981028 981028 N_noFeature 886019 23443115 1080066 N_ambiguous 616570 3025 165468 UnstrandedReadsAssigned:22600781 PositiveStrandReadsAssigned:657230 NegativeStrandReadsAssigned:22857836 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389868 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389868-trimmed-pair1.fastq SRR11389868-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,487,948 reads, 23,664,459 reads pseudoaligned [quant] estimated average fragment length: 217.241 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR11389868.ke.tsv 35125 SRR11389868.se.tsv 88098 total ==> SRR11389868.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 720.02 72.9936 6.25907 PNS24247 1044 827.759 53.3503 3.97926 PNS24249 1928 1711.76 291.356 10.5088 PNS24246 1044 827.759 53.3503 3.97926 PNS24248 1044 827.759 53.3503 3.97926 PNS24244 1471 1254.76 73.5989 3.62143 PNS24243 293 97.1054 1 0.635808 KQK14069 1603 1386.76 1048.32 46.6725 KQK14071 474 260.922 52.9456 12.5282 ==> SRR11389868.se.tsv <== BRADI_1g14170v3 1185 BRADI_1g53295v3 59 BRADI_1g59795v3 431 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 400 BRADI_1g74790v3 449 BRADI_1g09890v3 2 BRADI_1g77505v3 388 BRADI_1g48960v3 0 SRR11389868 completed mapping pipeline successfully