Starting /dee2/code/volunteer_pipeline.sh SRR11389869 current disk space = 1544495149056 free memory = 1596954288 SRR11389869 SRAfilesize ee6f99eaf8a3a7c5eb70b5471ce4988a SRR11389869.sra SRR11389869.sra file validated SRR11389869 is paired end SRR11389869 is conventional basespace SRR11389869 read1 length is 46-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 46-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.197 32.0 32.0 32.0 32.0 32.0 2 31.3815 32.0 32.0 32.0 32.0 32.0 3 31.1695 32.0 32.0 32.0 32.0 32.0 4 31.313 32.0 32.0 32.0 32.0 32.0 5 31.34775 32.0 32.0 32.0 32.0 32.0 6 33.788 36.0 36.0 36.0 32.0 36.0 7 34.27325 36.0 36.0 36.0 32.0 36.0 8 34.2145 36.0 36.0 36.0 32.0 36.0 9 34.1705 36.0 36.0 36.0 32.0 36.0 10-11 34.181625 36.0 36.0 36.0 32.0 36.0 12-13 34.236125 36.0 36.0 36.0 32.0 36.0 14-15 34.13725 36.0 36.0 36.0 32.0 36.0 16-17 34.085750000000004 36.0 36.0 36.0 32.0 36.0 18-19 33.918625000000006 36.0 36.0 36.0 32.0 36.0 20-21 34.0355 36.0 36.0 36.0 32.0 36.0 22-23 33.836 36.0 36.0 36.0 32.0 36.0 24-25 33.747125 36.0 36.0 36.0 32.0 36.0 26-27 33.47025 36.0 36.0 36.0 27.0 36.0 28-29 33.431875000000005 36.0 36.0 36.0 27.0 36.0 30-31 33.596000000000004 36.0 36.0 36.0 27.0 36.0 32-33 33.38175 36.0 36.0 36.0 27.0 36.0 34-35 33.351625 36.0 36.0 36.0 27.0 36.0 36-37 33.165499999999994 36.0 36.0 36.0 21.0 36.0 38-39 33.2505 36.0 36.0 36.0 24.0 36.0 40-41 33.206500000000005 36.0 36.0 36.0 24.0 36.0 42-43 33.095875 36.0 34.0 36.0 20.5 36.0 44-45 33.033625 36.0 36.0 36.0 14.0 36.0 46-47 32.99950006251563 36.0 34.0 36.0 14.0 36.0 48-49 32.54376094023506 36.0 32.0 36.0 14.0 36.0 50-51 32.709052263065765 36.0 32.0 36.0 14.0 36.0 52-53 32.581840557688196 36.0 32.0 36.0 14.0 36.0 54-55 32.58629314657328 36.0 32.0 36.0 14.0 36.0 56-57 32.67925944458344 36.0 32.0 36.0 14.0 36.0 58-59 32.35211585177167 36.0 32.0 36.0 14.0 36.0 60-61 32.0639778851849 36.0 32.0 36.0 14.0 36.0 62-63 31.815850878601573 36.0 32.0 36.0 14.0 36.0 64-65 31.773057644110274 36.0 32.0 36.0 14.0 36.0 66-67 31.39653731345159 36.0 32.0 36.0 14.0 36.0 68-69 31.30366098294885 36.0 32.0 36.0 14.0 36.0 70-71 31.359766921289676 36.0 32.0 36.0 14.0 36.0 72-73 31.430904017224414 36.0 32.0 36.0 14.0 36.0 74-75 30.946456461679546 36.0 32.0 36.0 14.0 36.0 76 30.003201707577375 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 7.0 24 11.0 25 25.0 26 30.0 27 66.0 28 114.0 29 192.0 30 293.0 31 365.0 32 580.0 33 810.0 34 1122.0 35 382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.625 9.375 8.85 44.15 2 28.875 9.175 38.45 23.5 3 28.499999999999996 15.125 19.425 36.95 4 32.475 22.625 18.099999999999998 26.8 5 30.049999999999997 26.174999999999997 21.175 22.6 6 27.53292806484296 28.14083080040527 21.403242147923 22.922998986828773 7 20.05 23.9 35.275 20.775 8 21.975 19.950000000000003 30.8 27.275 9 23.425 17.825 31.825 26.924999999999997 10-11 26.174999999999997 27.0625 21.3625 25.4 12-13 26.8125 21.475 23.1875 28.525 14-15 26.200000000000003 22.9375 23.6375 27.224999999999998 16-17 27.6125 22.7625 22.412499999999998 27.212500000000002 18-19 26.974999999999998 22.825 22.725 27.474999999999998 20-21 27.075 22.9375 23.1 26.887499999999996 22-23 26.575 23.3125 23.5 26.6125 24-25 27.650000000000002 21.987499999999997 22.037499999999998 28.325 26-27 26.637499999999996 22.1 23.7625 27.500000000000004 28-29 27.425 22.400000000000002 21.512500000000003 28.6625 30-31 27.025 22.0875 22.900000000000002 27.987499999999997 32-33 25.687500000000004 22.8125 23.4875 28.012500000000003 34-35 26.6125 22.7125 22.675 28.000000000000004 36-37 27.237499999999997 22.15 23.3125 27.3 38-39 26.5125 23.05 22.025 28.4125 40-41 27.494373593398347 22.605651412853213 22.74318579644911 27.156789197299325 42-43 27.77430251470036 22.28199674715376 22.6072813711998 27.336419366946078 44-45 26.540817602200274 22.165270658832352 23.39042380297537 27.903487935992 46-47 27.628453556694588 21.94024253031629 22.577822227778473 27.853481685210653 48-49 27.094273568392097 22.418104526131533 22.305576394098527 28.182045511377847 50-51 26.206551637909474 21.91797949487372 23.10577644411103 28.769692423105774 52-53 27.447792922345883 21.895710891584343 22.683506314868076 27.972989871201705 54-55 27.813906953476735 21.87343671835918 22.07353676838419 28.23911955977989 56-57 27.195396547410557 22.316737553164874 22.904678508881663 27.583187390542907 58-59 27.08046552371418 22.40020022525341 22.287573520210234 28.231760730822174 60-61 27.657443345436334 22.11093026167522 22.42393890071366 27.807687492174782 62-63 27.25450901803607 22.006513026052104 22.382264529058116 28.35671342685371 64-65 28.483709273182956 21.37844611528822 22.468671679197996 27.669172932330827 66-67 26.456949492417596 22.233362576764005 22.596816643689685 28.71287128712871 68-69 27.256770310932797 22.254262788365097 21.978435305917753 28.510531594784354 70-71 27.68439538384345 21.77621675865529 22.829904666332162 27.70948319116909 72-73 27.241856370267893 21.745692365740158 22.160734498805184 28.85171676518677 74-75 27.454353003440062 18.788039163799947 23.564435035723736 30.193172797036254 76 32.479544646033446 0.0 29.455709711846318 38.06474564212024 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 2.5 28 3.0 29 3.0 30 7.5 31 10.5 32 14.0 33 22.0 34 27.0 35 33.0 36 42.0 37 54.5 38 68.0 39 92.0 40 117.5 41 140.5 42 158.0 43 152.5 44 144.0 45 156.5 46 162.0 47 164.0 48 172.0 49 159.0 50 144.5 51 147.0 52 145.5 53 138.0 54 133.0 55 123.5 56 121.0 57 132.5 58 142.0 59 151.5 60 152.5 61 145.5 62 144.5 63 153.0 64 143.5 65 124.5 66 132.5 67 134.0 68 118.0 69 105.0 70 95.5 71 89.0 72 85.0 73 71.0 74 55.0 75 52.0 76 50.0 77 38.5 78 26.0 79 17.5 80 15.5 81 16.0 82 14.0 83 10.0 84 7.0 85 4.0 86 2.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.3 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.08750000000000001 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 1.0 59 1.0 60 1.0 61 0.0 62 2.0 63 1.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 1.0 70 2.0 71 2.0 72 15.0 73 61.0 74 256.0 75 840.0 76 2811.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60193187595323 96.975 2 1.2455516014234875 2.45 3 0.0762582613116421 0.22499999999999998 4 0.05083884087442806 0.2 5 0.0 0.0 6 0.02541942043721403 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389869 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389869_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 56 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6295 32.0 32.0 32.0 32.0 32.0 2 30.469 32.0 32.0 32.0 32.0 32.0 3 30.096 32.0 32.0 32.0 21.0 32.0 4 30.238 32.0 32.0 32.0 21.0 32.0 5 30.425 32.0 32.0 32.0 32.0 32.0 6 33.295 36.0 36.0 36.0 21.0 36.0 7 33.49925 36.0 36.0 36.0 27.0 36.0 8 33.3815 36.0 36.0 36.0 21.0 36.0 9 33.2745 36.0 36.0 36.0 21.0 36.0 10-11 33.27375 36.0 36.0 36.0 21.0 36.0 12-13 33.127250000000004 36.0 36.0 36.0 21.0 36.0 14-15 33.021375 36.0 36.0 36.0 21.0 36.0 16-17 33.102625 36.0 36.0 36.0 21.0 36.0 18-19 32.84625 36.0 36.0 36.0 14.0 36.0 20-21 32.87675 36.0 36.0 36.0 17.5 36.0 22-23 32.78775 36.0 34.0 36.0 14.0 36.0 24-25 32.831625 36.0 36.0 36.0 14.0 36.0 26-27 32.635125 36.0 36.0 36.0 14.0 36.0 28-29 32.8615 36.0 36.0 36.0 14.0 36.0 30-31 32.600875 36.0 32.0 36.0 14.0 36.0 32-33 32.52675 36.0 34.0 36.0 14.0 36.0 34-35 32.50475 36.0 32.0 36.0 14.0 36.0 36-37 32.01717222361494 36.0 32.0 36.0 14.0 36.0 38-39 32.11707194785661 36.0 32.0 36.0 14.0 36.0 40-41 32.07144487486023 36.0 32.0 36.0 14.0 36.0 42-43 32.038239719157474 36.0 32.0 36.0 14.0 36.0 44-45 31.977557673019056 36.0 32.0 36.0 14.0 36.0 46-47 31.864386463734185 36.0 32.0 36.0 14.0 36.0 48-49 31.83918715504265 36.0 32.0 36.0 14.0 36.0 50-51 31.537380832915204 36.0 32.0 36.0 14.0 36.0 52-53 31.267433161611436 36.0 32.0 36.0 14.0 36.0 54-55 31.34065244667503 36.0 32.0 36.0 14.0 36.0 56-57 31.326807228915662 36.0 32.0 36.0 14.0 36.0 58-59 31.02497442187574 36.0 32.0 36.0 14.0 36.0 60-61 30.857016390067958 36.0 32.0 36.0 14.0 36.0 62-63 30.3911612783811 36.0 27.0 36.0 14.0 36.0 64-65 30.585135814889334 36.0 27.0 36.0 14.0 36.0 66-67 30.361343849259075 36.0 27.0 36.0 14.0 36.0 68-69 30.463587728744265 36.0 27.0 36.0 14.0 36.0 70-71 30.402660118095532 36.0 27.0 36.0 14.0 36.0 72-73 30.16608919140645 36.0 27.0 36.0 14.0 36.0 74-75 30.26544124774074 36.0 27.0 36.0 14.0 36.0 76 29.145700071073204 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 9.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 6.0 18 3.0 19 2.0 20 5.0 21 9.0 22 12.0 23 20.0 24 39.0 25 73.0 26 91.0 27 118.0 28 192.0 29 270.0 30 328.0 31 450.0 32 564.0 33 736.0 34 840.0 35 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.94282848545637 18.655967903711137 8.650952858575728 41.75025075225677 2 30.072736393278156 22.04665161775771 29.270127915726107 18.610484073238023 3 25.859041886129923 26.33559066967645 18.53523952846752 29.270127915726107 4 29.7568312860366 29.405866131862624 15.943845575332164 24.893457006768614 5 32.013035848583606 28.854349461017797 17.874153923289047 21.25846076710955 6 25.09400852343946 33.61744798195036 17.548257708698923 23.740285785911254 7 22.727272727272727 15.595178302360624 33.02360622802612 28.653942742340533 8 24.92462311557789 19.396984924623116 22.085427135678394 33.5929648241206 9 25.06914759869248 19.361327633894895 26.527533316570278 29.041991450842342 10-11 28.77643504531722 24.69788519637462 18.65558912386707 27.870090634441087 12-13 26.71784545683363 20.97910898565316 22.38862320664485 29.914422350868364 14-15 28.14982973893303 22.159162567789128 21.98259553537647 27.708412157901375 16-17 27.414880201765445 21.84110970996217 22.244640605296343 28.49936948297604 18-19 28.778520105886802 21.921089121391653 21.429471826547335 27.87091894617421 20-21 28.07459677419355 21.811995967741936 21.824596774193548 28.288810483870968 22-23 28.576826196473554 23.35012594458438 20.680100755667507 27.39294710327456 24-25 28.235442082756883 22.63866180354672 21.04137844296315 28.084517670733238 26-27 27.30246602918973 23.175641670860596 21.22546552591847 28.296426774031204 28-29 28.027159562429272 22.04199673079341 21.564189613982148 28.366654092795173 30-31 26.348886932461323 23.330398691988428 21.796000503081373 28.524713872468872 32-33 28.555262165220675 22.431786747139444 21.287564441091412 27.725386646548472 34-35 28.664822730701534 21.900930349509682 21.624339954739753 27.80990696504903 36-37 28.120281831907395 21.904881731253145 21.074484146955207 28.900352289884246 38-39 27.65475591343734 22.961751383995974 22.15651736285858 27.226975339708105 40-41 28.001510193808205 21.771960734960988 21.94815001258495 28.278379058645857 42-43 28.11164194116168 22.00150867488056 22.089514709580087 27.797334674377673 44-45 28.28930817610063 23.069182389937108 22.050314465408803 26.59119496855346 46-47 28.968553459119494 22.477987421383645 20.729559748427672 27.82389937106918 48-49 27.867203219315893 22.170523138832998 21.265090543259557 28.69718309859155 50-51 28.382796780684107 22.22082494969819 21.856136820925553 27.540241448692154 52-53 28.864293799522073 21.619922022387122 21.292919129669226 28.222865048421582 54-55 28.58762756709084 22.250220486329848 21.20448532191004 27.95766662466927 56-57 28.28333753466095 22.939248802621627 21.23771111671288 27.539702546004534 58-59 29.014759682099157 21.395231487321812 21.193389680837644 28.396619149741394 60-61 27.587077233720343 22.463402322059565 21.580010095911156 28.369510348308935 62-63 28.793430195830698 21.794061907770057 21.528742893240683 27.88376500315856 64-65 28.022741629816807 21.983575489576754 21.42766898294378 28.566013897662668 66-67 28.4794952681388 23.02839116719243 21.438485804416406 27.053627760252365 68-69 27.304830369529576 22.94110228275949 22.184386429562366 27.56968091814857 70-71 29.0798939795532 21.759434557617062 20.762337498422315 28.398333964407424 72-73 27.44227353463588 22.646536412078152 21.644252727734077 28.26693732555189 74-75 29.285905322278683 18.32040652580904 22.98742979406258 29.40625835784969 76 29.340463458110516 0.0 31.550802139037433 39.10873440285205 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 5.5 2 0.0 3 2.0 4 4.0 5 3.0 6 2.5 7 1.5 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 2.5 14 1.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 0.5 26 1.5 27 3.5 28 3.5 29 3.5 30 4.5 31 7.5 32 14.5 33 23.0 34 27.0 35 38.5 36 51.5 37 53.0 38 59.5 39 76.5 40 94.0 41 110.0 42 116.0 43 127.0 44 139.0 45 143.0 46 144.0 47 138.5 48 145.0 49 142.0 50 136.0 51 129.0 52 127.0 53 129.0 54 128.5 55 142.0 56 146.5 57 146.0 58 155.0 59 154.0 60 163.5 61 160.5 62 136.5 63 140.5 64 142.5 65 139.5 66 134.5 67 127.5 68 129.5 69 123.5 70 94.0 71 80.0 72 95.5 73 88.0 74 65.5 75 59.0 76 52.5 77 35.5 78 27.0 79 27.5 80 22.0 81 17.0 82 13.0 83 8.5 84 5.0 85 3.5 86 4.0 87 3.0 88 2.0 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 3.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.325 3 0.325 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.44999999999999996 8 0.5 9 0.575 10-11 0.7000000000000001 12-13 0.675 14-15 0.8875 16-17 0.8750000000000001 18-19 0.8375 20-21 0.8 22-23 0.75 24-25 0.6125 26-27 0.65 28-29 0.5875 30-31 0.6125 32-33 0.5875 34-35 0.575 36-37 0.37603409375783403 38-39 0.37603409375783403 40-41 0.3886172746646609 42-43 0.275827482447342 44-45 0.3259779338014042 46-47 0.2884735983945817 48-49 0.2508780732563974 50-51 0.2508780732563974 52-53 0.25090954710826746 54-55 0.41405269761606023 56-57 0.426706827309237 58-59 0.4645906579608237 60-61 0.43975373790677225 62-63 0.5153343388637506 64-65 0.46529175050301813 66-67 0.3270028927178971 68-69 0.22650056625141565 70-71 0.22667170381564036 72-73 0.2278481012658228 74-75 0.240128068303095 76 0.31982942430703626 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 2.0 59 1.0 60 1.0 61 0.0 62 2.0 63 1.0 64 0.0 65 0.0 66 1.0 67 1.0 68 1.0 69 0.0 70 5.0 71 8.0 72 20.0 73 64.0 74 256.0 75 806.0 76 2814.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49220546894966 96.35000000000001 2 1.2266802964477383 2.4 3 0.1277791975466394 0.375 4 0.07666751852798365 0.3 5 0.0 0.0 6 0.051111679018655765 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025555839509327882 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCT 15 0.0021043753 69.675 63 GACCCAG 15 0.0021043753 69.675 26 CGACCCA 20 0.006578791 52.25625 25 >>END_MODULE Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376810 spots for SRR11389869.sra Written 2376810 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra Read 2376806 spots for SRR11389869.sra Written 2376806 spots for SRR11389869.sra SRR ids: ['SRR11389869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_er624737 SRR11389869.sra spots: 47536124 blocks: [[1, 2376806], [2376807, 4753612], [4753613, 7130418], [7130419, 9507224], [9507225, 11884030], [11884031, 14260836], [14260837, 16637642], [16637643, 19014448], [19014449, 21391254], [21391255, 23768060], [23768061, 26144866], [26144867, 28521672], [28521673, 30898478], [30898479, 33275284], [33275285, 35652090], [35652091, 38028896], [38028897, 40405702], [40405703, 42782508], [42782509, 45159314], [45159315, 47536124]] SRR11389869 file size 9078067 SRR11389869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389869 SRR11389869_1.fastq SRR11389869_2.fastq Input file: SRR11389869_1.fastq Paired file: SRR11389869_2.fastq trimmed: SRR11389869-trimmed-pair1.fastq, SRR11389869-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:45:06 2024 >> started Sat Dec 7 08:45:47 2024 >> done (41.458s) 47536124 read pairs processed; of these: 399 ( 0.00%) short read pairs filtered out after trimming by size control 72269 ( 0.15%) empty read pairs filtered out after trimming by size control 47463456 (99.85%) read pairs available; of these: 19048 ( 0.04%) trimmed read pairs available after processing 47444408 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 6 0.00% 24 8 0.00% 25 8 0.00% 26 13 0.00% 27 6 0.00% 28 9 0.00% 29 13 0.00% 30 16 0.00% 31 16 0.00% 32 14 0.00% 33 15 0.00% 34 18 0.00% 35 1185 0.00% 36 1135 0.00% 37 1342 0.00% 38 1481 0.00% 39 1774 0.00% 40 2025 0.00% 41 2284 0.00% 42 2487 0.01% 43 2768 0.01% 44 2947 0.01% 45 2962 0.01% 46 3091 0.01% 47 3439 0.01% 48 3576 0.01% 49 3677 0.01% 50 4273 0.01% 51 4593 0.01% 52 4813 0.01% 53 5370 0.01% 54 5655 0.01% 55 6145 0.01% 56 6709 0.01% 57 7408 0.02% 58 7783 0.02% 59 8230 0.02% 60 8994 0.02% 61 9230 0.02% 62 9972 0.02% 63 10949 0.02% 64 12156 0.03% 65 12791 0.03% 66 13839 0.03% 67 14979 0.03% 68 14683 0.03% 69 16409 0.03% 70 18854 0.04% 71 24423 0.05% 72 55274 0.12% 73 365371 0.77% 74 2977528 6.27% 75 19788152 41.69% 76 24012548 50.59% 47463456 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=20 prefix-density=0.64 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=10.39 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.2 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=11 prefix-density=0.51 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=42.08 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389869 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:46:15 Started mapping on | Dec 07 08:46:15 Finished on | Dec 07 08:49:06 Mapping speed, Million of reads per hour | 999.23 Number of input reads | 47463456 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 44166420 Uniquely mapped reads % | 93.05% Average mapped length | 150.19 Number of splices: Total | 18358283 Number of splices: Annotated (sjdb) | 17604744 Number of splices: GT/AG | 18121436 Number of splices: GC/AG | 207267 Number of splices: AT/AC | 4827 Number of splices: Non-canonical | 24753 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1516761 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 87446 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1780275 1780275 1780275 N_multimapping 1516761 1516761 1516761 N_noFeature 1010744 43151887 1247275 N_ambiguous 980364 3912 206208 UnstrandedReadsAssigned:42175312 PositiveStrandReadsAssigned:1010621 NegativeStrandReadsAssigned:42712937 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389869 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389869-trimmed-pair1.fastq SRR11389869-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,463,456 reads, 43,619,786 reads pseudoaligned [quant] estimated average fragment length: 201.68 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR11389869.ke.tsv 35125 SRR11389869.se.tsv 88098 total ==> SRR11389869.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 735.52 34.0963 1.3565 PNS24247 1044 843.32 54.1402 1.8786 PNS24249 1928 1727.32 362.172 6.13547 PNS24246 1044 843.32 54.1402 1.8786 PNS24248 1044 843.32 54.1402 1.8786 PNS24244 1471 1270.32 74.3114 1.71178 PNS24243 293 110.025 0 0 KQK14069 1603 1402.32 27139.5 566.319 KQK14071 474 275.591 2239.68 237.808 ==> SRR11389869.se.tsv <== BRADI_1g14170v3 31086 BRADI_1g53295v3 34 BRADI_1g59795v3 1207 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 254 BRADI_1g74790v3 221 BRADI_1g09890v3 0 BRADI_1g77505v3 549 BRADI_1g48960v3 0 SRR11389869 completed mapping pipeline successfully